ID: 1105802298

View in Genome Browser
Species Human (GRCh38)
Location 13:23917583-23917605
Sequence CAGCATTAGATCATCAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 1, 2: 2, 3: 21, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105802293_1105802298 16 Left 1105802293 13:23917544-23917566 CCACATAATCAATAGTGGAGGAC 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1105802298 13:23917583-23917605 CAGCATTAGATCATCAAGGCAGG 0: 1
1: 1
2: 2
3: 21
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105802298 Original CRISPR CAGCATTAGATCATCAAGGC AGG Intergenic
902491084 1:16781118-16781140 CACCATTAGGTCATCAGGGCTGG + Intronic
904590850 1:31614650-31614672 CAGGATTAGATCAACAAGGCTGG + Intergenic
907792981 1:57685487-57685509 CAGTGTTAGATCAACAAGGTAGG + Intronic
914411941 1:147437938-147437960 CAGCATTATAGCAACAAAGCTGG + Intergenic
917752315 1:178065231-178065253 CAGAATCAGTTCATTAAGGCTGG + Intergenic
918307965 1:183264486-183264508 CAGCTTTAGGGCATCATGGCAGG + Intronic
918856543 1:189762800-189762822 CAGCATTTGGGCATGAAGGCAGG + Intergenic
921875219 1:220187987-220188009 TAGCATGAGATCATCACGACAGG - Intronic
923411576 1:233715248-233715270 CAGCCTTATATGTTCAAGGCAGG - Intergenic
923529359 1:234801416-234801438 CACCATTAGGTCATCAGGGCTGG - Intergenic
924661025 1:246016880-246016902 TAGCATTAGACCGACAAGGCAGG - Intronic
1067055814 10:43049266-43049288 CAGCATGAGATCACCAAGGACGG - Intergenic
1072650943 10:97295042-97295064 CAGCCTTAGAAAATCCAGGCTGG + Intergenic
1072831856 10:98666357-98666379 CAGTGTTAGATCATTGAGGCAGG + Intronic
1075179974 10:120202133-120202155 TAGTATGAGATCATCAAGGCAGG - Intergenic
1075441028 10:122479612-122479634 GAGAATGAGATCATCCAGGCCGG + Intronic
1079467635 11:20746844-20746866 CACCATTATATCCTGAAGGCTGG + Intronic
1082929776 11:58590285-58590307 TAGCATTAGATTATTCAGGCTGG - Intronic
1090889740 11:130913256-130913278 CAGAATTAGAACAAAAAGGCAGG + Intronic
1094540664 12:31360878-31360900 CAGCATTAACTCAGCACGGCAGG + Intergenic
1094557890 12:31521079-31521101 CAGCCTTAGATCATTAAAGTTGG + Intronic
1095259214 12:40079665-40079687 CAGTGTTAGATCATCGAGGCAGG - Intronic
1099016962 12:77354895-77354917 CAGCATAAGACAATCAAGACTGG - Intergenic
1100503746 12:95199152-95199174 CAGCATTAGAAGCTCCAGGCTGG + Intronic
1104227896 12:126854243-126854265 AAGCAATTGATCATCAAGCCAGG - Intergenic
1105802298 13:23917583-23917605 CAGCATTAGATCATCAAGGCAGG + Intergenic
1106406587 13:29480060-29480082 CATGGTCAGATCATCAAGGCTGG - Intronic
1107297034 13:38920599-38920621 GAGTATTAGATCATCGAGGCAGG - Intergenic
1107772209 13:43800051-43800073 CAGCATTAGTTGAGAAAGGCAGG - Intergenic
1108163381 13:47666364-47666386 AATAATGAGATCATCAAGGCAGG - Intergenic
1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG + Intronic
1110716755 13:78714485-78714507 CAGCAAAAGATCATAGAGGCTGG - Intergenic
1112341492 13:98556316-98556338 CAGGATCACATCATTAAGGCTGG + Intronic
1116479162 14:45377266-45377288 CAGCACTAAATCATGAAGGCTGG + Intergenic
1118242344 14:64072404-64072426 CAGCATCAGATCACACAGGCTGG + Intronic
1119037168 14:71240248-71240270 CAGCACTGCCTCATCAAGGCAGG - Intergenic
1120587265 14:86328645-86328667 CTGCATCAAATCATCAAGCCTGG + Intergenic
1120917061 14:89719629-89719651 CAGCATTAGATCCAGAAGCCAGG + Intergenic
1121695670 14:95909903-95909925 CAGCAGTAGTTCTTCAAGCCAGG + Intergenic
1122639173 14:103147314-103147336 CAGCTTTATATCACCAATGCAGG + Intergenic
1125093210 15:35819713-35819735 CTGGATGAGATCACCAAGGCAGG - Intergenic
1127443799 15:59039258-59039280 TAGAATTAGAATATCAAGGCCGG - Intronic
1127552450 15:60054166-60054188 CAGCTTTAGATCCTCTAGACAGG - Intronic
1127578379 15:60314421-60314443 CAGCATGAGAACAGCAAGGGGGG + Intergenic
1128519132 15:68364166-68364188 CAGGATTAGATGAAGAAGGCTGG - Intronic
1129727329 15:77908236-77908258 AAGCATCAGATCAACATGGCAGG - Intergenic
1131394453 15:92075539-92075561 GAGCAAGAGCTCATCAAGGCAGG - Intronic
1133940485 16:10305131-10305153 CAGAATTATATCAACATGGCTGG - Intergenic
1135963952 16:27020677-27020699 CAGGAAGAGATCATCAGGGCTGG + Intergenic
1139244372 16:65427242-65427264 CATCTTTAGATCCTCAAGGCTGG + Intergenic
1139268314 16:65659950-65659972 CTGCATTAGACCAGCAAGGGGGG + Intergenic
1150955707 17:69857462-69857484 CAACATTGGATCATCTAAGCTGG + Intergenic
1155523865 18:26697026-26697048 CAGCAATGGATCATCAAGAGAGG - Intergenic
1164122091 19:22275159-22275181 CAGCATTAGATGATGAACCCTGG - Intergenic
1164178322 19:22797501-22797523 CAGCATGAGATAATCAACCCCGG + Intergenic
1166154584 19:40901384-40901406 CTGCATTAGAAAAGCAAGGCTGG + Intergenic
1166173532 19:41049208-41049230 CTGCATTAGAAAAGCAAGGCTGG - Intergenic
926575757 2:14579098-14579120 CAGCATTAGAAGTTCAAAGCTGG - Intergenic
928438695 2:31273369-31273391 CAGCACCAGATCATGATGGCTGG - Intergenic
928483535 2:31707269-31707291 CTGCATTAGTTCATCAACTCAGG + Intergenic
934715728 2:96542221-96542243 CAGCATTAGATGAGCAAGAAGGG - Intronic
938492301 2:131767965-131767987 AATGATTAGATCATGAAGGCAGG - Intergenic
938495268 2:131794385-131794407 AATGATTAGATCATGAAGGCAGG + Intergenic
940338846 2:152558138-152558160 CCGCATACTATCATCAAGGCCGG - Intronic
941026833 2:160465601-160465623 CAGCATTGAATCATTAAAGCAGG + Intronic
942825237 2:180167869-180167891 CTGCATGAGATCTTCAAGGGTGG - Intergenic
944354689 2:198773187-198773209 CAGCATTAAGGCATCAAGGTAGG - Intergenic
948923848 2:241081581-241081603 CTGCATCAGGTCATCAAGGAAGG + Intronic
1173040891 20:39461238-39461260 CTGCCTTAGATCATAAAGGCTGG - Intergenic
1173155382 20:40604224-40604246 CATCATTGGATCCTTAAGGCAGG - Intergenic
1174223329 20:48975503-48975525 TAGAATTAGCTCATCAAGGCTGG + Intronic
1174468717 20:50739081-50739103 CAGCATGAGAGCATCAAGCCTGG + Intronic
1176709584 21:10137766-10137788 AATGATTAGATCATGAAGGCAGG - Intergenic
1177535064 21:22414933-22414955 CAGCATAACATCTTCAATGCTGG - Intergenic
1180859180 22:19067321-19067343 GGGCATGAGATCATCAAGGAAGG - Intronic
1181588808 22:23870090-23870112 CAGCACTGGATCAGCAAGACTGG + Intronic
950948190 3:16972548-16972570 CAATGTTAGATCATCAAGGCAGG - Intronic
956650692 3:71501921-71501943 CAGAGTGAGATCAGCAAGGCAGG + Intronic
958739593 3:98052663-98052685 CTGCTTTAGATCAACAAGGCAGG + Intergenic
959879403 3:111425775-111425797 CAGTATTAGATCACTGAGGCAGG + Intronic
962350000 3:134649781-134649803 CAGCATTACTTAAGCAAGGCAGG + Intronic
963615057 3:147526454-147526476 CAGTATTAGATCATTAAGGCAGG - Intergenic
963925584 3:150947481-150947503 CAGTATTAGATCATGGAGGCAGG + Intronic
965570276 3:170165454-170165476 CAGAATTATATGATGAAGGCTGG + Intronic
973673877 4:53244165-53244187 CAGTATTAGATCATTGAGGCAGG + Intronic
973748698 4:53990165-53990187 CATCATTAAATCATCAATACAGG - Intronic
975143371 4:70940222-70940244 CAGCATTTGGGCATAAAGGCAGG + Intronic
977067089 4:92332343-92332365 CAGCATTAGATCATTCATGAAGG + Intronic
977332663 4:95657267-95657289 CAGTATTAGATCATCAAGGCAGG - Intergenic
977865707 4:102025213-102025235 CAGCATTTCATCATGAAAGCAGG + Exonic
984456169 4:179972194-179972216 CAGCATGTGATAATCAAAGCTGG - Intergenic
987617465 5:20295292-20295314 CTGCCTTAGATAATCATGGCAGG + Intronic
989165156 5:38426590-38426612 TAGCCTTACATAATCAAGGCTGG + Intronic
990637582 5:57746667-57746689 CAGCAGTACATCAGGAAGGCTGG + Intergenic
990733869 5:58838753-58838775 CAGCATTGGGTCATCCAGACAGG - Intronic
995206838 5:109489337-109489359 AAGCATTCCATCATCAAGCCAGG - Intergenic
1000430609 5:161147812-161147834 CAGCATTAGACCCATAAGGCAGG - Intergenic
1001010656 5:168094896-168094918 CAGCATTAGATTATCATAGGAGG + Intronic
1001135564 5:169099811-169099833 CTGCATTAGGTCAAGAAGGCAGG + Intronic
1003516108 6:6820228-6820250 CAGAAATAGATCATGAAGCCAGG - Intergenic
1005468320 6:26137024-26137046 CAGCATTAGAATATAAAAGCTGG - Intronic
1006384505 6:33722506-33722528 CAGCATTAGAGCATAATGCCAGG + Exonic
1007176110 6:39898812-39898834 CAGCCTTAGCACCTCAAGGCGGG + Intronic
1007478238 6:42133439-42133461 CAGCATTGGAACATCCAGGTGGG + Intronic
1007879502 6:45147619-45147641 AAGAATTAGATCATCTAGGATGG + Intronic
1014129271 6:117812145-117812167 AGGCATTAGATCAGCCAGGCAGG + Intergenic
1017461415 6:154654634-154654656 CATCATTTTGTCATCAAGGCAGG - Intergenic
1020896816 7:13950759-13950781 CTGAGTTAGATCATCAGGGCTGG - Intronic
1024838339 7:53551966-53551988 TTGCATTAGTTCATCAAGCCAGG - Intergenic
1025014341 7:55426857-55426879 CATCATCACATCATCAAGGCTGG - Intronic
1033572098 7:142640453-142640475 CAGAATTAGATCCTCAACGCAGG + Intergenic
1036496410 8:9273897-9273919 CAGCATCAGTTCATCAGGGAAGG - Intergenic
1037253022 8:16919195-16919217 CTGGATGAGATCATCAAGGGTGG + Intergenic
1039123806 8:34177780-34177802 CAGCATTAGGTCATCAAGATAGG + Intergenic
1039129821 8:34250293-34250315 CAGAATTGGATCACCAAGGGAGG + Intergenic
1041949281 8:63482405-63482427 CAGCATTAAAACATAATGGCAGG + Intergenic
1043971874 8:86538799-86538821 AAGCATGACATCATCAATGCTGG - Intronic
1044554414 8:93546843-93546865 AACTATTAGATCATCAAGTCTGG - Intergenic
1045070908 8:98503954-98503976 CAATATTAGATCAACAAGACAGG - Intronic
1046985534 8:120383948-120383970 CAGCATTAGTTCATTACTGCTGG + Intronic
1047079966 8:121448876-121448898 GAGCATTGGATAATAAAGGCTGG - Intergenic
1047939284 8:129813273-129813295 CAGCATTAGATTATTGAGGCAGG - Intergenic
1048150249 8:131886875-131886897 CAGCATCAGGCCACCAAGGCAGG + Intergenic
1048780675 8:137996539-137996561 GAGTATTAGAGCATGAAGGCAGG - Intergenic
1050478718 9:6067645-6067667 CAGCATGAGCACATAAAGGCTGG - Intergenic
1051205325 9:14682614-14682636 CAACATTAGATCAACGAGACAGG + Intronic
1051518711 9:17960047-17960069 CAGCCTTAGATCATCAGTGTTGG - Intergenic
1052002648 9:23305515-23305537 CTGAATTAGAACACCAAGGCAGG + Intergenic
1052833992 9:33236766-33236788 CAGCATTGTATCATCACTGCTGG - Intronic
1052884593 9:33632331-33632353 CAGAATTAGATCCTCAACGCAGG + Intergenic
1053646555 9:40123298-40123320 AATGATTAGATCATGAAGGCAGG - Intergenic
1053759159 9:41340253-41340275 AATGATTAGATCATGAAGGCAGG + Intergenic
1054327568 9:63721200-63721222 AATGATTAGATCATGAAGGCAGG - Intergenic
1054538015 9:66252675-66252697 AATGATTAGATCATGAAGGCAGG + Intergenic
1061878186 9:133555358-133555380 CAGCAAGAGATGATCCAGGCAGG + Intronic
1202794343 9_KI270719v1_random:106733-106755 AATGATTAGATCATGAAGGCAGG - Intergenic
1188968000 X:36578849-36578871 GATCATTAGATCTTCAAGGGTGG - Intergenic
1188977117 X:36689105-36689127 CAGGACTAGAAGATCAAGGCAGG - Intergenic
1191949528 X:66573131-66573153 CAGTATTAGATCATTGAGGCAGG - Intergenic
1195097164 X:101514197-101514219 GAGCATAAGATCATGGAGGCAGG + Intronic
1195885213 X:109630390-109630412 CAGCAGTATATCTTCAATGCTGG + Intronic
1200704259 Y:6428237-6428259 CACCCTTACATCATCTAGGCAGG + Intergenic
1201029852 Y:9736471-9736493 CACCCTTACATCATCTAGGCAGG - Intergenic
1201988789 Y:20001198-20001220 CAGCATTAGAGAATCAATACTGG - Intergenic