ID: 1105801058

View in Genome Browser
Species Human (GRCh38)
Location 13:23903650-23903672
Sequence TGCACCGCGGGCGGCCCCGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 81}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105801047_1105801058 9 Left 1105801047 13:23903618-23903640 CCTCCCGCCCGCGTCGCCTGGCC 0: 1
1: 0
2: 4
3: 32
4: 372
Right 1105801058 13:23903650-23903672 TGCACCGCGGGCGGCCCCGACGG 0: 1
1: 1
2: 0
3: 4
4: 81
1105801048_1105801058 6 Left 1105801048 13:23903621-23903643 CCCGCCCGCGTCGCCTGGCCTCG 0: 1
1: 0
2: 2
3: 12
4: 187
Right 1105801058 13:23903650-23903672 TGCACCGCGGGCGGCCCCGACGG 0: 1
1: 1
2: 0
3: 4
4: 81
1105801051_1105801058 1 Left 1105801051 13:23903626-23903648 CCGCGTCGCCTGGCCTCGAACCG 0: 1
1: 0
2: 1
3: 4
4: 129
Right 1105801058 13:23903650-23903672 TGCACCGCGGGCGGCCCCGACGG 0: 1
1: 1
2: 0
3: 4
4: 81
1105801050_1105801058 2 Left 1105801050 13:23903625-23903647 CCCGCGTCGCCTGGCCTCGAACC 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1105801058 13:23903650-23903672 TGCACCGCGGGCGGCCCCGACGG 0: 1
1: 1
2: 0
3: 4
4: 81
1105801052_1105801058 -7 Left 1105801052 13:23903634-23903656 CCTGGCCTCGAACCGCTGCACCG 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1105801058 13:23903650-23903672 TGCACCGCGGGCGGCCCCGACGG 0: 1
1: 1
2: 0
3: 4
4: 81
1105801044_1105801058 17 Left 1105801044 13:23903610-23903632 CCGAGCTCCCTCCCGCCCGCGTC 0: 1
1: 0
2: 0
3: 56
4: 400
Right 1105801058 13:23903650-23903672 TGCACCGCGGGCGGCCCCGACGG 0: 1
1: 1
2: 0
3: 4
4: 81
1105801046_1105801058 10 Left 1105801046 13:23903617-23903639 CCCTCCCGCCCGCGTCGCCTGGC 0: 1
1: 0
2: 1
3: 14
4: 231
Right 1105801058 13:23903650-23903672 TGCACCGCGGGCGGCCCCGACGG 0: 1
1: 1
2: 0
3: 4
4: 81
1105801049_1105801058 5 Left 1105801049 13:23903622-23903644 CCGCCCGCGTCGCCTGGCCTCGA 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1105801058 13:23903650-23903672 TGCACCGCGGGCGGCCCCGACGG 0: 1
1: 1
2: 0
3: 4
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105801058 Original CRISPR TGCACCGCGGGCGGCCCCGA CGG Intergenic