ID: 1105802696

View in Genome Browser
Species Human (GRCh38)
Location 13:23922654-23922676
Sequence GACACAATTGTGCCCCAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 244}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105802696_1105802697 -7 Left 1105802696 13:23922654-23922676 CCAGACTGGGGCACAATTGTGTC 0: 1
1: 0
2: 0
3: 18
4: 244
Right 1105802697 13:23922670-23922692 TTGTGTCACACTAAGCTAGATGG 0: 1
1: 0
2: 0
3: 10
4: 93
1105802696_1105802699 -2 Left 1105802696 13:23922654-23922676 CCAGACTGGGGCACAATTGTGTC 0: 1
1: 0
2: 0
3: 18
4: 244
Right 1105802699 13:23922675-23922697 TCACACTAAGCTAGATGGGAAGG 0: 1
1: 0
2: 1
3: 7
4: 136
1105802696_1105802700 19 Left 1105802696 13:23922654-23922676 CCAGACTGGGGCACAATTGTGTC 0: 1
1: 0
2: 0
3: 18
4: 244
Right 1105802700 13:23922696-23922718 GGAACTGAGACATTTCAAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 146
1105802696_1105802698 -6 Left 1105802696 13:23922654-23922676 CCAGACTGGGGCACAATTGTGTC 0: 1
1: 0
2: 0
3: 18
4: 244
Right 1105802698 13:23922671-23922693 TGTGTCACACTAAGCTAGATGGG 0: 1
1: 0
2: 2
3: 3
4: 69
1105802696_1105802701 28 Left 1105802696 13:23922654-23922676 CCAGACTGGGGCACAATTGTGTC 0: 1
1: 0
2: 0
3: 18
4: 244
Right 1105802701 13:23922705-23922727 ACATTTCAAGCAGGAAGATGAGG 0: 1
1: 0
2: 6
3: 31
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105802696 Original CRISPR GACACAATTGTGCCCCAGTC TGG (reversed) Intergenic
900575931 1:3382444-3382466 GACACAGCTGTGCCCCAGGCAGG - Intronic
900894583 1:5474327-5474349 GCCACAGTTTTGGCCCAGTCAGG - Intergenic
901072427 1:6528261-6528283 GGCGCAATTGTGCCACAGCCTGG - Intronic
901260605 1:7867830-7867852 GGCACAATTGTCCTCCAGCCTGG + Intergenic
901422150 1:9158375-9158397 CACACAATTGTACTCCAGCCTGG + Intergenic
901519659 1:9773775-9773797 TACACCATTGTGCTCCAGCCTGG - Intronic
902506310 1:16940768-16940790 GGACCAATTGTGCCCCAGCCTGG - Intronic
903593505 1:24476103-24476125 CACACAATTGTACTCCAGCCTGG - Intergenic
903869352 1:26422050-26422072 CACACAACTGTGCTCCAGGCTGG - Intronic
904149298 1:28424233-28424255 CACACCATTGTACTCCAGTCTGG - Intronic
904167309 1:28565741-28565763 CACACAACTGTGCTCCAGCCTGG + Intronic
904633938 1:31865045-31865067 CACACTCTTGTCCCCCAGTCTGG - Intergenic
905121994 1:35689449-35689471 TACACCATTGTACCCCAGCCTGG + Intergenic
905570297 1:38998828-38998850 GACACCATTGTACTCCAGCCTGG + Intronic
907596036 1:55720928-55720950 CACACCACTGTGCTCCAGTCTGG - Intergenic
908371042 1:63477674-63477696 CACACCATTGTGCTCCAGGCTGG + Intronic
908531385 1:65037820-65037842 GACACCATTGTACTCCAGCCTGG + Intergenic
908722059 1:67136074-67136096 CACACCACTGTGCTCCAGTCTGG - Intronic
910400752 1:86835736-86835758 TGCACAATTGTACTCCAGTCTGG - Intergenic
910866596 1:91793760-91793782 CACACAACTGTGCTCCAGCCTGG + Intronic
913523567 1:119669042-119669064 CACACCATTGTACCCCAGCCTGG - Intronic
914257047 1:145969140-145969162 CACACCACTGTGCACCAGTCTGG - Intronic
915650085 1:157303295-157303317 GACTCTAGTGTCCCCCAGTCAGG + Intergenic
915697978 1:157763479-157763501 CACACCATTGTGCTCCAGCCTGG + Intronic
917508071 1:175647092-175647114 CACACAATTTTGCCCCAGGCAGG + Intronic
918391490 1:184067877-184067899 CACACCACTGTGCTCCAGTCTGG + Intronic
922175214 1:223192093-223192115 CACACCATTGTACTCCAGTCTGG - Intergenic
922531152 1:226346216-226346238 GTCACACTTGTCCCCCAGGCTGG - Intergenic
923519721 1:234726083-234726105 GGCAAAAGTGTGCCCCTGTCTGG - Intergenic
923556937 1:235008608-235008630 CACACCATTGTGCTCCAGCCTGG - Intergenic
1063002119 10:1933905-1933927 CACACCATTGTGCTCCAGTCTGG + Intergenic
1064114163 10:12563308-12563330 GACACCACTGCACCCCAGTCTGG + Intronic
1065003975 10:21362736-21362758 GACACCACTGTACTCCAGTCTGG - Intergenic
1066160300 10:32721047-32721069 CACACAACTGTGCTCCATTCTGG + Intronic
1068858983 10:61827513-61827535 CACACCATTGTGCTCCAGCCTGG + Intergenic
1069751933 10:70750416-70750438 GGCAGAGATGTGCCCCAGTCAGG - Intronic
1072100748 10:92226946-92226968 GACAAAATTGGGGCTCAGTCAGG - Intronic
1072649550 10:97283975-97283997 GACACCACTGTGCTCCAGCCTGG - Intronic
1074011469 10:109485905-109485927 CACACCATTGTACTCCAGTCCGG - Intergenic
1074589078 10:114795663-114795685 CACACCATTGTACTCCAGTCTGG + Intergenic
1076560657 10:131361133-131361155 TGCACAGTGGTGCCCCAGTCAGG - Intergenic
1077205362 11:1339820-1339842 GACACCATTGTGCTCCAGCCTGG + Intergenic
1080581662 11:33649454-33649476 GACACCATTGTACTCCAGCCTGG + Intronic
1083058961 11:59849732-59849754 CACACCATTGTACCCCAGCCTGG - Intergenic
1083111898 11:60418550-60418572 GACACAAATATGACACAGTCTGG - Intergenic
1084074641 11:66763646-66763668 CACACCATTGCACCCCAGTCTGG - Intronic
1084893737 11:72250497-72250519 GAGAGCATTGTGCCCCTGTCTGG + Intergenic
1086119655 11:83292895-83292917 GATACAATTGTGCCCAAGCTGGG - Intergenic
1088375837 11:109140808-109140830 GGCAGGATAGTGCCCCAGTCAGG - Intergenic
1089483910 11:118829979-118830001 CACGCCATTGTGCTCCAGTCTGG + Intergenic
1091489426 12:920006-920028 CACACAATTGCACCCCAGCCTGG + Intronic
1092732946 12:11551337-11551359 CACACCATTGTGCTCCAGCCTGG + Intergenic
1095443400 12:42260460-42260482 CACACAATTGCCCTCCAGTCTGG + Intronic
1096758766 12:53822332-53822354 CACACCACTGTGCTCCAGTCTGG - Intergenic
1097026364 12:56058742-56058764 GGCACTATTTTTCCCCAGTCTGG - Intergenic
1097301781 12:58026858-58026880 GGCACCATTGTACCCCAGCCTGG - Intergenic
1098313556 12:69171023-69171045 CACACCATTGTACTCCAGTCTGG - Intergenic
1099649944 12:85413484-85413506 GACAGCATTGTGAGCCAGTCTGG + Intergenic
1100257627 12:92900710-92900732 CACACCATTGTACCCCAGCCTGG - Intronic
1103672078 12:122625521-122625543 CACACCATTGTACCCCAGCCTGG + Intronic
1105802696 13:23922654-23922676 GACACAATTGTGCCCCAGTCTGG - Intergenic
1106630145 13:31463269-31463291 CACACCATTGTGCTCCAGCCTGG - Intergenic
1113285952 13:108849232-108849254 GGCACCATTGTACTCCAGTCTGG - Intronic
1114250283 14:20954056-20954078 GACACAATGGTGACCCAGTGAGG - Intergenic
1114874123 14:26694356-26694378 AAGATAATTGTGCCCCAGTGAGG + Intergenic
1115114961 14:29869394-29869416 CGCACCATTGTACCCCAGTCTGG + Intronic
1115994207 14:39178485-39178507 CACACTATTGTACCCCAGCCTGG + Intronic
1117310100 14:54512702-54512724 GCCACAATAGTGCCTCACTCTGG + Intronic
1117379812 14:55150007-55150029 CACACCATTGTACCCCAGCCTGG + Intronic
1117597379 14:57337147-57337169 GATACAATTGTGGCCAGGTCAGG - Intergenic
1118014894 14:61650081-61650103 CACACCATTGTACCCCAGCCTGG + Intronic
1118359036 14:65040482-65040504 CACACCATTGTGCTCCAGCCCGG - Intronic
1118894379 14:69933571-69933593 CACACCATTGTACCCCAGCCTGG - Intronic
1119847614 14:77842045-77842067 GGCACCATTGTACCCCAGCCTGG + Intronic
1119982136 14:79093768-79093790 GAGACAATTGTGCCTGAGGCTGG + Intronic
1120392355 14:83924651-83924673 GGCATAAATGTGCACCAGTCAGG + Intergenic
1121281008 14:92698125-92698147 GACAAAGTTGTTCCCCAGTGGGG + Intergenic
1121935507 14:98014842-98014864 GATACATATGTGACCCAGTCAGG + Intergenic
1125560534 15:40628987-40629009 CACACAACTGTACCCCAGGCTGG + Intronic
1127137204 15:55936834-55936856 CACACCATTGTGCTCCAGCCTGG - Intronic
1128525999 15:68412717-68412739 TACACCATTGTACTCCAGTCTGG - Intronic
1128654469 15:69450394-69450416 GGCACCACTGTGCCCCAGCCTGG + Intergenic
1130447812 15:84020252-84020274 GACACACTTGGGATCCAGTCCGG + Intronic
1130846329 15:87750516-87750538 GACACCACTGTGCTCCAGCCTGG - Intergenic
1132321496 15:100928885-100928907 AACACAATTGTGTCCCAGGAAGG + Intronic
1132831583 16:1930705-1930727 GACACCATTGTACTCCAGCCTGG - Intergenic
1133046509 16:3091258-3091280 GCCATGATTGTGCCACAGTCTGG + Intronic
1133615487 16:7472738-7472760 GAAACAATTTTGCCACAGTCTGG - Intronic
1134501345 16:14771302-14771324 GACACCACTGTGCTCCAGCCTGG - Intronic
1134538657 16:15046829-15046851 CACACAACTGTGCTCCAGACAGG + Intronic
1134579227 16:15357612-15357634 GACACCACTGTGCTCCAGCCTGG + Intergenic
1134579239 16:15357738-15357760 GACACCACTGTGCTCCAGCCTGG + Intergenic
1134723346 16:16399815-16399837 GACACCACTGTGCTCCAGCCTGG - Intergenic
1134723358 16:16399941-16399963 GACACCACTGTGCTCCAGCCTGG - Intergenic
1134944070 16:18311929-18311951 GACACCACTGTGCTCCAGCCTGG + Intergenic
1134944082 16:18312055-18312077 GACACCACTGTGCTCCAGCCTGG + Intergenic
1135015051 16:18918217-18918239 GGCACCATTGTGCTCCAGCCTGG + Intronic
1136332148 16:29587189-29587211 GGCACCATTGTGCTCCAGCCTGG + Intergenic
1136446844 16:30327255-30327277 GGCACCATTGTGCTCCAGCCTGG + Intergenic
1137607215 16:49794919-49794941 CACACTATTGTACCCCAGCCTGG - Intronic
1138396260 16:56707066-56707088 TACACCACTGTGCCCCAGCCTGG - Intronic
1140374008 16:74430167-74430189 GACACATTAGCACCCCAGTCAGG - Intergenic
1141710210 16:85694527-85694549 CACACCACTGCGCCCCAGTCTGG - Intronic
1142622665 17:1174885-1174907 GACATACGTGTGCCCCAGGCAGG - Intronic
1142632308 17:1232975-1232997 GAAGCAAATGTGCCCCAGTCCGG - Intergenic
1142788675 17:2245722-2245744 CACACCACTGTGCTCCAGTCTGG - Intronic
1143691994 17:8576023-8576045 CACACAACTGTGCTCCAGCCTGG - Intronic
1145746976 17:27327372-27327394 CACACCATTGTACCCCAGCCTGG + Intergenic
1148613315 17:48979802-48979824 CACACCATTGTGCTCCAGCCTGG - Intergenic
1149103868 17:52938140-52938162 CACGCCATTGTGCTCCAGTCTGG + Intergenic
1149158789 17:53666368-53666390 CACACCACTGTGCTCCAGTCTGG + Intergenic
1149908064 17:60544992-60545014 GGCACCATTGTGCTCCAGCCTGG + Intergenic
1150535065 17:66029657-66029679 CACACCACTGTACCCCAGTCTGG + Intronic
1151410391 17:73922674-73922696 CACGCCATTGTGCTCCAGTCAGG - Intergenic
1151487849 17:74412941-74412963 CGCACAATTGTGCCGCAGCCTGG - Intergenic
1154247368 18:12711054-12711076 CACACCATTGTACTCCAGTCTGG + Intronic
1155197501 18:23488694-23488716 GGCACCATTGTACTCCAGTCTGG + Intergenic
1155977087 18:32142694-32142716 CACACCATTGTACTCCAGTCTGG + Intronic
1158627158 18:59081435-59081457 CACACCATTGCACCCCAGTCTGG - Intergenic
1159158462 18:64613318-64613340 GACACTATTTTCTCCCAGTCGGG + Intergenic
1159352222 18:67290736-67290758 GGCACAATTGCACTCCAGTCTGG - Intergenic
1163364890 19:16870308-16870330 GAAACAAATGTTCCCCAGTCAGG - Intronic
1163790039 19:19301268-19301290 GATTCAGGTGTGCCCCAGTCTGG - Intronic
1163852668 19:19674218-19674240 CACACCATTGTACTCCAGTCTGG - Intronic
1164001549 19:21105066-21105088 CACACGATTGCACCCCAGTCTGG - Intronic
1164099048 19:22038098-22038120 CACACCATTGTACCCCAGGCTGG - Intergenic
1164119228 19:22250753-22250775 CACACCATTGTACCCCAGGCTGG - Intergenic
1165320643 19:35083247-35083269 TACACCACTGTGCTCCAGTCTGG - Intergenic
1166973082 19:46583456-46583478 GACACCATTGTACTCCAGTCCGG + Intronic
1167090489 19:47340795-47340817 GACAGAATCGTTCCCCATTCAGG - Exonic
1167257337 19:48438822-48438844 GACACCATTGCACCCCAGCCTGG - Intronic
1167459914 19:49619583-49619605 CGCACAATTGTACCCCAGCCTGG - Intronic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
925491470 2:4399823-4399845 GACACCACTGTGCTCCAGCCTGG + Intergenic
925833014 2:7914963-7914985 CACACCACTGTACCCCAGTCTGG - Intergenic
926678893 2:15649345-15649367 GGCACCATTGTGCTCCAGCCTGG + Intergenic
927615328 2:24588126-24588148 CACACTACTGTGCTCCAGTCTGG - Intronic
931705171 2:64941211-64941233 GAGATAATGGTGGCCCAGTCAGG - Intergenic
932008296 2:67949769-67949791 GGCACCATTGTACCCCAGCCTGG - Intergenic
932382863 2:71301567-71301589 CACACCATTGTACCCCAGTCTGG - Intronic
932875731 2:75449402-75449424 GACACCATTGTGCTTCAGTCTGG + Intergenic
935004510 2:99058990-99059012 CACACCAGTGTGCTCCAGTCTGG + Intronic
935720728 2:105976673-105976695 CACACAGTTGTGCCACTGTCAGG + Intergenic
936697449 2:114966996-114967018 CACACCATTGTACACCAGTCTGG + Intronic
936845516 2:116826284-116826306 GACACAATTTTGCCCCAAAGAGG - Intergenic
937394945 2:121526409-121526431 AACTCAAATGTGCCCCAGTAGGG - Intronic
940459354 2:153943536-153943558 CACACAATTGCACTCCAGTCTGG - Intronic
944173200 2:196801382-196801404 GACACAATTGCTCCACTGTCTGG - Intergenic
944992223 2:205250883-205250905 CACACCACTGTGCCCCAGCCTGG + Intronic
945851534 2:215014135-215014157 GGCACAACTGCGCTCCAGTCTGG + Intronic
946869765 2:224075001-224075023 GACACACCTTTGCCCCAGCCTGG - Intergenic
946986847 2:225282926-225282948 GACACCATTTTGCCCAAGGCTGG + Intergenic
1172511541 20:35504330-35504352 GGCAGAATTGAGCCGCAGTCTGG + Exonic
1173244742 20:41328648-41328670 CACACTACTGTGCTCCAGTCTGG - Intergenic
1174424332 20:50421257-50421279 CGCACCATTGTGCTCCAGTCTGG + Intergenic
1174612929 20:51814031-51814053 GACGCCATTGTACTCCAGTCTGG - Intergenic
1175579879 20:60090172-60090194 GAGAAAATGGAGCCCCAGTCAGG + Intergenic
1178408031 21:32340567-32340589 CACACCATTGTACTCCAGTCTGG + Intronic
1179208213 21:39303473-39303495 CACACAACTGCGCCCCAGCCTGG + Intronic
1180539754 22:16433072-16433094 GGCACAACTGTACTCCAGTCTGG - Intergenic
1180557480 22:16589619-16589641 GACACTATTGTACCCCAGCCTGG - Intergenic
1181036669 22:20173059-20173081 GACACAATTGCACTCCAGTCTGG - Intergenic
1181714920 22:24718286-24718308 GACACCATTGCACCCCAGCCTGG + Intergenic
1181915432 22:26275980-26276002 CACACACTTATGCCCCAGTGAGG - Intronic
1182284297 22:29235302-29235324 CACACCATTGTGCTCCAGCCTGG + Intronic
1182446952 22:30395378-30395400 CACACCATTGTACTCCAGTCTGG - Intronic
950718850 3:14868296-14868318 GCCACATTTGTTTCCCAGTCTGG + Intronic
951618848 3:24579094-24579116 GAGACATCTGTGCCCCAGTGTGG - Intergenic
954282359 3:49591025-49591047 CACACCATTGTACTCCAGTCTGG + Intronic
954429390 3:50461903-50461925 GACACATTGGTGCCGCAGGCTGG + Intronic
954476850 3:50754601-50754623 CACACCATTGCACCCCAGTCTGG - Intronic
956322975 3:68019368-68019390 GACCCTTTTGTGCCCCAGTCAGG + Intronic
958984385 3:100763417-100763439 CACACCATTGTGCTCCAGCCTGG + Intronic
959932154 3:111996777-111996799 CACACCATTGCGCCCCAGCCTGG + Intergenic
966189340 3:177258119-177258141 CACACCATTGTGCTCCAGCCTGG - Intergenic
967491363 3:190094938-190094960 GAGACAATTCTGCCACAGTCAGG + Intronic
967837309 3:193975324-193975346 GGCAAAATTGTTCCCCAGGCGGG - Intergenic
968348495 3:198032056-198032078 GACACTATTGTACCACAGCCTGG + Intronic
969093768 4:4717229-4717251 GACACAGCTGTGCACCAGCCCGG + Intergenic
969482900 4:7456260-7456282 GACACAATTCTGCCCATGACAGG + Intronic
969725953 4:8918147-8918169 GGCACCATTGTGCCACAGACAGG - Intergenic
970988672 4:22188060-22188082 CATACCATTGTGCCCCAGCCTGG + Intergenic
973642213 4:52914568-52914590 GACACAAGTGTGCCCGAGACAGG - Intronic
975282535 4:72578121-72578143 GACACCACTGTACTCCAGTCCGG + Intergenic
975623989 4:76324215-76324237 GACAGAATTGTTGCCCAGGCTGG + Intronic
977054739 4:92177438-92177460 TACACTAATGTGCCCCAGTGAGG - Intergenic
978599560 4:110413642-110413664 GGCACCATTGTGCCCCAGCTTGG - Intronic
979429878 4:120616566-120616588 CACACAAATGTACTCCAGTCTGG + Intergenic
980014740 4:127636223-127636245 CACACCATTGCACCCCAGTCTGG + Intronic
982342942 4:154323371-154323393 GGCACAATTGCGCTCCAGCCTGG - Intronic
984504551 4:180600505-180600527 GACACCACTGTTCCCCAGCCTGG + Intergenic
985706398 5:1403664-1403686 GACACAACTGTGACCCATGCGGG + Intronic
987782251 5:22454515-22454537 AACACCACTGTGCTCCAGTCTGG - Intronic
988600998 5:32639389-32639411 GACACAAAGATGCCCCAGGCAGG - Intergenic
989075589 5:37562310-37562332 AACACCATTGTGCTCCAGCCTGG + Intronic
989960884 5:50413617-50413639 GACACCATTGTACTCCAGCCTGG - Intronic
990589101 5:57243729-57243751 GGCACAACTGTACTCCAGTCTGG - Intronic
992842686 5:80711696-80711718 GACACCATTGTACTCCAGCCTGG - Intronic
992959512 5:81944998-81945020 CACACTATTGTGCTCCAGCCTGG - Intergenic
994991702 5:107004798-107004820 GACACAGTGGTGCCTCACTCCGG - Intergenic
996549683 5:124717036-124717058 GACACCATTGCACTCCAGTCTGG + Intronic
998464227 5:142330401-142330423 GGCACCATTGTACCCCAGCCTGG + Intergenic
1004057870 6:12159056-12159078 GACACAACAGAACCCCAGTCAGG - Intronic
1004382214 6:15142300-15142322 GACACCACTGTGCTCCAGCCTGG - Intergenic
1004681417 6:17899021-17899043 GACACTATGTTGCCCCAGGCTGG + Intronic
1005470897 6:26161162-26161184 CACGCAATTGTCCTCCAGTCTGG + Intronic
1005990836 6:30900759-30900781 CACACAACTGTGCTCCAGCCTGG + Intergenic
1006527943 6:34624365-34624387 CACACTATTGTGCTCCAGCCTGG - Intronic
1007214033 6:40222138-40222160 CACACCATTGTGGCCCAGCCTGG - Intergenic
1008283194 6:49620503-49620525 GAAACTATGGTGCCCCATTCAGG - Intronic
1009480652 6:64154394-64154416 CACACCATTGTACTCCAGTCTGG + Intronic
1010625574 6:78133554-78133576 GACACAATTGGTGCCCACTCAGG + Intergenic
1010928905 6:81776911-81776933 TACACCACTGTGCTCCAGTCTGG + Intergenic
1013529819 6:111008941-111008963 CACACCATTGTGCTCCAGCCTGG - Intronic
1015273000 6:131356601-131356623 CGCACCACTGTGCCCCAGTCTGG - Intergenic
1017914956 6:158824418-158824440 GGCACCATTGCGCTCCAGTCTGG + Intergenic
1018070829 6:160163130-160163152 CACACCATTGTACCCCAGCCTGG - Intergenic
1021173993 7:17428704-17428726 CACACAACTGTACCCCAGCCTGG + Intergenic
1021772385 7:24018523-24018545 CACACAATTGTGCAACACTCTGG - Intergenic
1023826150 7:44011141-44011163 CACACCACTGTACCCCAGTCTGG - Intergenic
1025077678 7:55957083-55957105 CACACCATTGTGCTCCAGCCTGG - Intronic
1025867043 7:65392578-65392600 GACACCATTGTACTCCAGCCTGG - Intronic
1026230420 7:68478490-68478512 GACACAATTGAGGCCCAGAGAGG + Intergenic
1026800814 7:73398707-73398729 CACACCATTGTGCTCCAGCCTGG - Intergenic
1027117439 7:75492480-75492502 CGCACCATTGTGCTCCAGTCTGG - Intergenic
1027337900 7:77173583-77173605 CACACCATTGTGCTCCAGTCTGG + Intronic
1028828772 7:95304374-95304396 CACACCATTGTACTCCAGTCTGG - Intronic
1028846332 7:95484286-95484308 CACACCACTGTGCTCCAGTCTGG + Intronic
1029720063 7:102357572-102357594 GGCACCATTGTGCTCCAGCCTGG + Intergenic
1029752550 7:102551685-102551707 GGCACCATTGTGCTCCAGCCTGG - Intronic
1029770501 7:102650778-102650800 GGCACCATTGTGCTCCAGCCTGG - Intronic
1029777835 7:102697228-102697250 CACACCATTGCGCTCCAGTCTGG - Intergenic
1032221889 7:130000735-130000757 CGCACCATTGTGCTCCAGTCTGG - Intergenic
1035817094 8:2552918-2552940 CACACCACTGTGCTCCAGTCTGG + Intergenic
1035969999 8:4237576-4237598 GACACTATTGTGCTCCAGCTTGG - Intronic
1037596505 8:20358636-20358658 GACACAATTCAGCCCCAAACAGG - Intergenic
1039535410 8:38307226-38307248 CACACAACTGTACTCCAGTCTGG - Intronic
1040058556 8:43084026-43084048 CACACCACTGTGCCCCAGCCTGG + Intronic
1046821471 8:118638370-118638392 CACACCATTGTACTCCAGTCTGG - Intergenic
1047107813 8:121753638-121753660 AACACATTTTTCCCCCAGTCAGG - Intergenic
1047712088 8:127562546-127562568 GACACCACTGTACTCCAGTCTGG + Intergenic
1047734944 8:127757028-127757050 GACTCAGTGGTGCCCCAGTCAGG + Intergenic
1048471570 8:134708906-134708928 CACACCATTGTGCTCCAGACTGG + Intronic
1049027592 8:140005866-140005888 CACACCATTGTACTCCAGTCTGG + Intronic
1049785121 8:144446902-144446924 CACGCCATTGTGCCCCAGCCTGG - Intergenic
1051982245 9:23035166-23035188 GCCAGTATTGTGTCCCAGTCTGG - Intergenic
1053172897 9:35903672-35903694 CACACCATTGTGCTCCAGCCTGG - Intergenic
1054945019 9:70786439-70786461 CACACGATTGTGCTCCAGCCTGG + Intronic
1055052491 9:71994500-71994522 TGCACAACTGTGCTCCAGTCTGG - Intergenic
1057534883 9:95891181-95891203 GACACACTTGTTGCCCAGGCTGG - Intronic
1059672855 9:116507930-116507952 GACACCATTGTACTCCAGCCTGG - Intronic
1186593925 X:10960355-10960377 CACACCACTGTGCCCCAGTTTGG - Intergenic
1187183992 X:16967618-16967640 CACACCATTGTGCTCCAGCCTGG + Intronic
1187406091 X:19005595-19005617 CACACCATTGTACTCCAGTCTGG - Intronic
1187495550 X:19792696-19792718 GAGGCAATTGTGCCCCAGCAAGG + Intronic
1187758786 X:22557082-22557104 CACACCATTGTGCTCCAGCCTGG - Intergenic
1188758774 X:33999259-33999281 TACACCATTGTACTCCAGTCTGG + Intergenic
1190077552 X:47328916-47328938 CACACCACTGTGCCCCAGCCTGG - Intergenic
1190227085 X:48554514-48554536 CATACCATTGTGCTCCAGTCTGG + Intronic
1190557824 X:51654424-51654446 CACACAATTGTACTCCAGCCTGG - Intergenic
1192587339 X:72329360-72329382 GACACACTAGTTCCCCAGTGAGG + Intergenic
1195556064 X:106225929-106225951 GACACAATTGGGCCACAAACTGG + Intergenic
1201180959 Y:11344717-11344739 GGCACAACTGTACTCCAGTCTGG - Intergenic