ID: 1105804483

View in Genome Browser
Species Human (GRCh38)
Location 13:23944815-23944837
Sequence CCTCACAAGCAGACATTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105804483_1105804485 -8 Left 1105804483 13:23944815-23944837 CCTTCAAATGTCTGCTTGTGAGG 0: 1
1: 0
2: 1
3: 9
4: 144
Right 1105804485 13:23944830-23944852 TTGTGAGGTCATTCTTAGAAAGG 0: 1
1: 3
2: 6
3: 13
4: 146
1105804483_1105804487 18 Left 1105804483 13:23944815-23944837 CCTTCAAATGTCTGCTTGTGAGG 0: 1
1: 0
2: 1
3: 9
4: 144
Right 1105804487 13:23944856-23944878 TTGTCAACATAAAATGTACCTGG 0: 1
1: 0
2: 1
3: 11
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105804483 Original CRISPR CCTCACAAGCAGACATTTGA AGG (reversed) Intergenic
900495350 1:2973624-2973646 CCTGAGAGGCAGACATTTGGGGG + Intergenic
900972193 1:5997888-5997910 TCTTAGCAGCAGACATTTGAAGG + Intronic
905017438 1:34787288-34787310 TCTCACAAGTAGCCATTTGAAGG + Intronic
905773020 1:40650308-40650330 CCTCAGAAGCAGGGACTTGAAGG + Intronic
906681024 1:47725458-47725480 CCTGACAAGGAGTCTTTTGAGGG + Intergenic
906921433 1:50068631-50068653 TCACACAACCAGACATGTGACGG - Intronic
907892623 1:58650041-58650063 GCTAAAAAGCAGACATTTGGAGG - Intergenic
912038566 1:105354345-105354367 CCTCACAAAAAGAAAATTGATGG + Intergenic
912723899 1:112042487-112042509 CCTCACAGGAGGGCATTTGAAGG + Intergenic
913206048 1:116540122-116540144 CCTCAGAAGTAGAAATTTTAAGG + Intronic
914975575 1:152357836-152357858 CCTCAGAAGAAGACATTTCAAGG + Intronic
917504619 1:175616468-175616490 TCTCTGAAGCAGAAATTTGAAGG + Intronic
918382388 1:183969157-183969179 TCTCACTACCAGACATATGAGGG + Intronic
919224867 1:194683795-194683817 CCTCAAAAGGAGACATATTATGG - Intergenic
919509259 1:198440404-198440426 CCTTACAAGCAGATTTTTCAGGG + Intergenic
922064911 1:222127147-222127169 CCTCATAAGGTGACATTGGAGGG - Intergenic
922085132 1:222339091-222339113 CCTCATGAGCTGATATTTGATGG + Intergenic
923389481 1:233499808-233499830 CCTCACAATGATACATTTGAAGG - Intergenic
924217110 1:241834043-241834065 GCTTACAAGCAGACATTGAAAGG - Intergenic
1064016076 10:11773291-11773313 CCTGAACAGCAGACATTGGATGG - Intergenic
1065312466 10:24429840-24429862 CCTGACAAACAGATTTTTGAGGG - Intronic
1066211689 10:33246283-33246305 CATCACAGGGAGTCATTTGAAGG - Intronic
1066521059 10:36219873-36219895 TCTCACAGGCAGCCATTTTAAGG + Intergenic
1069809890 10:71150497-71150519 CAGCACAGGAAGACATTTGAGGG + Intergenic
1073374502 10:103021371-103021393 CCTCACACACACACATTCGACGG - Intronic
1077976606 11:7253195-7253217 CATCTCAAGCAAACATTGGAAGG - Intronic
1082736618 11:56862980-56863002 CTTCACAATCAGAAATTTCATGG - Intergenic
1085150829 11:74251761-74251783 TCTGACAAGCAGACACTTGTAGG + Intronic
1088747185 11:112813981-112814003 ATTCCCAACCAGACATTTGAAGG + Intergenic
1089328656 11:117674758-117674780 ACACACAAGCAGAGATTTAAAGG - Intronic
1091181752 11:133611181-133611203 CCTCACCAGCAGTCTCTTGAGGG + Intergenic
1094035651 12:26067690-26067712 CCTCACATGCAGACATTGAAAGG + Exonic
1098203942 12:68086136-68086158 GCACACAAGCACACACTTGAGGG - Intergenic
1098877392 12:75880652-75880674 CCTAAAAAGCAGACAGTTCATGG + Intergenic
1100250896 12:92822501-92822523 CCACACAAACCCACATTTGAAGG + Intronic
1101613959 12:106317959-106317981 CCTCACCAGCTGAAATTTCATGG - Intronic
1105804483 13:23944815-23944837 CCTCACAAGCAGACATTTGAAGG - Intergenic
1106619994 13:31363810-31363832 AGTCACAAGCAGGCCTTTGAGGG + Intergenic
1107516887 13:41138091-41138113 ACTCACAATCAGAAAGTTGAGGG - Intergenic
1108005786 13:45944921-45944943 TTTCACAAGCAGACTTTGGAGGG - Intergenic
1108125161 13:47234557-47234579 ACTGAGAAGCAGATATTTGAGGG + Intergenic
1108262044 13:48668055-48668077 TCTGACAAGCACATATTTGAGGG - Intronic
1108699289 13:52930142-52930164 CCTTGGAAGCAGACATTTGTAGG - Intergenic
1109559304 13:64025746-64025768 CATCTCAAGCAGGCATTGGAAGG + Intergenic
1110071864 13:71187603-71187625 AAGCACAAGGAGACATTTGAGGG + Intergenic
1110285645 13:73747219-73747241 CCTTACATGCACACAATTGAGGG + Intronic
1112765352 13:102735987-102736009 CCCCAAAAGGATACATTTGAGGG - Exonic
1113214636 13:108024971-108024993 ACTGCCAAGAAGACATTTGAGGG - Intergenic
1114352252 14:21865978-21866000 CATCACAAGCAGTGATATGAGGG - Intergenic
1115140629 14:30167355-30167377 CTTCACAAACACACATTAGAGGG + Intronic
1115342965 14:32311752-32311774 GCTCACAATCAGCCATTTGATGG + Intergenic
1130159445 15:81384123-81384145 CCTCACAAGCAGAGAGAGGAAGG - Intergenic
1131506600 15:93025252-93025274 TCTCCCAAGAACACATTTGAGGG - Exonic
1132495380 16:260733-260755 CCTTACAAGCTGTCATTTTAAGG + Intronic
1134178101 16:12024999-12025021 CCTCATAAGCACATATTTTAAGG - Intronic
1141791621 16:86240382-86240404 TCTCTCCAGCAGACATTTGGGGG - Intergenic
1142051661 16:87962657-87962679 CCCCGCAAGCACACATTTGGGGG + Intronic
1143142158 17:4746859-4746881 CCTCAAAAAAAGACATCTGAGGG + Intergenic
1143685615 17:8513208-8513230 CCTCATAAACAGACATAGGAAGG + Intronic
1152367488 17:79864981-79865003 GCTCACAAGCAAACATGTGCTGG + Intergenic
1153262365 18:3237044-3237066 CTTGACGAGCACACATTTGATGG + Intergenic
1158921731 18:62199651-62199673 CCTCAGAAACAGAGCTTTGATGG - Intronic
1160018536 18:75162898-75162920 CCTCACAACCAGACAAAGGAAGG + Intergenic
1161079991 19:2305853-2305875 CCCCAAAAGCAGACCTTGGAGGG - Intronic
1163391968 19:17036587-17036609 CTTCACAAGCATGCATTTGGAGG - Intergenic
1163647878 19:18500442-18500464 TGTCACAAGCAGCCAGTTGATGG - Intronic
1164086988 19:21911980-21912002 CCTCTCAAGCAGACAATTAGTGG - Intergenic
1164748443 19:30632979-30633001 TCTCACAAGCAGGCATGTCATGG - Intronic
1167849806 19:52192692-52192714 ACTAACCAGCAGACATTTGTAGG + Intronic
929580005 2:43076070-43076092 CCTCCCAGGGAGACATTTGCAGG - Intergenic
930020126 2:46996663-46996685 CCTCACAGGCAAACATTTTAGGG - Intronic
932206676 2:69889513-69889535 CCACACAGGCAGAGATTGGATGG - Intergenic
941829624 2:169940385-169940407 CCAGACATGCAGACATTTTAAGG - Intronic
944081598 2:195794589-195794611 TCTCAAAAGCATACATATGAAGG + Intronic
944509154 2:200447202-200447224 ACCCCCAAGCAGACATTTAATGG - Intronic
945043136 2:205759179-205759201 CCTAGGAAGTAGACATTTGAAGG + Intronic
945633686 2:212319244-212319266 CCTTACTATCAAACATTTGAAGG - Intronic
945890061 2:215421142-215421164 CCTAACAAGCAGATATTTAAAGG - Intronic
948163536 2:235844115-235844137 TCTCACAGGCAGACAATGGATGG - Intronic
948790560 2:240374471-240374493 TATCACAAGCTGTCATTTGAGGG + Intergenic
1168798502 20:628502-628524 CCTCCCAAGCTGGCTTTTGATGG + Intergenic
1168851389 20:979337-979359 CCCCACAAGGAGACATTTGAGGG - Intronic
1170750583 20:19141143-19141165 CCTCAAGAACAGACAGTTGAGGG + Intergenic
1175524147 20:59621929-59621951 ACTCACAAGCAGATCTTTTAAGG + Intronic
1178478184 21:32956079-32956101 GCTCACAAGCAGACACTTTCCGG + Intergenic
1181822798 22:25488585-25488607 CCTCATATGCACACATTTGGTGG - Intergenic
1182067171 22:27438853-27438875 CCTCCCAAGCAGACACCTCAGGG - Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
953811961 3:46120366-46120388 ACTATCAGGCAGACATTTGAGGG - Intergenic
953842059 3:46397036-46397058 CCTGAAAAGCAGACATTAGGAGG + Intergenic
953892512 3:46763468-46763490 GCTAACAAGCAGAGATTTCATGG + Intronic
954226894 3:49187961-49187983 CCTCAGAAACAGACATGTAAGGG - Intronic
954703028 3:52461927-52461949 CCTGACATGCAGTCCTTTGACGG + Intronic
956513469 3:70020080-70020102 CATCACAACCAGACAAATGATGG + Intergenic
957187288 3:76958035-76958057 GCCCATAATCAGACATTTGAAGG - Intronic
957637082 3:82800361-82800383 AATCACAAGAAAACATTTGAGGG - Intergenic
958150398 3:89685634-89685656 CCTCATGAGCAGTCATTTGGTGG + Intergenic
959163541 3:102747577-102747599 CCTCACAAGCTGAAAATTAATGG - Intergenic
959994648 3:112667460-112667482 GATCAGAACCAGACATTTGAAGG - Intergenic
961760176 3:129161456-129161478 CATCACACGCAGACGTGTGATGG + Intergenic
962611440 3:137080402-137080424 TGTCACAAGCAGAGTTTTGATGG + Intergenic
962839135 3:139217810-139217832 CCTCCCAAGCCCACACTTGAGGG - Intronic
964736635 3:159924953-159924975 CCTGAGACGCAGACATTTGTAGG + Intergenic
966384301 3:179379175-179379197 CCACACAAGCACACCTATGAAGG + Intronic
966400148 3:179539577-179539599 CCTCCTAAGCAAAAATTTGAAGG - Intergenic
969055683 4:4401255-4401277 CAGCACAAGCAGTCATCTGAAGG - Intronic
971513398 4:27456029-27456051 CCTTACATGGAGATATTTGAGGG + Intergenic
972033068 4:34486945-34486967 CCTCAAATGCAGACATATGTTGG + Intergenic
974998614 4:69194041-69194063 TCTCAAAAGCTAACATTTGAAGG - Intronic
977124814 4:93151387-93151409 CCTCAAAAGGAGAAATATGAAGG + Intronic
977474605 4:97489765-97489787 CTTCAGAAGGAGACCTTTGAAGG - Intronic
977859808 4:101943366-101943388 CCTCAGAAGCAGTCATCTAATGG - Intronic
978807955 4:112820253-112820275 CCTGAAAAGCAGAAATCTGAAGG - Intronic
979519948 4:121654382-121654404 CCTCACATGCTGACATTTAGAGG + Intergenic
980661167 4:135860408-135860430 ACTCACAGGCAGACAGGTGAGGG - Intergenic
981903208 4:149890617-149890639 CCTCACAAAGAGGCATTTGGAGG + Intergenic
985992603 5:3575672-3575694 CCTCACAAGCAGACACATCTGGG + Intergenic
988326765 5:29778516-29778538 TCTCATAAGAATACATTTGATGG + Intergenic
990654045 5:57934979-57935001 CCACACAAGCAGACCTTCTAAGG - Intergenic
990908025 5:60824314-60824336 GCTCACAAGTCGGCATTTGAAGG + Intronic
997571810 5:134934738-134934760 CCTCACTATCAGACAATGGAAGG - Intronic
1003480465 6:6526787-6526809 CCTCAAAAGCATACCTTTGCAGG + Intergenic
1004770340 6:18774120-18774142 CCTCTCCAGCACACATTTAAGGG - Intergenic
1007971063 6:46052771-46052793 CTCCACAGGCAGCCATTTGAGGG + Intronic
1010517960 6:76797643-76797665 TCTCAAAAGAAGACATATGAAGG - Intergenic
1010632915 6:78220579-78220601 CCTCACTAGCTGACATTAGTGGG + Intergenic
1011401896 6:86971978-86972000 ACCCACAAGCAGATAATTGAGGG + Intronic
1012102440 6:95106685-95106707 CCACACCTGCAAACATTTGAAGG - Intergenic
1012906261 6:105069872-105069894 CATCACAACCAGAAATTTCAAGG + Intronic
1014524917 6:122490992-122491014 CCTCAGAAGAAAAAATTTGAGGG + Intronic
1018172943 6:161155831-161155853 CCAAACATGCAGTCATTTGAAGG + Intronic
1020659862 7:10969166-10969188 TGTCACCAGCAGACTTTTGAGGG - Intergenic
1022203891 7:28144443-28144465 CCTGAGAGGCAGACATTTGCAGG + Intronic
1025962405 7:66234483-66234505 AATAACAAGCTGACATTTGATGG - Intronic
1026914409 7:74111488-74111510 CCTTAGAAGCAGACAGTTGTGGG + Intronic
1027668109 7:81064514-81064536 ACTCTCAAGCAGACATTTATGGG + Intergenic
1030272219 7:107682189-107682211 CCTGACAAGCATACATTTTTGGG - Intronic
1031847005 7:126817696-126817718 TTTCAGAAGCAGACATTTGAGGG + Intronic
1034673380 7:152873372-152873394 CATCCCAAGCAGACCTTTGCAGG - Intergenic
1034860286 7:154589104-154589126 CCTCACAAGCATACTTGTGCAGG - Intronic
1035762771 8:2081470-2081492 CCTCACGAGCAGACAGATCAGGG + Intronic
1039925957 8:41932680-41932702 CCTCACACGCAGAGATTGCAAGG - Exonic
1043756304 8:84008018-84008040 TCTCAAAACCAGAAATTTGAGGG - Intergenic
1043971771 8:86537596-86537618 TTCCACAAGCAGACATCTGATGG + Exonic
1044848520 8:96405609-96405631 TCTCAACATCAGACATTTGATGG - Intergenic
1045189197 8:99866426-99866448 GCTCAGCAGCAGACCTTTGAGGG - Intronic
1056697933 9:88876038-88876060 CCTTAAAAGCAGACATGTGATGG - Intergenic
1058419960 9:104824179-104824201 CCTCCCAAACACACATTTCATGG - Intronic
1193577080 X:83212725-83212747 TCTCAAAAGAAGACATTTGTGGG + Intergenic
1193585865 X:83320142-83320164 CCTCCACAGCATACATTTGAAGG - Intergenic
1194488446 X:94516260-94516282 CCCCACATGCAAACATTTCAAGG - Intergenic
1194716474 X:97291873-97291895 CCTGACAACCAGATAGTTGAAGG - Intronic
1201903429 Y:19066124-19066146 CCTCACAAGGATGCTTTTGAGGG - Intergenic
1202180950 Y:22139426-22139448 CCCCACAAACAGACATTTTTTGG - Intergenic
1202210410 Y:22446974-22446996 CCCCACAAACAGACATTTTTTGG + Intergenic