ID: 1105799064

View in Genome Browser
Species Human (GRCh38)
Location 13:23887952-23887974
Sequence GCAATATGGGCAGGTTGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105799064_1105799070 -1 Left 1105799064 13:23887952-23887974 CCAGTACAACCTGCCCATATTGC 0: 1
1: 1
2: 0
3: 4
4: 101
Right 1105799070 13:23887974-23887996 CTCTCGGGAATTCTAACTATCGG 0: 1
1: 0
2: 0
3: 9
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105799064 Original CRISPR GCAATATGGGCAGGTTGTAC TGG (reversed) Intronic
904493109 1:30872170-30872192 CCAATATGGGCTGATTGTTCTGG + Intronic
905819342 1:40977918-40977940 GCAGCATGGGCAGGTTGTCAGGG + Intergenic
906606720 1:47177885-47177907 GCTACATGTGCAGGATGTACAGG - Intergenic
910182125 1:84496536-84496558 GGTATATGTGCAGGATGTACAGG - Intronic
919792532 1:201301210-201301232 GCAATTTGGTCAGGATGTGCAGG + Intronic
920688474 1:208127967-208127989 GCAAGATGGGCAGGCTGTGCTGG - Intronic
1068707359 10:60091637-60091659 GCAATTTCCGCAGGTTATACAGG - Intronic
1073173542 10:101534470-101534492 GAAATATGGGCAAGTTGTGGAGG - Intronic
1078054349 11:7995097-7995119 GCAATATGCAGAGGATGTACTGG + Exonic
1079891660 11:26063390-26063412 GTAACATGGGTAGGTTGAACAGG + Intergenic
1086767593 11:90717589-90717611 GCAATATGGGAAGGTTGGCTAGG + Intergenic
1093896381 12:24579131-24579153 GAGAGCTGGGCAGGTTGTACTGG - Intergenic
1096143456 12:49262056-49262078 GCAATATGAGGAGATTGGACAGG - Intronic
1100590302 12:96021539-96021561 GCACTATTGGCATGTTGTAGAGG + Intronic
1101644934 12:106622905-106622927 GCAATTTGGGCAGGGTGCAGTGG - Intronic
1103029988 12:117605413-117605435 GCTACATGTGCAGGATGTACAGG + Intronic
1105539178 13:21299672-21299694 ACAATATGGGCAGGTTGTACTGG + Intergenic
1105799064 13:23887952-23887974 GCAATATGGGCAGGTTGTACTGG - Intronic
1107432235 13:40350533-40350555 GCAAAATGAGGAGGTTGAACTGG + Intergenic
1111150829 13:84252071-84252093 GGAATATGTGCAGGATGTGCAGG + Intergenic
1111391432 13:87600641-87600663 GCAAAATTGGCAGGGTGTATGGG - Intergenic
1116911511 14:50471037-50471059 GGTATATGTGCAGGATGTACAGG + Intronic
1124126617 15:26943128-26943150 TCACTTTGGGCATGTTGTACTGG + Intronic
1125875273 15:43138370-43138392 GCAATAATGGGAGGTTGTCCAGG + Intronic
1127736961 15:61850523-61850545 GCAATATGGGCTGGGTGCAGTGG + Intergenic
1127835862 15:62790503-62790525 GTAAAATGGGGAGGTTGAACTGG + Intronic
1132211539 15:100027054-100027076 GCATTATGGGCAGGGAGAACAGG + Intronic
1132247477 15:100308947-100308969 GCAAAATGGGCAGCTTGCTCAGG + Intronic
1136067557 16:27769061-27769083 GCCAGATGGCCAGGTTCTACTGG - Intronic
1139230659 16:65279115-65279137 GCAACATGTGCAGGTTGTGGTGG + Intergenic
1140276696 16:73515299-73515321 TCAATAGGAGCAGGATGTACTGG + Intergenic
1146384723 17:32359654-32359676 GCACTATGGGCAGGCAGTGCAGG + Intronic
1147222769 17:38948677-38948699 GCAAGATGTGCAGGTTACACAGG + Intronic
1148465805 17:47864687-47864709 GAAATATGGGCAGCTCTTACAGG + Intergenic
1150690818 17:67365793-67365815 GCCATAAGGGAAGGTTTTACAGG - Intronic
1151702162 17:75749238-75749260 GCAAAATGGGCTGGGTATACTGG + Intronic
1156210356 18:34933517-34933539 GCAATGTGGGTAAGCTGTACTGG - Intergenic
1160582921 18:79897936-79897958 GCGATATGAGCAGGTTGTAAAGG - Intronic
1161274979 19:3410877-3410899 GCCACATGGCCAGGTTGTGCTGG + Intronic
1165006974 19:32815211-32815233 GAAATATGGGCAGGTGGTGGGGG - Intronic
1166527534 19:43522001-43522023 ACAAAATGGGCAGGTTGTGGTGG - Intronic
1168441919 19:56375909-56375931 GCAAGAGGGGCTGGTTTTACAGG - Intronic
926517396 2:13865239-13865261 CCAAGATAGGCATGTTGTACTGG + Intergenic
927458648 2:23278696-23278718 GGAATATGGGCAGGATGGATGGG + Intergenic
929017950 2:37519235-37519257 GCAATATGGGCTGGGTGCAGTGG - Intergenic
939038995 2:137165335-137165357 GGAATATAGGCAGGTGGTCCTGG - Intronic
940559181 2:155272765-155272787 GTTACATGTGCAGGTTGTACAGG + Intergenic
940561384 2:155301579-155301601 GTAATATGGGCAGGGTGTGGTGG + Intergenic
944761119 2:202814981-202815003 ACAATATGTGCAGTTTGCACAGG - Intronic
947321058 2:228919523-228919545 GCAATATGGGCAACTCCTACTGG + Intronic
947459717 2:230293215-230293237 ACAATTGGGGCAGGTTGTGCAGG + Intronic
1170771713 20:19338545-19338567 ATCATATGGGCAGGTTGGACAGG - Intronic
1172659342 20:36556901-36556923 ACAATATGGGCATGTTATATTGG + Intergenic
1173095324 20:40022345-40022367 GCAAAATGAGAAGGTTGTAGTGG + Intergenic
1176349510 21:5781228-5781250 GGTATATGGGCAGGATGTGCAGG - Intergenic
1176356324 21:5901812-5901834 GGTATATGGGCAGGATGTGCAGG - Intergenic
1176365206 21:6028670-6028692 ACAATCTGGGCCGGTGGTACTGG - Intergenic
1176543831 21:8179298-8179320 GGTATATGGGCAGGATGTGCAGG - Intergenic
1176562782 21:8362343-8362365 GGTATATGGGCAGGATGTGCAGG - Intergenic
1179758312 21:43509875-43509897 ACAATCTGGGCCGGTGGTACTGG + Intergenic
1183655855 22:39184369-39184391 GCCAGATGGGCAGCTGGTACTGG - Intergenic
1185393428 22:50574712-50574734 GCAGCATGTGCAGGATGTACTGG - Intronic
1203248698 22_KI270733v1_random:95519-95541 GGTATATGGGCAGGATGTGCAGG - Intergenic
951711936 3:25592107-25592129 GGAATATGGGCAGGATGGAGAGG + Intronic
954970317 3:54646277-54646299 GATATATGTGCAGGTTGTGCAGG + Intronic
959997510 3:112695076-112695098 GCCAAATGGGAAAGTTGTACAGG - Intergenic
960330883 3:116359599-116359621 GGTACATGTGCAGGTTGTACAGG + Intronic
962093316 3:132268307-132268329 GAAAACAGGGCAGGTTGTACTGG - Intronic
965737528 3:171837214-171837236 GCAAAATGTGGAGGTTGGACTGG - Intergenic
970868930 4:20791943-20791965 CCAATATGGGCAGGGTAGACTGG - Intronic
975674861 4:76816509-76816531 GCAGAATGTGCAGGTTGTATAGG - Intergenic
978500174 4:109400932-109400954 GCAGTAGGGGCTGGTTGTACTGG - Intergenic
985759852 5:1742789-1742811 GAAAGGTGGACAGGTTGTACAGG + Intergenic
986639379 5:9857543-9857565 GGTATATGTGCAGGATGTACAGG - Intergenic
991991431 5:72343837-72343859 TCAATATGGGCAGGCTGAATGGG - Intronic
993301219 5:86213442-86213464 GCTATATGGGAAGGATGTGCAGG + Intergenic
996468687 5:123833917-123833939 GCAATGGAAGCAGGTTGTACTGG + Intergenic
997646333 5:135484482-135484504 TGAATGTGGGCAGGGTGTACTGG + Intergenic
999397994 5:151242784-151242806 GCAAGACTGGTAGGTTGTACTGG + Intronic
1002969967 6:2005633-2005655 GACAAATGGGTAGGTTGTACTGG - Intronic
1003673869 6:8184945-8184967 GCTACATGTGCAGGATGTACAGG + Intergenic
1003691502 6:8358866-8358888 GCAATGTGTGAAGGTTCTACAGG + Intergenic
1009902601 6:69826879-69826901 GCAATATTAGCAGGCTGTCCAGG - Intergenic
1010735939 6:79443749-79443771 GCAATATGGACAGGCTGAATTGG - Intergenic
1016738481 6:147506275-147506297 AAAAAATGGGCAGGTTGTATGGG - Intergenic
1017077511 6:150632491-150632513 GCAAGGTGGGCAGGTTGGAGAGG + Intronic
1018559343 6:165085402-165085424 ACCATGTGGGCAGGTAGTACCGG - Intergenic
1022893056 7:34720456-34720478 GAAATATGGGCAGGATGTAGGGG + Intronic
1023103325 7:36740474-36740496 GCAAACTGGGCAGGTGGAACAGG - Intergenic
1023579312 7:41664309-41664331 GCAATATGAGTAGCTTGGACAGG + Intergenic
1030648019 7:112085958-112085980 GTAATATGGGCTGGCTGTATAGG + Intronic
1036093093 8:5690768-5690790 GGTATGTGGGCAGGATGTACAGG + Intergenic
1039615169 8:38949981-38950003 GCATTCTGGGCAGATTGAACAGG - Intronic
1041911393 8:63092496-63092518 GGAATATTGGCTGGTTGTGCTGG - Intergenic
1044222584 8:89686649-89686671 GCAGAATGTGCAGGTTGTAAAGG + Intergenic
1052448881 9:28600322-28600344 GCAATATTGTCATGTTGTAATGG - Intronic
1054810307 9:69429040-69429062 CCGTTATGTGCAGGTTGTACAGG + Exonic
1055267448 9:74512664-74512686 GCATTATGGGCATTTTGGACAGG - Intronic
1055279745 9:74660803-74660825 GCACTATTGGCATGTTGCACTGG + Intronic
1055308996 9:74958987-74959009 GCAATCTGGGCAGGGTGTGGTGG + Intergenic
1058131789 9:101261948-101261970 GGTATATGTGCAGGATGTACGGG - Intronic
1061258141 9:129464803-129464825 GCAATAAGGGCAGCTGGTTCTGG - Intergenic
1186963847 X:14766013-14766035 GCACTAGGGGCAGGTATTACTGG + Intergenic
1195645744 X:107229013-107229035 GCAATATGGGCATTTTGTGTAGG - Intronic
1197338790 X:125241164-125241186 ACAAAATGGGCTGGGTGTACTGG + Intergenic
1197677960 X:129351116-129351138 GCAAACTTGGTAGGTTGTACAGG - Intergenic
1200910099 Y:8524252-8524274 GCAATGAGGACAGGTTGTAGGGG - Intergenic