ID: 1105801058

View in Genome Browser
Species Human (GRCh38)
Location 13:23903650-23903672
Sequence TGCACCGCGGGCGGCCCCGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 81}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105801046_1105801058 10 Left 1105801046 13:23903617-23903639 CCCTCCCGCCCGCGTCGCCTGGC 0: 1
1: 0
2: 1
3: 14
4: 231
Right 1105801058 13:23903650-23903672 TGCACCGCGGGCGGCCCCGACGG 0: 1
1: 1
2: 0
3: 4
4: 81
1105801047_1105801058 9 Left 1105801047 13:23903618-23903640 CCTCCCGCCCGCGTCGCCTGGCC 0: 1
1: 0
2: 4
3: 32
4: 372
Right 1105801058 13:23903650-23903672 TGCACCGCGGGCGGCCCCGACGG 0: 1
1: 1
2: 0
3: 4
4: 81
1105801050_1105801058 2 Left 1105801050 13:23903625-23903647 CCCGCGTCGCCTGGCCTCGAACC 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1105801058 13:23903650-23903672 TGCACCGCGGGCGGCCCCGACGG 0: 1
1: 1
2: 0
3: 4
4: 81
1105801052_1105801058 -7 Left 1105801052 13:23903634-23903656 CCTGGCCTCGAACCGCTGCACCG 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1105801058 13:23903650-23903672 TGCACCGCGGGCGGCCCCGACGG 0: 1
1: 1
2: 0
3: 4
4: 81
1105801049_1105801058 5 Left 1105801049 13:23903622-23903644 CCGCCCGCGTCGCCTGGCCTCGA 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1105801058 13:23903650-23903672 TGCACCGCGGGCGGCCCCGACGG 0: 1
1: 1
2: 0
3: 4
4: 81
1105801044_1105801058 17 Left 1105801044 13:23903610-23903632 CCGAGCTCCCTCCCGCCCGCGTC 0: 1
1: 0
2: 0
3: 56
4: 400
Right 1105801058 13:23903650-23903672 TGCACCGCGGGCGGCCCCGACGG 0: 1
1: 1
2: 0
3: 4
4: 81
1105801051_1105801058 1 Left 1105801051 13:23903626-23903648 CCGCGTCGCCTGGCCTCGAACCG 0: 1
1: 0
2: 1
3: 4
4: 129
Right 1105801058 13:23903650-23903672 TGCACCGCGGGCGGCCCCGACGG 0: 1
1: 1
2: 0
3: 4
4: 81
1105801048_1105801058 6 Left 1105801048 13:23903621-23903643 CCCGCCCGCGTCGCCTGGCCTCG 0: 1
1: 0
2: 2
3: 12
4: 187
Right 1105801058 13:23903650-23903672 TGCACCGCGGGCGGCCCCGACGG 0: 1
1: 1
2: 0
3: 4
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105801058 Original CRISPR TGCACCGCGGGCGGCCCCGA CGG Intergenic
905177915 1:36149498-36149520 TGCCCCGCGGGAGGCCGCGCAGG - Intronic
913942262 1:125119599-125119621 TGCACTGCGCTCGGCCCCGATGG + Intergenic
914821473 1:151107612-151107634 TTCACCGCGCCCGGCCCTGATGG + Intronic
1065968139 10:30785219-30785241 TGCACCGCGGGGGGCGGCGCTGG - Intergenic
1067474426 10:46556624-46556646 TGCTCCGCGGGCCGGGCCGACGG - Intergenic
1072501500 10:96022844-96022866 TGCACAGCAGGAGGCCCTGAGGG + Intronic
1076693858 10:132237646-132237668 TGCACCGGGGCCAGCCCCGCCGG - Intronic
1076939204 10:133590486-133590508 TGCACTGGGGGCTGCCCAGAGGG + Intergenic
1077281609 11:1748600-1748622 TCCACCGCGGGCTGCACCGCGGG + Intronic
1077514169 11:2991935-2991957 TGCGCCGCGGGCGGCCTCCTGGG - Intronic
1078076754 11:8169068-8169090 CGAACCGCGGGCGGCGCGGACGG + Intergenic
1078449453 11:11429463-11429485 TGCACGGCGGGAGCCCCAGAGGG - Intronic
1080659129 11:34281555-34281577 TGCCCAGCGGGAGTCCCCGAAGG - Intronic
1080677209 11:34439090-34439112 TGCTCCCCGAGCGGGCCCGAAGG + Intronic
1083272915 11:61580993-61581015 TGCTCCGCGGGCGGGCGGGAGGG - Intronic
1090636934 11:128695087-128695109 TGCAACGGAGGCGGCTCCGAAGG - Intronic
1091586586 12:1820390-1820412 GGCACCACGGCCGGCCGCGAGGG - Exonic
1096503572 12:52079864-52079886 TGCACCGCGCGCGGCCCCTCGGG - Intergenic
1105801058 13:23903650-23903672 TGCACCGCGGGCGGCCCCGACGG + Intergenic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1106226899 13:27792898-27792920 GGCAGCGCGGGCGGCCCGGGGGG - Exonic
1107624803 13:42271857-42271879 TGCCCCGCGGGCTGCTCCGCGGG + Intergenic
1115203024 14:30874281-30874303 TGGAGGGCCGGCGGCCCCGACGG - Intergenic
1118343300 14:64914556-64914578 TGGCCCGCGGGCGGCCCCCGAGG + Intronic
1119262517 14:73245945-73245967 TCCACCTCCGGCGGCTCCGATGG + Intronic
1122418706 14:101562383-101562405 TGCACGGCGCTCGGCCCCGGAGG + Exonic
1122919457 14:104874060-104874082 TGCCCCGTGGGCAGCCCTGAGGG - Intronic
1124237767 15:28004435-28004457 TGCCCCGCTGGCGTCCCCGCAGG - Intronic
1125536032 15:40441544-40441566 TGCAAGGCGGGCGGCCCCCGGGG - Intronic
1131108625 15:89750733-89750755 GGCACAGCGGGCAGCCCCGAGGG + Exonic
1131112961 15:89776831-89776853 GGCACAGCGGGCAGCCCCAAGGG - Exonic
1131257486 15:90871822-90871844 GGCCCCGGGGCCGGCCCCGAGGG + Intronic
1132806714 16:1778382-1778404 TGCACTGCGGGCGGGCCTGGGGG - Intronic
1136696277 16:32084484-32084506 TGCGCTGCGCTCGGCCCCGATGG - Intergenic
1136778985 16:32885578-32885600 GGCACCGGGGAGGGCCCCGAGGG + Intergenic
1136796772 16:33027736-33027758 TGCGCTGCGCTCGGCCCCGATGG - Intergenic
1136891633 16:33975940-33975962 GGCACCGGGGAGGGCCCCGAGGG - Intergenic
1142049934 16:87951610-87951632 TGCGGCGCGGGCGGCCCGGCGGG - Intronic
1203081396 16_KI270728v1_random:1147667-1147689 GGCACCGGGGAGGGCCCCGAGGG + Intergenic
1147135520 17:38431872-38431894 TGCACTGAGGGGGGCCACGAAGG - Intronic
1151612045 17:75182686-75182708 TGAGCCGCGGCCGGCCCCGTGGG + Intergenic
1152335274 17:79697100-79697122 TACAGCTCGGGAGGCCCCGATGG - Intergenic
1152626095 17:81388569-81388591 TGCCCTGCGGGATGCCCCGAGGG + Intergenic
1153964153 18:10165696-10165718 AGCACCGCTGAGGGCCCCGAGGG + Intergenic
1160909460 19:1468072-1468094 TGGACGGCCGGCGGCTCCGAGGG - Exonic
1161355882 19:3819405-3819427 AGTACCTCGGGCTGCCCCGATGG + Intronic
1163301965 19:16453350-16453372 AGCACCGTGGGAGGCCCCGGTGG - Intronic
929174235 2:38960560-38960582 TGCGCCGCGGGCGGCGACGGCGG - Exonic
932772121 2:74506289-74506311 GCCACCGCGCCCGGCCCCGAAGG - Intronic
933869276 2:86550126-86550148 AGCACCCCGGGAGGCCACGACGG + Intronic
934655749 2:96116239-96116261 CGCCCCTCGGGCGGCGCCGAGGG + Exonic
936619749 2:114083030-114083052 TGCAACGCGGGCTCCCACGAAGG - Intergenic
940140199 2:150485357-150485379 TGAACCGCTGGAGCCCCCGAGGG - Intronic
942450912 2:176107617-176107639 AGCAGCGGGGGCGGCCCCGGCGG + Exonic
948290269 2:236819302-236819324 TGCAGGGCAGGTGGCCCCGAGGG + Intergenic
1180785826 22:18547173-18547195 TGCAACGTGGGCAGCCCTGAGGG - Intergenic
1181131110 22:20732898-20732920 TGCCACGTGGGCTGCCCCGAGGG - Intronic
1181242751 22:21486727-21486749 TGCAACGTGGGCAGCCCTGAGGG - Intergenic
1182122995 22:27799003-27799025 TGCTGCAGGGGCGGCCCCGAAGG + Exonic
1182296047 22:29311677-29311699 TGGATCGCGGCCGGCCCCGGGGG + Intronic
1183068577 22:35380716-35380738 TGCACCCCAGGCGTCCCAGAAGG - Intronic
1183259866 22:36787751-36787773 TGCATCCCAGGCGGCCCCGCAGG + Intergenic
1184732431 22:46378153-46378175 TGCCCTGCGTGTGGCCCCGAGGG + Intronic
962808705 3:138944935-138944957 TACACCGCGGGCGGGCGCGGAGG - Exonic
966886591 3:184380558-184380580 GGCGCGGCGGGCGGCCCGGAGGG + Intronic
968609088 4:1549043-1549065 TGCACTGCAGGCAGCCCAGAGGG + Intergenic
971018936 4:22515632-22515654 AGCACGATGGGCGGCCCCGAGGG - Exonic
973696750 4:53497727-53497749 TGTACTGCGGCCTGCCCCGAGGG + Intronic
974260460 4:59518681-59518703 TGCACCGAGGACTGCCGCGATGG - Intergenic
984795705 4:183658801-183658823 GGCACCCCGGCCGGCTCCGAGGG + Intronic
985472169 5:53266-53288 TGGGCCGCGGGAGGGCCCGAGGG + Intergenic
987286950 5:16466209-16466231 GGCTCCGAGGTCGGCCCCGAGGG - Intergenic
990003799 5:50922802-50922824 TGCACTGCAGGCAGCCCAGAGGG - Intergenic
1013369231 6:109455515-109455537 TGGACCGCGGGCGGCAGCGGTGG + Intronic
1015843050 6:137493494-137493516 TGCAGCGCGGGCGGCGTGGAGGG + Exonic
1026036382 7:66833097-66833119 GCAACCGCGGGGGGCCCCGACGG - Intergenic
1028762530 7:94510583-94510605 TGCGCCCCGGGCTGCCCCCAAGG - Intronic
1031997292 7:128241104-128241126 TGCACCTCGCGGGGCCTCGAGGG - Intergenic
1042591559 8:70402947-70402969 AGCACCGCGGGCGGACGGGAAGG - Intronic
1055551289 9:77434332-77434354 AGCACCGCGGGCGGCCAGGGTGG + Intronic
1061577764 9:131518250-131518272 AGCACCCCGGGCTGCTCCGAGGG - Intronic
1061863435 9:133479261-133479283 GGCACCGCGTGCGCCCCCGAAGG + Intergenic
1062421532 9:136484676-136484698 TGCACCGCCTGCGGCCCTGCTGG - Exonic
1185736635 X:2500889-2500911 TGCGGCGCGGGCGGCCCTGCGGG - Exonic
1186466063 X:9785800-9785822 CGCACCGCGGGCTGCCGCGCAGG - Intronic
1192428395 X:71096658-71096680 TCCACCTCGGGCGGCTCGGACGG - Exonic
1200100820 X:153688476-153688498 GGCACCGGGGAGGGCCCCGAGGG - Exonic