ID: 1105799164

View in Genome Browser
Species Human (GRCh38)
Location 13:23888911-23888933
Sequence CCGGACCCGACACTCTGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 39}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105799164 Original CRISPR CCGGACCCGACACTCTGGGT AGG Intronic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
902779738 1:18697277-18697299 CCTGACCAGAGATTCTGGGTAGG + Intronic
903625568 1:24727693-24727715 AAGGACCAGACACTGTGGGTTGG + Intergenic
915248634 1:154572927-154572949 CCCGACCCCGCACTTTGGGTAGG + Intronic
921692060 1:218163841-218163863 CCCGACCCCACACCCTAGGTGGG - Intergenic
1075828600 10:125383587-125383609 CTGGACCTGACATTCTTGGTTGG + Intergenic
1079908570 11:26280597-26280619 CCTCACCCGCCAATCTGGGTGGG - Intergenic
1102859098 12:116320015-116320037 CCCGTCCTGACCCTCTGGGTTGG + Intergenic
1104841903 12:131829544-131829566 CCTGGCCCGACTCCCTGGGTAGG - Intronic
1104925211 12:132310432-132310454 CCGGCCCCGTCCTTCTGGGTGGG - Intronic
1105737629 13:23287512-23287534 CCTGGTCAGACACTCTGGGTAGG + Intronic
1105799164 13:23888911-23888933 CCGGACCCGACACTCTGGGTAGG + Intronic
1113839856 13:113353016-113353038 CCCAGCCCCACACTCTGGGTAGG + Intronic
1113839868 13:113353061-113353083 CCCAGCCCCACACTCTGGGTAGG + Intronic
1113839880 13:113353106-113353128 CCCAGCCCCACACTCTGGGTAGG + Intronic
1113839892 13:113353151-113353173 CCCAGCCCCACACTCTGGGTAGG + Intronic
1113839905 13:113353196-113353218 CCCAGCCCCACACTCTGGGTAGG + Intronic
1122984128 14:105204410-105204432 CCGGGCCCGACACCCTGAGCTGG + Intergenic
1129034957 15:72643278-72643300 CTGGACCTGACACTCAGGGAAGG - Intergenic
1129214925 15:74093938-74093960 CTGGACCTGACACTCAGGGAAGG + Intergenic
1129473830 15:75769943-75769965 CTGGACCTGACACTCAGGGAAGG + Intergenic
1142003109 16:87675327-87675349 GCAGCACCGACACTCTGGGTTGG - Intronic
1154200113 18:12293840-12293862 CCCAACCCGAGACTCAGGGTAGG - Intergenic
1157618926 18:49004085-49004107 CTGAACCAGAGACTCTGGGTGGG + Intergenic
1166302735 19:41921618-41921640 CCGCACCGGAGACCCTGGGTTGG + Intronic
930618183 2:53615828-53615850 CGGGACCAGACATTCTTGGTTGG - Intronic
942045329 2:172096450-172096472 CCGGCCCCGAGACTCCGGGATGG - Intergenic
1169016381 20:2296137-2296159 CCTGGCCGGACACTCTGGCTTGG - Intronic
1171010269 20:21505771-21505793 CCTGACCCCACGGTCTGGGTCGG + Intergenic
1172606829 20:36219719-36219741 CCTTACCTGACACCCTGGGTGGG + Intronic
1180859599 22:19070136-19070158 CAGCACCCGACACTCTGGGTAGG + Intronic
1181198917 22:21206594-21206616 CTGGACCCGACACGCTGGTGGGG - Intergenic
1181648568 22:24246709-24246731 CTGGACCCGACACGCTGGTGGGG - Intergenic
1181729148 22:24831984-24832006 GCTGCCCCGACTCTCTGGGTGGG - Intronic
1185089924 22:48760635-48760657 CCGGATCCCACACTCTGGGCAGG - Intronic
1203227888 22_KI270731v1_random:88243-88265 CTGGACCCGACACGCTGGTGGGG + Intergenic
965185727 3:165460305-165460327 CCCGACCCAACAATGTGGGTGGG + Intergenic
979271389 4:118766613-118766635 CCTGAGCCGACACTTTGGGTAGG + Intronic
991975945 5:72183855-72183877 CCGGGCCCCACACACTGGATAGG + Intronic
1000087748 5:157902973-157902995 CCGGCACTGACACTCTGGTTGGG + Intergenic
1001276800 5:170357201-170357223 CCGGACCCTGCACTGTGGCTCGG + Intronic
1057321396 9:94016315-94016337 CCTGCCCTTACACTCTGGGTAGG - Intergenic
1199601754 X:149545251-149545273 CCGGACTCTCCACTCTGGCTAGG + Intronic