ID: 1105805002

View in Genome Browser
Species Human (GRCh38)
Location 13:23947473-23947495
Sequence GTCCATTGGGAGCCGGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 6, 2: 1, 3: 3, 4: 103}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105804987_1105805002 26 Left 1105804987 13:23947424-23947446 CCCCACTGGCACAACTCCCCTCA 0: 1
1: 0
2: 1
3: 19
4: 179
Right 1105805002 13:23947473-23947495 GTCCATTGGGAGCCGGCCCCAGG 0: 1
1: 6
2: 1
3: 3
4: 103
1105804994_1105805002 10 Left 1105804994 13:23947440-23947462 CCCCTCAGCACAGTGGGGGAGAT 0: 1
1: 0
2: 2
3: 15
4: 172
Right 1105805002 13:23947473-23947495 GTCCATTGGGAGCCGGCCCCAGG 0: 1
1: 6
2: 1
3: 3
4: 103
1105804996_1105805002 8 Left 1105804996 13:23947442-23947464 CCTCAGCACAGTGGGGGAGATGC 0: 1
1: 1
2: 7
3: 10
4: 208
Right 1105805002 13:23947473-23947495 GTCCATTGGGAGCCGGCCCCAGG 0: 1
1: 6
2: 1
3: 3
4: 103
1105804989_1105805002 24 Left 1105804989 13:23947426-23947448 CCACTGGCACAACTCCCCTCAGC 0: 1
1: 0
2: 4
3: 16
4: 206
Right 1105805002 13:23947473-23947495 GTCCATTGGGAGCCGGCCCCAGG 0: 1
1: 6
2: 1
3: 3
4: 103
1105804995_1105805002 9 Left 1105804995 13:23947441-23947463 CCCTCAGCACAGTGGGGGAGATG 0: 1
1: 0
2: 1
3: 21
4: 222
Right 1105805002 13:23947473-23947495 GTCCATTGGGAGCCGGCCCCAGG 0: 1
1: 6
2: 1
3: 3
4: 103
1105804988_1105805002 25 Left 1105804988 13:23947425-23947447 CCCACTGGCACAACTCCCCTCAG 0: 1
1: 0
2: 0
3: 18
4: 151
Right 1105805002 13:23947473-23947495 GTCCATTGGGAGCCGGCCCCAGG 0: 1
1: 6
2: 1
3: 3
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105805002 Original CRISPR GTCCATTGGGAGCCGGCCCC AGG Intergenic
900414315 1:2528082-2528104 GCCCCTTGGGAGCTGGTCCCTGG + Intergenic
900639365 1:3681433-3681455 GGCCACTGGGAGCTGGGCCCAGG + Intronic
905199057 1:36304168-36304190 GTCCAGTGGGAGACAGCGCCAGG - Exonic
908568792 1:65386902-65386924 AACCATTGGGAGCCGGCTACAGG + Exonic
912495743 1:110089997-110090019 GTGCCCTGGGAGCAGGCCCCTGG - Intergenic
915409494 1:155689105-155689127 GGCGCTTTGGAGCCGGCCCCAGG + Exonic
923147261 1:231206942-231206964 GTCCTTTGGGAGCCCGCCTGTGG - Intronic
1065801466 10:29356698-29356720 GCCCCTTGGGAGCCAGACCCAGG - Intergenic
1069492812 10:68875745-68875767 GGCCAATAGGAGCAGGCCCCTGG - Intronic
1069534159 10:69240924-69240946 ACCCATTGTGTGCCGGCCCCTGG + Intronic
1072299281 10:94043530-94043552 GTGCATTGGGAGCCAGCCTGTGG + Intronic
1074745672 10:116529560-116529582 CTCCATGGGCAGCCTGCCCCGGG + Intergenic
1076799211 10:132812871-132812893 GCCCAGTGGGAGCAGGCCCTGGG - Exonic
1077010140 11:376012-376034 GCCCCTTGGGAGGCCGCCCCGGG + Intronic
1077232570 11:1464604-1464626 CTCCATGGGGAGCCTGCCCTGGG + Intergenic
1077532079 11:3102061-3102083 GTCCCCTGGAAGCCGGCCCTCGG + Intronic
1089196463 11:116696453-116696475 GTCCATGGAGGGCAGGCCCCAGG + Intergenic
1090653552 11:128825889-128825911 GTGCATGGGCAGCCTGCCCCAGG + Intergenic
1091461143 12:644025-644047 GCCCCCTGGGAGCCGGCCCGTGG - Intronic
1105805002 13:23947473-23947495 GTCCATTGGGAGCCGGCCCCAGG + Intergenic
1114670357 14:24407814-24407836 GCCCGTTGGGGGCCTGCCCCTGG - Intronic
1119436791 14:74602806-74602828 GTCCAAGGGGAGACGGCTCCAGG + Intronic
1119806837 14:77487731-77487753 TTCCACTGGGAGGTGGCCCCAGG + Intronic
1121500183 14:94429374-94429396 GTAAATTGGCAGCCGGCACCAGG - Intergenic
1202902069 14_GL000194v1_random:49873-49895 GTCCATTGGGAGCCAGCCCCAGG - Intergenic
1124439777 15:29677632-29677654 GTCCACAGGGGGTCGGCCCCTGG + Intergenic
1124500328 15:30222977-30222999 GTCCATGGCGAGGCGGCGCCCGG - Intergenic
1124743245 15:32315689-32315711 GTCCATGGCGAGGCGGCGCCCGG + Intergenic
1125956092 15:43792235-43792257 GTCCAATGGGAGCCGGCTCCCGG + Intronic
1132708042 16:1254906-1254928 GTCCATGGGGAGCTGGGGCCGGG + Intergenic
1132786350 16:1658850-1658872 GTCCATAGGGAGGTTGCCCCGGG + Intronic
1137691347 16:50430190-50430212 GTTCATTGTGATCGGGCCCCAGG - Intergenic
1137700405 16:50493896-50493918 TTCCAGTGGGAGCCAGGCCCTGG - Intergenic
1142125589 16:88408784-88408806 GTGCATTGGGTGCCGGGCACAGG - Intergenic
1142603936 17:1071447-1071469 GTGGATTGGCAGCCGGGCCCGGG - Intronic
1144795019 17:17885388-17885410 GCCCATTGGGAGCTAGACCCAGG + Intronic
1148832214 17:50440988-50441010 GTCCATGGGGAGCCCCTCCCGGG - Intronic
1150414514 17:64976013-64976035 GTCCTTTGGGTGACTGCCCCAGG - Intergenic
1152225338 17:79090233-79090255 TTCTGTTGGGAGCTGGCCCCGGG + Intronic
1152737543 17:82004799-82004821 GGCCTTTGGAAGCCGGGCCCAGG + Intronic
1160719136 19:589929-589951 GTCCATGGCGAGGCGGCGCCGGG - Exonic
1163830415 19:19544832-19544854 GTCAATCTGGAGCCCGCCCCCGG + Exonic
1166982445 19:46639276-46639298 GTCCATCGGGACACGCCCCCAGG - Intergenic
925294327 2:2767553-2767575 GTCGAGTGGGAGCCTGGCCCAGG - Intergenic
926129517 2:10293008-10293030 GTCAGGTGGGAGCCAGCCCCTGG - Intergenic
929568509 2:43005588-43005610 GAGCCTTGTGAGCCGGCCCCGGG + Intergenic
934504620 2:94880557-94880579 GTCCATTGGGAGCCAGCCCCAGG + Intergenic
934531089 2:95089546-95089568 GGTGATTGGGAGCCGGGCCCAGG + Intronic
938696214 2:133837645-133837667 CTCCAGTGGGAGCCAGCCCGAGG + Intergenic
947993341 2:234504841-234504863 ATCCCTAGGGAGCCAGCCCCTGG + Intergenic
948716221 2:239865325-239865347 GTTCTGTGGGAGCCGGGCCCGGG - Intergenic
1169335030 20:4748899-4748921 GTCCAGAGGAAGCCGGCCCCAGG + Intergenic
1172044622 20:32071552-32071574 GGCCAGTGGGAGCCAGCCCGGGG + Intronic
1173546794 20:43903929-43903951 GTCCATGGGGGGCCTGCCCTTGG + Intergenic
1173951321 20:46995672-46995694 ATCCCTTAGAAGCCGGCCCCTGG + Intronic
1174165142 20:48578934-48578956 GGCCAATGGGAGCCTGCCCTGGG + Intergenic
1175934398 20:62508356-62508378 GTCCAGTGGGTGCTGCCCCCAGG - Intergenic
1175965675 20:62658946-62658968 GGGCCTTGGGAGTCGGCCCCAGG + Intronic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1176199758 20:63854987-63855009 GTCCCTGGGGAGCTGGCGCCAGG - Intergenic
1176621438 21:9064640-9064662 GTCCATTGGGAGCCAGCCCCAGG - Intergenic
1180224892 21:46386470-46386492 CTCCATTGGGAGCCTGTGCCTGG + Intronic
1180843117 22:18968409-18968431 GTGCAGTGGGAGCAGGCCCAAGG - Intergenic
1184265401 22:43343462-43343484 GGCCAATGGGCGCCGGCCTCCGG + Intergenic
1184655843 22:45941741-45941763 TTCCATGGGGAGTTGGCCCCGGG - Intronic
1185210548 22:49568454-49568476 GTCCACTGGGAGTCTGCCCTGGG - Intronic
1185210569 22:49568519-49568541 GTCCACTGGGAGTTGGCCCTGGG - Intronic
1185210591 22:49568585-49568607 GTCCGCTGGGAGTCGGCCCTGGG - Intronic
950031228 3:9855220-9855242 GTCCAGTGGGAGCTGCTCCCTGG - Intergenic
950305784 3:11914755-11914777 GCCCATTGGGAACAGGCTCCAGG + Intergenic
950510149 3:13420781-13420803 GTCGAGGGGGAGCGGGCCCCGGG - Intergenic
950680455 3:14581554-14581576 GTCCAATGGGAGACAGCCCCAGG + Intergenic
951540193 3:23775291-23775313 GGCCATTGGGAGCCGGCCTGGGG - Intergenic
954306042 3:49725992-49726014 GTCCCTTGGGATCCTTCCCCTGG - Exonic
954790570 3:53130251-53130273 GGCCCTTGAGAGCCTGCCCCAGG - Intronic
955194092 3:56788691-56788713 GTCAGGTGGGAGCCGGCCTCAGG + Intronic
961794727 3:129401443-129401465 GTCCAGAGGGAACTGGCCCCCGG + Exonic
962210977 3:133477316-133477338 GTCCATTGGGAGCCCTGCTCTGG - Intergenic
968726872 4:2251907-2251929 GTCCTTTGGGGGGCGGTCCCAGG + Intronic
969018124 4:4118867-4118889 GTGCAGTGGGAGGCGGCTCCAGG - Intergenic
969631755 4:8343139-8343161 CTCCATTGAGAGCTGGTCCCTGG + Intergenic
969735867 4:8989846-8989868 GTGCAGTGGGAGGCGGCTCCAGG + Intergenic
969795083 4:9521305-9521327 GTGCAATGGGAGGCGGCTCCAGG + Intergenic
972765548 4:42150669-42150691 GTCCCTTGGGCGCAGGCCTCAGG + Intronic
983255399 4:165394434-165394456 GACCATTGGGAGTGGGCCTCTGG + Intronic
988984442 5:36603106-36603128 GTCAATGGGGAGCCAGCCACAGG - Intergenic
992626440 5:78639976-78639998 GTCCAATTGCAGCCTGCCCCAGG + Intronic
1001300382 5:170529342-170529364 GGCCAATGGGAGCCAGCCCTGGG - Intronic
1001555630 5:172635187-172635209 CTTCCTTTGGAGCCGGCCCCAGG + Intergenic
1002478886 5:179486301-179486323 GGCCATTGGCACCCGGCCCTTGG - Intergenic
1002927159 6:1611246-1611268 GTCCAGCGGGAGCAGCCCCCCGG + Exonic
1007997652 6:46325613-46325635 GTGCAGTGGGAGCGGGCTCCAGG - Intronic
1010374863 6:75155770-75155792 GTGACTTGGGAGCCTGCCCCTGG - Exonic
1015187981 6:130440536-130440558 GCCCATCAGGCGCCGGCCCCGGG + Exonic
1019316629 7:390016-390038 GTCCATAGGAAGCCAGCCCTGGG - Intergenic
1019435097 7:1018536-1018558 GCCCAGTGGGAGCAGGCACCTGG + Intronic
1019666280 7:2253699-2253721 GTCCACTGCGAGCCGGCCAGAGG - Exonic
1029401961 7:100352417-100352439 GGCCATGGGGCGCCGGACCCTGG + Exonic
1035013815 7:155745473-155745495 GTCCATCCAGGGCCGGCCCCAGG + Exonic
1035326144 7:158067436-158067458 AGCCATTGGGAGCAGCCCCCAGG - Intronic
1037819880 8:22130482-22130504 GCCCATGGGGAGCAGGCGCCCGG - Exonic
1039852222 8:41379022-41379044 GTGCAAGGGGAGCCTGCCCCTGG - Intergenic
1042229582 8:66542467-66542489 GTCCACGGGGAGCCTGCCCTCGG + Intergenic
1047333976 8:123919000-123919022 CTCCAGTGGGATCCTGCCCCAGG + Intronic
1049348984 8:142154042-142154064 GTCCATGGGGAAACGGCCCTGGG + Intergenic
1051894187 9:21971011-21971033 GTCCACGGGCAGACGGCCCCAGG + Exonic
1057082235 9:92181521-92181543 GCCCAGCGGGAGCCAGCCCCAGG - Intergenic
1061010133 9:127949874-127949896 GTCCACTGGAAACCTGCCCCCGG + Intronic
1061912267 9:133731513-133731535 GTCCGTGGGGAGCAGACCCCTGG + Intronic
1062118164 9:134820276-134820298 GTCCCCTGGGTGCCTGCCCCAGG - Intronic
1203744621 Un_GL000218v1:35052-35074 GTCCATTGGGAGCCAGCCCCAGG - Intergenic
1203565483 Un_KI270744v1:84432-84454 GTCCATTGGGAGCCAGCCCCAGG + Intergenic
1189450404 X:41123673-41123695 GTCCATCAGGAGCCTGGCCCTGG - Exonic
1201157967 Y:11150093-11150115 GTCCATTGGGAGCCAGCCCCAGG - Intergenic