ID: 1105805744

View in Genome Browser
Species Human (GRCh38)
Location 13:23950844-23950866
Sequence GCCCCTTCCAGGCCAGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 832
Summary {0: 1, 1: 1, 2: 6, 3: 89, 4: 735}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105805738_1105805744 -4 Left 1105805738 13:23950825-23950847 CCCCTTCCAGTAACACTGAGCCC 0: 1
1: 0
2: 0
3: 20
4: 171
Right 1105805744 13:23950844-23950866 GCCCCTTCCAGGCCAGGCCCAGG 0: 1
1: 1
2: 6
3: 89
4: 735
1105805736_1105805744 11 Left 1105805736 13:23950810-23950832 CCCAGGAGGACTGAGCCCCTTCC 0: 1
1: 0
2: 2
3: 43
4: 249
Right 1105805744 13:23950844-23950866 GCCCCTTCCAGGCCAGGCCCAGG 0: 1
1: 1
2: 6
3: 89
4: 735
1105805739_1105805744 -5 Left 1105805739 13:23950826-23950848 CCCTTCCAGTAACACTGAGCCCC 0: 1
1: 0
2: 0
3: 16
4: 173
Right 1105805744 13:23950844-23950866 GCCCCTTCCAGGCCAGGCCCAGG 0: 1
1: 1
2: 6
3: 89
4: 735
1105805740_1105805744 -6 Left 1105805740 13:23950827-23950849 CCTTCCAGTAACACTGAGCCCCT 0: 1
1: 0
2: 3
3: 7
4: 181
Right 1105805744 13:23950844-23950866 GCCCCTTCCAGGCCAGGCCCAGG 0: 1
1: 1
2: 6
3: 89
4: 735
1105805734_1105805744 13 Left 1105805734 13:23950808-23950830 CCCCCAGGAGGACTGAGCCCCTT 0: 1
1: 0
2: 2
3: 25
4: 197
Right 1105805744 13:23950844-23950866 GCCCCTTCCAGGCCAGGCCCAGG 0: 1
1: 1
2: 6
3: 89
4: 735
1105805732_1105805744 23 Left 1105805732 13:23950798-23950820 CCAGGGCCAGCCCCCAGGAGGAC 0: 1
1: 0
2: 3
3: 51
4: 462
Right 1105805744 13:23950844-23950866 GCCCCTTCCAGGCCAGGCCCAGG 0: 1
1: 1
2: 6
3: 89
4: 735
1105805737_1105805744 10 Left 1105805737 13:23950811-23950833 CCAGGAGGACTGAGCCCCTTCCA 0: 1
1: 0
2: 1
3: 22
4: 253
Right 1105805744 13:23950844-23950866 GCCCCTTCCAGGCCAGGCCCAGG 0: 1
1: 1
2: 6
3: 89
4: 735
1105805731_1105805744 24 Left 1105805731 13:23950797-23950819 CCCAGGGCCAGCCCCCAGGAGGA 0: 1
1: 0
2: 1
3: 47
4: 425
Right 1105805744 13:23950844-23950866 GCCCCTTCCAGGCCAGGCCCAGG 0: 1
1: 1
2: 6
3: 89
4: 735
1105805735_1105805744 12 Left 1105805735 13:23950809-23950831 CCCCAGGAGGACTGAGCCCCTTC 0: 1
1: 0
2: 2
3: 24
4: 234
Right 1105805744 13:23950844-23950866 GCCCCTTCCAGGCCAGGCCCAGG 0: 1
1: 1
2: 6
3: 89
4: 735
1105805733_1105805744 17 Left 1105805733 13:23950804-23950826 CCAGCCCCCAGGAGGACTGAGCC 0: 1
1: 1
2: 1
3: 38
4: 332
Right 1105805744 13:23950844-23950866 GCCCCTTCCAGGCCAGGCCCAGG 0: 1
1: 1
2: 6
3: 89
4: 735
1105805741_1105805744 -10 Left 1105805741 13:23950831-23950853 CCAGTAACACTGAGCCCCTTCCA 0: 1
1: 0
2: 3
3: 10
4: 225
Right 1105805744 13:23950844-23950866 GCCCCTTCCAGGCCAGGCCCAGG 0: 1
1: 1
2: 6
3: 89
4: 735

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105805744 Original CRISPR GCCCCTTCCAGGCCAGGCCC AGG Intergenic
900125590 1:1067712-1067734 GGCCCTTCCCGACCAGGCCAAGG + Intergenic
900142533 1:1144688-1144710 GTCCCCGGCAGGCCAGGCCCCGG - Intergenic
900290308 1:1920933-1920955 GCCAGGTCCAGGCCAGGCCCCGG - Intergenic
900392886 1:2441358-2441380 GCCCCTCCCAGTGCAGGCCCAGG - Intronic
900394960 1:2449609-2449631 GCCCCACCCAGGCCAGGCAGAGG - Intronic
900474411 1:2869479-2869501 GCCCGTGCCAGGCCAGGCTCTGG - Intergenic
900524420 1:3121563-3121585 CGCACTTCCAGGCCAGGCCCAGG - Intronic
900791531 1:4684044-4684066 GCCTTTTCCAGGCCATTCCCGGG - Intronic
901063733 1:6485388-6485410 GCAGCCTCCAGGCCGGGCCCGGG - Intronic
901260817 1:7869310-7869332 GCCCTTTCAAGGGCAGCCCCCGG + Intergenic
901628638 1:10637682-10637704 GTGCCTGCCAGGTCAGGCCCTGG + Exonic
901868748 1:12125311-12125333 GCCCAGGCCAGGCCAGGCCGGGG - Intronic
901923590 1:12552557-12552579 GCCCCTCCCAGCCCAGGCACAGG + Intergenic
901929017 1:12584715-12584737 GCACCTTCCTGGCCGGGCCTTGG + Intronic
902217050 1:14940845-14940867 CCACCTGCCTGGCCAGGCCCAGG - Intronic
902288431 1:15421490-15421512 GCTCCATCCAGGGCAGGCTCTGG - Intronic
902408363 1:16198786-16198808 TTCCCTTCCAGGCCTGGCCCTGG - Intronic
902471548 1:16649964-16649986 TACCCTTCCAGGGCTGGCCCAGG - Intergenic
902487261 1:16757481-16757503 TACCCTTCCAGGGCTGGCCCAGG + Intronic
902923035 1:19678756-19678778 GGCCCTTGCAGGAGAGGCCCTGG + Intronic
902990859 1:20186191-20186213 GCCCCTTCCAGGCCTGGCGGAGG - Intronic
903233063 1:21933630-21933652 GCCCCTGCCTGGCTTGGCCCGGG - Intronic
903326971 1:22574471-22574493 GCCCCCTCCCTGCCAGCCCCTGG + Intronic
903543498 1:24109823-24109845 GTCCATTCAAGGCCAGGCCGTGG + Intronic
903559155 1:24215002-24215024 GCCCCTTGCAGGTGAGGCTCAGG + Intergenic
903785664 1:25859497-25859519 GCCCCGCCCCGGCAAGGCCCTGG + Intergenic
903954135 1:27013096-27013118 GTCCCTTTAAGTCCAGGCCCGGG - Intergenic
904009878 1:27383354-27383376 GCCCCCACCTGGCCACGCCCCGG - Intronic
904034299 1:27550785-27550807 CCCCCTGCCCTGCCAGGCCCAGG - Exonic
904044563 1:27602155-27602177 GCCCCTCCCAGCCCAGCCCCAGG + Intronic
904304643 1:29580304-29580326 GCTCCTTCCAGGCCTGGTCCTGG + Intergenic
904370093 1:30042799-30042821 GCCCTTTCCAGGCCTGCCCATGG + Intergenic
904598864 1:31662920-31662942 GCCCCTGCCATGCCAGCCCCTGG - Intronic
905043246 1:34977125-34977147 GCGGCCTCCGGGCCAGGCCCAGG + Intergenic
905201794 1:36321147-36321169 GCCCCAGCCAGGTCAGGCCGCGG - Exonic
905386198 1:37605989-37606011 GAGCCTTCCAGGACTGGCCCAGG + Intergenic
905485522 1:38293026-38293048 TCCCACTCCAAGCCAGGCCCTGG - Intergenic
905742831 1:40387793-40387815 GCCCCTTCCTGGGCTGGCCGAGG + Intronic
905873104 1:41416184-41416206 GCCTCTTCCAGGGCAGGGCTTGG - Intergenic
905891698 1:41522122-41522144 GCCACCTCCAGGCCTGCCCCAGG - Intronic
906279358 1:44542925-44542947 GCCCCTCCCAGGCCCGCTCCAGG + Intronic
906468419 1:46105744-46105766 CCCCCTTCCACCCCAGCCCCGGG - Intronic
906701224 1:47859557-47859579 GCCCCTTTCTGGCCTGACCCTGG + Intronic
906811706 1:48833883-48833905 GCCACTTCCACCACAGGCCCAGG + Intronic
907046634 1:51303608-51303630 GCCCCTCCCCAGCCAGGCTCTGG - Intronic
907243498 1:53093277-53093299 GCCCCAGCCAGGCCTGGCTCCGG - Intronic
907809079 1:57850640-57850662 GGCACTTGCAGGCCAGGCCTTGG - Intronic
907815487 1:57914412-57914434 GCCCATCCCATGACAGGCCCTGG - Intronic
908085318 1:60625804-60625826 GCCTCAGCCAGGCCAGGCCAGGG - Intergenic
908259325 1:62327439-62327461 GCCTCTTCCAGGCCTGCCCATGG - Intergenic
910378019 1:86594516-86594538 GCCCCTCCCATCACAGGCCCAGG - Intergenic
910507029 1:87961093-87961115 GCACCATCCAGGCCAGGGCCTGG - Intergenic
910622712 1:89273747-89273769 GCCCCTTCCTGGGCTGGCCGAGG - Intergenic
911176137 1:94820312-94820334 GCCCCTCCCCGGCCCGGCCCCGG + Intergenic
911975294 1:104487360-104487382 GCCCACCCCAGGACAGGCCCTGG + Intergenic
912457439 1:109807325-109807347 GGCTCTTACAGGCCTGGCCCTGG - Intergenic
912746293 1:112248295-112248317 GGCCCGTCCAGCCCAGGCCTTGG + Intergenic
915079494 1:153342053-153342075 GCACCCGCCAGGCCAGGCCAGGG + Intronic
915489664 1:156244097-156244119 GCCCCCTCCAGGACAGGGTCAGG + Exonic
916606098 1:166343453-166343475 GCCCCTTCCTGGGCTGGCCCAGG - Intergenic
917406274 1:174711259-174711281 GCCCCTTCCTGGGCTGGCCAAGG - Intronic
917817640 1:178725981-178726003 GCCCCCGCCAGCCCCGGCCCCGG + Intronic
917869557 1:179229488-179229510 CTCCCTCCCAGCCCAGGCCCTGG + Exonic
917963436 1:180164130-180164152 GCCTGTTGCATGCCAGGCCCAGG - Intronic
918100123 1:181365661-181365683 GCCCCTCCCTGTCCAGACCCTGG - Intergenic
919731708 1:200916961-200916983 GCCCCTCCCAGACATGGCCCAGG - Intergenic
921386170 1:214572263-214572285 CCTCCTTCCAGGCCCAGCCCAGG - Intergenic
922179013 1:223219184-223219206 GCCCCTCCCATCACAGGCCCAGG + Intergenic
922555591 1:226529872-226529894 GCCCCTCCCAGGCCAGTCAGGGG - Intergenic
922570843 1:226634016-226634038 GCCGGCTCCAGGCCAGACCCAGG - Exonic
923234817 1:232022208-232022230 GCCATTTCCATGCCATGCCCAGG - Intronic
923623280 1:235594803-235594825 GCCCCTTCCTGGGCTGGCCAAGG - Intronic
1063181717 10:3607382-3607404 ACCCTTTCCACTCCAGGCCCAGG + Intergenic
1063300449 10:4845337-4845359 GCCCCTTCCTGGGCTGGCCGAGG - Intronic
1063391619 10:5653231-5653253 GCCCCTTGTAGGCCTTGCCCAGG - Intronic
1064460970 10:15534908-15534930 GCCCCTTCCTGGGCTGGCCGAGG + Intronic
1065695589 10:28376761-28376783 TCCCCTTCCAGGCTCTGCCCTGG + Intergenic
1065893092 10:30137758-30137780 GCCCCTTCCAGGCAGGGAGCAGG - Intergenic
1066370652 10:34815580-34815602 GCCCCCACCAGCCCTGGCCCAGG + Intergenic
1066659054 10:37721531-37721553 GCCTCTGCCAGCCCAGGCCTGGG - Intergenic
1067058228 10:43064630-43064652 GCCCCCTCCTGGCAAGGCCCCGG - Intergenic
1067062919 10:43087196-43087218 GTGCCTCCCAGGCCAGGGCCGGG + Intronic
1067569137 10:47359011-47359033 CCCCTTTCCAGATCAGGCCCAGG - Intergenic
1067705097 10:48600842-48600864 TCTACTTCCAGGCCAGGCCCTGG - Intronic
1067723411 10:48747972-48747994 GCCCTTTCCAAGCCAGGCCTTGG + Intronic
1067779588 10:49190065-49190087 GCTACATTCAGGCCAGGCCCAGG + Intergenic
1067801603 10:49362963-49362985 GCCCCTGCCAGGCCGGACCCAGG + Intergenic
1067839322 10:49663463-49663485 GCCCTGTCCATGCCAGGCCCTGG - Intronic
1067911400 10:50350515-50350537 GCCCCTCCCATCACAGGCCCAGG + Intronic
1069174873 10:65279049-65279071 GCCCCTCCCATCACAGGCCCAGG + Intergenic
1069624529 10:69859709-69859731 GCCCCTCCCAGTCCAGTCGCAGG + Intronic
1069708578 10:70474846-70474868 CTCCCTTCCCTGCCAGGCCCTGG - Intergenic
1069920963 10:71815367-71815389 GACCCTCCAAGGCCAGGCCTTGG + Exonic
1070727575 10:78802797-78802819 GTCCCTGCCTGGCCTGGCCCAGG - Intergenic
1070781999 10:79143104-79143126 GCCCCCTCCAGGCCAGGCCCCGG + Intronic
1070795887 10:79215975-79215997 ACCTCTTCCGTGCCAGGCCCTGG - Intronic
1070801643 10:79247482-79247504 CCCCCTGCCTGGCCAGGCTCAGG + Intronic
1070814634 10:79315072-79315094 GCTCCCTGCAGCCCAGGCCCCGG + Exonic
1071244417 10:83746990-83747012 GCACCCTCCAAGCCAGGCACAGG + Intergenic
1071997695 10:91163380-91163402 GCGCCTTCCAGTCCTGGCCGCGG + Intronic
1072107928 10:92291435-92291457 ACCCGCTCAAGGCCAGGCCCAGG - Exonic
1072151627 10:92689527-92689549 GCGCCGTCCAGGCCTGGGCCCGG - Intergenic
1072303611 10:94085811-94085833 CTGTCTTCCAGGCCAGGCCCTGG - Intronic
1073332858 10:102682076-102682098 GCGCCCTCGAGGTCAGGCCCAGG - Intronic
1074183859 10:111084957-111084979 GATGCTTCCACGCCAGGCCCAGG - Intergenic
1074715906 10:116218484-116218506 GCCCCTTCCTGCCCAGGTGCAGG + Intronic
1074996407 10:118760569-118760591 GCCCCTTCCTGGGCTGGCCGAGG - Intergenic
1075089435 10:119435160-119435182 GCCCCTCCCATCACAGGCCCAGG - Intronic
1075590192 10:123685471-123685493 GCCCCCTCCAGGCCCGGCTGTGG - Intronic
1076096365 10:127737309-127737331 GGCCCCGCCCGGCCAGGCCCAGG + Exonic
1076749988 10:132537744-132537766 GCCCCGCCCAGGCCCCGCCCCGG + Intergenic
1076804867 10:132850309-132850331 GGGCCCTCCCGGCCAGGCCCAGG + Exonic
1076838838 10:133034762-133034784 GCCCCTTCCATGCTAAGCACTGG + Intergenic
1076895451 10:133309163-133309185 GCCCCTCCCACTCCAGGCTCCGG - Intronic
1076991789 11:279517-279539 GCCACCTCCAGGGCAGGCTCCGG - Exonic
1076993042 11:285463-285485 GCCCCGTCCAGGACAGGCCCAGG + Intergenic
1077231556 11:1460109-1460131 GGGCCTTCCGGGCCAGGCCTTGG + Intronic
1077609576 11:3636096-3636118 TCCCATTCCAGGCCAATCCCAGG + Intergenic
1078251953 11:9623459-9623481 GCCCCTTTCTGGCCTGGCCAAGG - Intergenic
1078301258 11:10133726-10133748 GCCCCTTTCTGGCCTGGCCAAGG - Intronic
1078590498 11:12636982-12637004 ACCCCTCCCAGTCAAGGCCCTGG - Intergenic
1079130300 11:17743460-17743482 GGCCCTGCCTGGCCAGGCCATGG + Intronic
1080395465 11:31886034-31886056 GTGCCCTCCAGGCCTGGCCCAGG + Intronic
1080482629 11:32667449-32667471 GCACCGTCCAAGCCAGGCACAGG + Intronic
1080749830 11:35141452-35141474 TCTTCTTTCAGGCCAGGCCCAGG - Intronic
1081850847 11:46274197-46274219 GCCCTTTCCAGGACAGGGCCTGG - Intergenic
1083085015 11:60134077-60134099 GCCCCTCCCATTACAGGCCCAGG + Intergenic
1083165863 11:60887043-60887065 GCCCACCCCAGGACAGGCCCTGG - Intergenic
1083321776 11:61852110-61852132 GCCCAGCCCAGGCCAAGCCCGGG - Intronic
1083331354 11:61899905-61899927 GCCTGCTCCATGCCAGGCCCCGG + Intronic
1083428485 11:62601708-62601730 GCTCCTGCCAGGCCAGAGCCAGG + Exonic
1083484852 11:62976916-62976938 GCAGCCTCCAGGCCAGGGCCGGG + Intronic
1083602527 11:63957884-63957906 GCTCCTGCCAGCCCTGGCCCGGG + Intergenic
1083739466 11:64701044-64701066 GCACCGCCCAGGCCAGGCCCTGG + Intronic
1084310045 11:68311865-68311887 GCCCCTTCCAGGCTGTGCCTGGG + Intergenic
1084361389 11:68670395-68670417 GCCTCTTGCTGGGCAGGCCCCGG + Intergenic
1084378159 11:68792528-68792550 GGAACATCCAGGCCAGGCCCAGG - Intronic
1084456468 11:69270615-69270637 AGCCCCTCCAAGCCAGGCCCAGG + Intergenic
1084484994 11:69443080-69443102 GCCCCTTCCTGGCCAGTGCTGGG - Intergenic
1084654170 11:70505590-70505612 GCCCCCTCAAGGCCCGGCACTGG - Intronic
1084674001 11:70623900-70623922 GCCCCTCCCAGGCCAGGGCAGGG + Intronic
1084889617 11:72230277-72230299 ACCCCTCCCAGGTCTGGCCCTGG - Intronic
1085030076 11:73265685-73265707 GCCCCTTCCTGCCCAGGCAGTGG - Intronic
1085253688 11:75160019-75160041 CCCGCCTCCAGGCCAGACCCTGG - Intronic
1085291031 11:75399663-75399685 GCCGCTTCCAGGGCAGGCCACGG - Intronic
1085298803 11:75446317-75446339 GGCCCTCCCTGGCCAGGCTCAGG + Intronic
1085429055 11:76430735-76430757 CCCCATTCCATGCCAGGCCCTGG - Intergenic
1085477217 11:76796180-76796202 GCCGGTTCCAGGCCAGGTTCAGG - Exonic
1085512825 11:77096889-77096911 GCCCCTCCCAGGCCCCACCCAGG - Intronic
1086887731 11:92224551-92224573 GCCGCTTCCAGGCCCGGCGCCGG + Intergenic
1088640760 11:111871089-111871111 GCCCACTCTAGGCCTGGCCCAGG + Intronic
1089002003 11:115059930-115059952 CCCCCTTCCCTGCCTGGCCCTGG + Intergenic
1089244790 11:117110872-117110894 GCCCCTTTCTGGGCAGGCCGAGG - Intergenic
1089401377 11:118166518-118166540 GCCACTGCCAGGCCAAGCACTGG + Exonic
1089593574 11:119560485-119560507 GCCCCGTCCTGGCCTGCCCCAGG - Intergenic
1089823178 11:121246675-121246697 GCCTCTTCCAGGCCTGCCCATGG + Intergenic
1090064781 11:123493379-123493401 ACCCCTTGCAGGCTAAGCCCAGG - Intergenic
1090177487 11:124663965-124663987 AGCTATTCCAGGCCAGGCCCAGG + Intronic
1090399915 11:126442653-126442675 GCTCCCTCCAGCCCATGCCCAGG + Intronic
1090820574 11:130337781-130337803 GCCCCTTCCTGGGCTGGCCGAGG - Intergenic
1091037219 11:132245127-132245149 GCCCCTGCCAGGCCTGGCAGAGG + Intronic
1091450712 12:570539-570561 GGCCCTTTAAGGCCAGGCCCAGG + Intronic
1091590133 12:1837819-1837841 GCCCCTCTCAGGCCTGGCACAGG + Intronic
1091787580 12:3252355-3252377 GCCCATTCCAGGCCAGGGAATGG + Intronic
1091816453 12:3442574-3442596 ACCCGTTCCAGGCCAAGCCCTGG - Intronic
1091971154 12:4788157-4788179 GCCCCCTCCCCGCCAGCCCCCGG - Intronic
1092258991 12:6942399-6942421 CCCGCTTCCCTGCCAGGCCCTGG - Intergenic
1092366491 12:7881219-7881241 GCCCCTTCCTGGGCTGGCCTAGG + Intronic
1092410982 12:8252612-8252634 GCCCCTTCCTGGGCTGGCCGAGG - Intergenic
1092668217 12:10830934-10830956 GCCCGCACCCGGCCAGGCCCAGG + Intronic
1092752194 12:11729228-11729250 GCCCCTTCTAGGCCACGAACTGG - Intronic
1093394148 12:18660132-18660154 GCACCTTCCAGGAGAGGACCTGG + Intergenic
1093653992 12:21674472-21674494 GCCCCTTTCTGGCCTGGCCAAGG - Intronic
1094424627 12:30305425-30305447 ACCCCCTCCAGGCCCAGCCCCGG + Intergenic
1094792474 12:33930756-33930778 GCACCTTCCAAGCCATGCGCAGG - Intergenic
1096024849 12:48351285-48351307 GCCCGTTACAGGCCAGACCGAGG + Intronic
1096094395 12:48925006-48925028 CCCCCTCCCAGGCCCCGCCCCGG + Intronic
1096521934 12:52189307-52189329 GCCCCTTCCAGGCAGGAGCCTGG - Intronic
1096526927 12:52215646-52215668 GCCCCTTCCAGAGCAACCCCTGG + Intergenic
1097036820 12:56129589-56129611 CCCCTTTCCAGTCCAGGGCCTGG - Intronic
1097194244 12:57235091-57235113 GCCCCAGCCTGGGCAGGCCCTGG + Exonic
1097378014 12:58861046-58861068 GCCCCTCCCATCACAGGCCCTGG - Intergenic
1098795927 12:74888114-74888136 GCCCCTCCCATCACAGGCCCAGG - Intergenic
1100166670 12:91924311-91924333 GCCCCTTCCTGGGCTGGCCGAGG - Intergenic
1100844382 12:98644515-98644537 CCACTTACCAGGCCAGGCCCAGG + Exonic
1101021569 12:100559320-100559342 GCCCCTTTCAGGGCTGGCCAAGG + Intronic
1101238422 12:102813480-102813502 TCCCCTTCCAGGGAAGGCTCTGG + Intergenic
1102278339 12:111599333-111599355 GCCCCTCCCCCGCCCGGCCCCGG - Exonic
1103410802 12:120710388-120710410 GCCCCTTCCCCGCCGGGCCCCGG + Intergenic
1103588111 12:121971189-121971211 GTGGCCTCCAGGCCAGGCCCAGG - Intronic
1103725842 12:122997018-122997040 GACCCTTCCCGGCCAGGGCCTGG + Intronic
1104633558 12:130424434-130424456 GCCGCGTGCAGCCCAGGCCCTGG - Intronic
1104805553 12:131587076-131587098 GCCTTTTCCAGGCCAGCCCATGG + Intergenic
1104965999 12:132509089-132509111 CCCCCGTCCAGCCCGGGCCCAGG - Intronic
1105070416 12:133231172-133231194 CCCCCTTTCTGGCCAGTCCCTGG + Intronic
1105247641 13:18667138-18667160 GTGCCTTGCAGCCCAGGCCCTGG + Intergenic
1105541516 13:21320748-21320770 GGCCCTTCCAGTCCAGGTCTGGG - Intergenic
1105805744 13:23950844-23950866 GCCCCTTCCAGGCCAGGCCCAGG + Intergenic
1106563245 13:30864369-30864391 TTCCCCTCTAGGCCAGGCCCTGG - Intergenic
1107086960 13:36435354-36435376 GTGCCATCCTGGCCAGGCCCAGG - Intronic
1107443579 13:40449845-40449867 ACCCCTTCCACTCCAGGCCTGGG - Intergenic
1108308578 13:49163426-49163448 GGACCCTCCATGCCAGGCCCTGG + Intronic
1108423061 13:50270603-50270625 GACCCTTCCAGCTGAGGCCCAGG + Intronic
1108502912 13:51084501-51084523 TCCCCTTCAAGGCCAGGCCAAGG - Intergenic
1108724367 13:53163855-53163877 GCCCCTCCCATCACAGGCCCAGG - Intergenic
1111575021 13:90142683-90142705 CCCCCTTCCACGACAGGCCCTGG + Intergenic
1112144875 13:96688058-96688080 CCCCATTCCATGACAGGCCCCGG - Intronic
1112337870 13:98529314-98529336 GCCCCTTCCAGGTCACTGCCTGG + Intronic
1112350415 13:98628634-98628656 GCTCTCTCCAGGCCAGGCGCTGG + Intergenic
1112563758 13:100534904-100534926 GCACCCTCCAGGTCAGGCGCTGG - Intronic
1113182756 13:107650265-107650287 GCCCCCTTCAGGCCAGGTCCGGG - Intronic
1113783106 13:112987727-112987749 GCCCCTTCCAGGCCCTGGACAGG - Intronic
1113950022 13:114066576-114066598 GTCCCTTCCAGGCCTGGGCCTGG + Intronic
1113961340 13:114127978-114128000 CCCCTTTCCAGGCAAGGCCCGGG + Intronic
1115490940 14:33957534-33957556 CCCACTTCCAGGCCAGGAGCAGG - Intronic
1115534672 14:34361954-34361976 GCTCCTTCCGGACCAGCCCCTGG - Intronic
1115851661 14:37594721-37594743 CCCGCTTCCAGGCCCGGCCAAGG + Intronic
1116127097 14:40801273-40801295 GCCCCTCCCATCACAGGCCCAGG - Intergenic
1116900908 14:50361894-50361916 GCCCCTTTCTGGGCAGGCCAAGG + Intronic
1119223306 14:72926278-72926300 GCCCCAGACAGGCCAGGCCTGGG + Intergenic
1121125371 14:91403401-91403423 GCCCTTTCCAGACAAGGCGCCGG + Intronic
1121429444 14:93876624-93876646 GCCCTTTAGGGGCCAGGCCCTGG - Intergenic
1121528891 14:94638855-94638877 GCTCCTTCCAGGCAGGGCCCAGG + Intergenic
1121717313 14:96085421-96085443 GCCCCTTCCTGCCCCAGCCCAGG - Intronic
1121974054 14:98385908-98385930 GCCTCTTCCAGGCCTGCCCATGG + Intergenic
1122059096 14:99124699-99124721 GCACCTCCAAGGCCTGGCCCAGG - Intergenic
1122205554 14:100146293-100146315 GCTTCGTCCAGGCCAGGCCCAGG - Exonic
1122348180 14:101073213-101073235 GCCCGTTCCAGGCCTGGGGCTGG + Intergenic
1122521062 14:102344096-102344118 GCTCCTTCCAGGTCCTGCCCTGG + Intronic
1122625658 14:103084292-103084314 GCCCCTCCCCAGCCTGGCCCCGG + Intergenic
1122815980 14:104314297-104314319 CCCCGTGCCAGGTCAGGCCCTGG + Intergenic
1122864017 14:104595452-104595474 GCCCCTCCCTGTCCTGGCCCTGG + Intronic
1122887055 14:104714792-104714814 TCCCCTTTGAGGCCCGGCCCCGG - Exonic
1122923910 14:104891214-104891236 GCCCTCTCCAGGCCAGGCGCTGG + Intronic
1123015054 14:105369527-105369549 CCCCCTCCCAGGAAAGGCCCTGG - Intronic
1123036438 14:105473847-105473869 GACCCCTCGAGGTCAGGCCCTGG + Intronic
1123108856 14:105855894-105855916 GCCTCTTCCAGGTGAGGGCCGGG - Intergenic
1123116852 14:105898820-105898842 CCCCCTCTCAGGCCAAGCCCTGG - Intergenic
1202918988 14_KI270723v1_random:13499-13521 GCCCCTTGCAGTCAGGGCCCAGG + Intergenic
1202925641 14_KI270724v1_random:21496-21518 GCCCCTTGCAGTCAGGGCCCAGG - Intergenic
1124405928 15:29391632-29391654 GCATCTTACAGGGCAGGCCCTGG - Intronic
1124406894 15:29401014-29401036 GCCCCTTCAAGCCTGGGCCCCGG + Intronic
1124438625 15:29671226-29671248 GACCCTTCCAGACCTAGCCCTGG + Intergenic
1125726489 15:41870937-41870959 GCTTCTGCCAGGCCAGGCTCTGG + Intronic
1126386267 15:48096532-48096554 GCCCCTTTCATGCAAGGCCCAGG + Intergenic
1126410817 15:48371344-48371366 GCCCATTCCAGGTCAGGCTCTGG - Intergenic
1126639615 15:50811907-50811929 GCCCCTTCCTGGGCTGGCCGAGG + Intergenic
1126668338 15:51094425-51094447 ACCCCTTCCAGGCCAAGACTGGG - Intronic
1127829325 15:62736778-62736800 TCCCCTTCTGTGCCAGGCCCTGG + Intronic
1128129259 15:65214845-65214867 GACCCACCCAGGCCAGGCCTTGG - Intergenic
1128161176 15:65423414-65423436 GTCCATTCCAGCCCAGGTCCTGG + Intergenic
1128509564 15:68305058-68305080 GGGCCTTGCAGGCCAGGGCCAGG - Intronic
1128511057 15:68314118-68314140 GTCCGTGCCAGGCCAGGCACAGG - Intronic
1128758062 15:70196523-70196545 GTGGATTCCAGGCCAGGCCCGGG - Intergenic
1128801436 15:70499591-70499613 GCCTCCTGCATGCCAGGCCCTGG + Intergenic
1129208581 15:74052477-74052499 GCCCCTTCCTGGGCTGGCCGAGG + Intergenic
1129460303 15:75697079-75697101 TCCCCAGCCAGGCCAGGGCCGGG + Intronic
1129902789 15:79164556-79164578 CCCTCTTCAAGGACAGGCCCAGG - Intergenic
1130296331 15:82648799-82648821 GCCCCTTACAAACCGGGCCCAGG - Intronic
1131078570 15:89514932-89514954 GCTCCTGCCAGGTCATGCCCAGG - Intergenic
1131248277 15:90814573-90814595 GCGTCTTCCTGGCCAGCCCCAGG - Intronic
1131249191 15:90819614-90819636 GCCCCATGAAGGTCAGGCCCTGG + Intergenic
1131344854 15:91637021-91637043 TATCCTTCCAGGCCAGGCCTAGG + Intergenic
1131827630 15:96333389-96333411 GGCCCTTACAGGCCCTGCCCAGG + Intronic
1132097655 15:98999988-99000010 GCCCCTTTCTGGGCAGGCCAAGG + Intronic
1132467329 16:83367-83389 GCCACTTCCAGGCCAGGCCAGGG + Intronic
1132498194 16:273679-273701 GCCCAGCCCAGGCCAGGCTCCGG - Intronic
1132549900 16:550044-550066 GCCACATCCTGGCCAGGCCGTGG + Intronic
1132568146 16:632498-632520 GCCCCTGCAAGGGGAGGCCCAGG - Intronic
1132584921 16:701943-701965 GCAGCTCCCAGGCCAGGCTCAGG - Intronic
1132603506 16:784154-784176 GCTCCTCCCTGGCCAGCCCCGGG - Intergenic
1132625189 16:888215-888237 GTCCCTGCCCGCCCAGGCCCTGG + Intronic
1132896020 16:2229772-2229794 GGCCCCTCCCAGCCAGGCCCTGG - Intronic
1132898989 16:2243306-2243328 GCCCCTTTCTGGTAAGGCCCTGG - Exonic
1132974672 16:2705406-2705428 GCCCGTGCCAGGCCAGGCTGTGG + Intronic
1132995780 16:2821632-2821654 GCCACTGCCAAGTCAGGCCCTGG + Exonic
1133202471 16:4212642-4212664 ACTCCGGCCAGGCCAGGCCCGGG + Intronic
1133287300 16:4696626-4696648 GCCCATACCAGGCAGGGCCCTGG - Exonic
1133336079 16:5007490-5007512 GGCCCTCCCCGGCCAGGCCCTGG - Intronic
1134093747 16:11405362-11405384 GCCCCTTAAGGGCCAGGACCAGG - Intronic
1135525760 16:23212612-23212634 GACCCTTCCTGGCCATCCCCAGG - Intronic
1135583461 16:23648240-23648262 TGACCTTCCAGGCCAGGCTCAGG + Intronic
1136408779 16:30064789-30064811 GCCCCTTGCAGGACCGGGCCGGG + Intronic
1136450918 16:30353871-30353893 GCCCCAGCCACGCCAGCCCCTGG + Intronic
1136452194 16:30359696-30359718 GCCCCTCCCGGCCCAGGACCAGG + Intronic
1136535619 16:30897264-30897286 GCCCCATCCATGCAAGGCGCTGG - Intronic
1136625549 16:31459771-31459793 GCCCCGTCCCAGGCAGGCCCCGG + Exonic
1136651950 16:31680613-31680635 GTCCCTTCCAGGCCAGTCCTTGG + Intergenic
1136866881 16:33766462-33766484 GCCATCTCCAGACCAGGCCCAGG + Intergenic
1137603346 16:49771044-49771066 GGCACCTCCAGGTCAGGCCCCGG + Intronic
1137619419 16:49866729-49866751 GCCCCTGGGAAGCCAGGCCCTGG - Intergenic
1139449513 16:67018353-67018375 GTCCTTTCCAGGCCATGCCCTGG + Intergenic
1139528471 16:67530227-67530249 GCCCTGGCCAGGCCCGGCCCGGG + Intronic
1139577017 16:67847886-67847908 GCCCCTTCCAGCCCAGGTTCTGG - Intronic
1139953184 16:70681635-70681657 GCCCCATTCAGCCCAGGGCCTGG - Intronic
1140224501 16:73066964-73066986 GCCCCTTCCAGCCAAGGCCTGGG + Intergenic
1140722582 16:77784799-77784821 GCCCCTTCCTGGGCTGGCCGAGG - Intergenic
1141043289 16:80690785-80690807 GCCCCTACCATGCCAGCCACAGG + Intronic
1141103546 16:81215165-81215187 GTCCCTCGCAGGCCAGGCTCTGG + Intergenic
1141430967 16:83969921-83969943 GGCCCTCCCAGCCCAGACCCCGG - Intronic
1141443278 16:84042852-84042874 GCCCCCTGCAGGCCCGGCCCCGG + Intergenic
1141837660 16:86553374-86553396 GCCCCTTTCTGGACTGGCCCAGG + Intronic
1141935860 16:87237240-87237262 GCACCTGCCTGGCCAGCCCCTGG - Intronic
1142134519 16:88445498-88445520 GCCCCAGCCGCGCCAGGCCCTGG - Intergenic
1142159581 16:88550203-88550225 TCTCCTTCCACGCCAGGCCAGGG + Intergenic
1142212677 16:88815964-88815986 GCCAACTCCAGGCCAGCCCCAGG - Intronic
1142222917 16:88864260-88864282 GCGGCCTCCAGGGCAGGCCCCGG - Exonic
1142226402 16:88879824-88879846 GCCCCTGGCTGACCAGGCCCTGG - Intronic
1142260389 16:89040021-89040043 CCCGCTTCCAGCCCAGGGCCAGG - Intergenic
1203105281 16_KI270728v1_random:1349740-1349762 GCCATCTCCAGACCAGGCCCAGG - Intergenic
1203128233 16_KI270728v1_random:1612628-1612650 GCCATCTCCAGACCAGGCCCAGG + Intergenic
1142572012 17:880912-880934 GCCCCTTGGAGCCCTGGCCCAGG - Intronic
1142614204 17:1125475-1125497 GCACCATCCACGCCTGGCCCGGG + Intronic
1143111486 17:4555371-4555393 GCCGCTTCCAGGTCAGGGCACGG + Exonic
1143830221 17:9645422-9645444 GCCCCCTCCAGGGCAGCGCCGGG - Intronic
1144358539 17:14469387-14469409 GCCCCTGATAGGCCAGGGCCAGG - Intergenic
1144784513 17:17824224-17824246 CCCCCTTCTAGGGCAGCCCCAGG + Intronic
1144944361 17:18962163-18962185 GCCCCTGGCAGACCAGGGCCAGG - Intronic
1145061549 17:19737399-19737421 TCCCCTTACCTGCCAGGCCCAGG + Intergenic
1145250342 17:21293812-21293834 GCCTGCTCCATGCCAGGCCCAGG - Intronic
1145268631 17:21392561-21392583 GCCCCTCCAAGGCCAGTGCCGGG - Intronic
1145814249 17:27783953-27783975 GCTCTTTTCTGGCCAGGCCCTGG - Intronic
1145866958 17:28247747-28247769 GCCCCTTCCAGGCCACTCTTGGG + Intergenic
1146000647 17:29128361-29128383 CCCGCTTCCGGGACAGGCCCTGG + Intronic
1146459442 17:33033793-33033815 GCCCCTTCCAGGCCCACCCATGG + Intronic
1146470516 17:33120824-33120846 CCAGCTACCAGGCCAGGCCCTGG - Intronic
1146637889 17:34519537-34519559 CCCCCATCCAGGCCAGGACAGGG + Intergenic
1147423120 17:40332263-40332285 TCCCGTCCCAGGCCAGGCCCCGG - Intronic
1147793259 17:43025861-43025883 ACCCCGTCCAGCCCAGCCCCTGG - Intronic
1147925135 17:43941347-43941369 GCCCCTTCCAGGCCTGCTCTTGG - Intronic
1148241271 17:46000819-46000841 GACCCAGCCAGGCCAGCCCCTGG + Intronic
1149158927 17:53667478-53667500 GCCCCTCCCATCACAGGCCCAGG + Intergenic
1149996389 17:61408193-61408215 GCCCCTTCCTGGGCAGTGCCCGG + Exonic
1150775768 17:68080596-68080618 GCCCCTTCCTGGGCTGGCCAAGG + Intergenic
1151433119 17:74078331-74078353 GCTCCTTCCAGGCCAGGCAGTGG - Intergenic
1151458225 17:74239316-74239338 GCCTCCTCCATGCTAGGCCCGGG - Intronic
1151562542 17:74878282-74878304 GCCCCTCCCTGGCCTGGCCCTGG - Exonic
1151704207 17:75758176-75758198 GCTCCTGCCCGCCCAGGCCCTGG + Intronic
1151812576 17:76453087-76453109 TCCCGCTCCAGCCCAGGCCCCGG - Exonic
1151821589 17:76499879-76499901 CCCCCTTGCAGCCCAGGCCTGGG - Intronic
1151897596 17:76990687-76990709 GCCCCATCCAGGCCAAGTCCCGG - Intergenic
1151903811 17:77034996-77035018 GCCCCCTCCAGGCCCAGCCCTGG + Intergenic
1151977120 17:77489301-77489323 GCCCCTTCCAGGGCTGGACGGGG + Intronic
1152068134 17:78122547-78122569 GCTCCCTGCAGGCCTGGCCCTGG - Intronic
1152214460 17:79024415-79024437 GCCTCCTCCCGGCCAGGTCCGGG - Exonic
1152341443 17:79728144-79728166 GCCATCTCCAGACCAGGCCCAGG + Intergenic
1152418070 17:80175821-80175843 GCCCCTGCCACCCCAGGGCCAGG - Intronic
1152545685 17:80999104-80999126 TCCCTGTCAAGGCCAGGCCCAGG + Exonic
1152585882 17:81189261-81189283 CCCCGTTCCTGGCCAGGCGCAGG - Intergenic
1152610418 17:81312604-81312626 GCCCCTCTGATGCCAGGCCCTGG + Exonic
1152626529 17:81390282-81390304 GCCCCCTCCCGACCAGGCCTGGG - Intergenic
1152748218 17:82051005-82051027 CGCCCTTCCAGGCCAGGTCAGGG - Intronic
1152790783 17:82278053-82278075 GCCCCTTCCTGGCTGGGCTCAGG - Intergenic
1152843891 17:82587539-82587561 GCCGCTTCCAGGCCACACCCAGG - Intronic
1153025919 18:672253-672275 GCCCCTTCCAGGTTAGATCCAGG + Intronic
1154198308 18:12281879-12281901 GCCACTCCAAGGCCAGGCCAGGG + Intergenic
1154441201 18:14391981-14392003 GTGCCTTGCAGCCCAGGCCCTGG - Intergenic
1154492798 18:14934200-14934222 CTGCCTTCCAGGCCAGGCTCAGG - Intergenic
1155168108 18:23247442-23247464 GCCCCTTCCAAGCCAGGATCTGG + Intronic
1156213879 18:34977144-34977166 GTCCCTCCCAGGCCAGGGGCTGG + Intronic
1156370091 18:36465418-36465440 GCCCTCGCCAGTCCAGGCCCAGG - Intronic
1156484327 18:37455463-37455485 GCCCCCTACAGCCCAGGCCTTGG - Intronic
1156610542 18:38718803-38718825 GCCCCTTTCTGGCCTGGCCAAGG - Intergenic
1156886452 18:42141162-42141184 GCCCTTTCCACTCCATGCCCAGG + Intergenic
1157606656 18:48930148-48930170 GCCCTGGCCTGGCCAGGCCCTGG - Intronic
1157856953 18:51112226-51112248 GCCCCTTCCTGGGCTGGCCGAGG - Intergenic
1158670494 18:59469659-59469681 GTCCTTTCCAGGCCAGGGCCAGG - Intronic
1158867491 18:61652019-61652041 GCCTCTCCCAGTCAAGGCCCCGG + Intergenic
1159592341 18:70348731-70348753 GCACCCTCCAAGCCAGGCACAGG + Intronic
1160013718 18:75125505-75125527 GGCCCTCCCAGGCCAGCCCAGGG - Intergenic
1160200118 18:76788954-76788976 GCCCCTTCCTGGGCTGGCCGAGG - Intergenic
1160732575 19:647982-648004 GCCTGTTCCAGGGCAGGACCCGG - Exonic
1160799919 19:963032-963054 GCCACTTCCAGGCCCTTCCCAGG - Intronic
1160806314 19:993709-993731 GGTCCTTCCAGGTCTGGCCCAGG + Intronic
1160810800 19:1012218-1012240 GCCCCGCCCAGGCCACCCCCTGG + Intronic
1160868565 19:1266811-1266833 GCCCCTGCCCGGCGAGGCGCGGG - Intronic
1160874585 19:1291138-1291160 GCCCCTCCCAGGGCTGTCCCTGG - Intronic
1160966281 19:1748320-1748342 GCCCGGAACAGGCCAGGCCCAGG + Intergenic
1161051731 19:2167504-2167526 TTCCCTCCCTGGCCAGGCCCTGG + Intronic
1161063137 19:2225223-2225245 ACCCAGTCCAGGCCTGGCCCAGG + Intronic
1161100026 19:2416850-2416872 ACCCTCCCCAGGCCAGGCCCTGG - Intronic
1161104606 19:2437065-2437087 GCCCCGCTCTGGCCAGGCCCAGG - Intronic
1161167183 19:2794581-2794603 GTCCCCTCCAGGCTGGGCCCTGG - Intronic
1161401414 19:4067445-4067467 CCCCCCGCAAGGCCAGGCCCTGG + Intergenic
1161422190 19:4182144-4182166 GCCCCGTCCTGGCCCGGCTCTGG + Intronic
1161858939 19:6783432-6783454 GCCACTTCCAGGCCTGGCCTGGG - Intronic
1161976723 19:7611557-7611579 GCCGGTTCCAGGCCTTGCCCAGG - Exonic
1162233174 19:9283876-9283898 GCCCCTTTCTGGGCAGGCCAAGG - Intergenic
1162477340 19:10908442-10908464 GCTCCCTGCATGCCAGGCCCTGG + Intronic
1162496768 19:11027679-11027701 CCCGCCTCCAGGCCAGGCGCCGG - Intronic
1162600092 19:11662352-11662374 GCCCATTCCAGGCCAGAAGCAGG + Intergenic
1162781134 19:13007511-13007533 GCCCTTGCCATGCCAGGGCCTGG - Intronic
1162910694 19:13846705-13846727 GCTCCTCCCAGCCCAGCCCCCGG + Intergenic
1163012235 19:14433433-14433455 GCCCCCTCCCCGCCACGCCCGGG + Intronic
1163448269 19:17360516-17360538 GCCCCATCCAGGTAAGGCACTGG - Exonic
1164671743 19:30076378-30076400 GCCCCCTCCAGGCCAGGAGCGGG + Intergenic
1164789186 19:30961539-30961561 TCCTCCTCCAGGCCTGGCCCAGG - Intergenic
1165068219 19:33241122-33241144 CTCCCTTCCGGGCCAGGGCCAGG - Intergenic
1165323156 19:35098771-35098793 AGCCCTGCCAGGACAGGCCCCGG + Intergenic
1165347468 19:35257897-35257919 CCACATTCCAGGTCAGGCCCAGG - Intronic
1165426617 19:35749399-35749421 GCCCTTACCATGCCAGGCCTGGG - Intronic
1165749454 19:38251333-38251355 GCCCCCTCCAGGACCGGGCCCGG - Exonic
1165949429 19:39465723-39465745 GCCCCCTCCAGGCTATTCCCGGG - Intronic
1166290571 19:41860627-41860649 GCCCCTTCAACGCCGGGCTCCGG - Intronic
1166339665 19:42129905-42129927 GCCACAGCCAGGCAAGGCCCCGG + Intronic
1166364113 19:42269895-42269917 GCCCAGGCCAGCCCAGGCCCTGG - Intronic
1166377021 19:42333456-42333478 GCCCCTTCAAGGCGGGGCCCAGG + Intronic
1166683264 19:44781082-44781104 GCCCCATCCTGCCCTGGCCCAGG + Intronic
1166855465 19:45780861-45780883 GCCCCTCCCCTGCCAGGCCTGGG - Intronic
1167158846 19:47755059-47755081 GCCTCTTCCAGGCAGGGCTCGGG + Intronic
1167767949 19:51496816-51496838 TCCCCTTCCATGCCTGGCCTGGG + Intronic
1168153433 19:54460850-54460872 GGCCCGTGTAGGCCAGGCCCAGG - Exonic
1168325513 19:55536796-55536818 GCCCCTCCTCCGCCAGGCCCAGG + Intronic
1202703946 1_KI270713v1_random:6759-6781 TACCCTTCCAGGGCTGGCCCAGG - Intergenic
925056381 2:860616-860638 GCCCCCTCCACACCAGCCCCCGG + Intergenic
925093046 2:1170450-1170472 GGGCCTTGAAGGCCAGGCCCAGG + Intronic
925425528 2:3746341-3746363 GCCTCACCTAGGCCAGGCCCTGG + Intronic
925628947 2:5869151-5869173 GCCGCTTCCAGGGCAATCCCCGG - Intergenic
925654152 2:6126804-6126826 ACACGTTCCAGGCCTGGCCCCGG + Intergenic
926048899 2:9730547-9730569 GGCCCTCCAAGGCCATGCCCTGG + Intergenic
926314075 2:11696877-11696899 GCCCCTCCCTGGCTACGCCCAGG + Intronic
926331242 2:11827712-11827734 ACCAATTCTAGGCCAGGCCCTGG - Intergenic
926394640 2:12428429-12428451 GCCCCATCCTGGTGAGGCCCTGG + Intergenic
926428225 2:12759280-12759302 GTCACTTCCAGCCCTGGCCCTGG - Intergenic
926703974 2:15823269-15823291 GCCTCCTGCACGCCAGGCCCTGG - Intergenic
926800161 2:16653097-16653119 GCACCATGCAGGACAGGCCCAGG - Intronic
927255310 2:21036120-21036142 TCTCCTTCCTGGTCAGGCCCAGG + Intronic
927360148 2:22223654-22223676 GCCCCTCCCATCACAGGCCCAGG + Intergenic
927510914 2:23643123-23643145 TCCCCCTCCAGCCCAAGCCCTGG + Intronic
927592901 2:24372192-24372214 GCCCTTGCTTGGCCAGGCCCAGG + Intergenic
927783103 2:25954948-25954970 GCCTCTGCCAGGCCTGCCCCTGG + Intronic
927926120 2:27014850-27014872 ACCCCTTCCTGCCCAGGCCCGGG - Intronic
928701596 2:33903933-33903955 GCCCCTTCCTGGGCTGGCCAAGG - Intergenic
929043683 2:37770907-37770929 GGACCTTCCAGGCAAGTCCCTGG + Intergenic
930772213 2:55139928-55139950 GGCCCTTCAAGGCCTGCCCCAGG + Intergenic
933663587 2:84946723-84946745 GCCCACTGCAGGCCGGGCCCTGG - Intergenic
933763500 2:85692042-85692064 GCCCATTGCAAGTCAGGCCCAGG - Intronic
934551782 2:95267241-95267263 GCCACTGCCAGGGCAGCCCCAGG - Intergenic
934736344 2:96691667-96691689 GCCCCAGCCAGGCCAGGCCCTGG - Intergenic
934772999 2:96919924-96919946 GCCTCTACCAGGCTGGGCCCTGG + Intronic
934951174 2:98576663-98576685 TCCCCTTCCAAGCCATGCCTGGG - Intronic
935330001 2:101969863-101969885 ACCCCTCCCATGACAGGCCCAGG - Intergenic
935381137 2:102452195-102452217 GCCCCCTCCAGTCCAGTCCCTGG + Exonic
936081362 2:109434749-109434771 CCCCCTCACAGGCCAGTCCCTGG + Intronic
936091177 2:109502190-109502212 GCCCCTTCCGGGGCACCCCCAGG - Intronic
936531095 2:113277662-113277684 CCCCCTTCCCGGCCAGGGCTGGG - Intronic
936581589 2:113704826-113704848 GCCCCTTCCTGGGCTGGCCGAGG - Intergenic
936600409 2:113889921-113889943 GCCCCGGCCAGGCCAGGCCCAGG - Intergenic
937241757 2:120466400-120466422 GCCCCTCCTGGCCCAGGCCCAGG - Intergenic
937288075 2:120765557-120765579 GGCCCTTCCAGCCCCGGCCTGGG - Intronic
937291918 2:120787109-120787131 CCCCCTGCCAGGCCAGGCAGGGG - Intronic
937436026 2:121882066-121882088 GCCCCTTCTCAGCTAGGCCCAGG + Intergenic
938079916 2:128364496-128364518 GCTCCTTCCAGGCCCGGCCAGGG + Intergenic
938422705 2:131156984-131157006 GCCCTCTGCTGGCCAGGCCCGGG + Intronic
938931261 2:136088444-136088466 GCCCCTTCCTGGGCTGGCCGAGG - Intergenic
939190421 2:138911320-138911342 GCACCTTCCATGCCAGGCTTAGG + Intergenic
941349511 2:164414540-164414562 GCCCCTTCCATCACAGGCCTAGG - Intergenic
941719502 2:168798501-168798523 GCAGCTTCCAGGCCAGACCCTGG + Intronic
942124016 2:172805108-172805130 GCCCTTTCCAGGCAGGCCCCAGG + Intronic
943835103 2:192507907-192507929 GCCCCTTCCTGGGCTGGCCAAGG + Intergenic
944866803 2:203870525-203870547 GCTCCTTCATGGCCAAGCCCAGG - Intronic
945241541 2:207681405-207681427 GGCGCGGCCAGGCCAGGCCCGGG + Intergenic
946258973 2:218469271-218469293 GCCCCTTCTAGGCCATGGCAAGG - Intronic
946280241 2:218661071-218661093 CACCCTTCCGGGCCAGGGCCAGG - Exonic
946312873 2:218892553-218892575 CCTCCCACCAGGCCAGGCCCCGG - Intronic
946865796 2:224039730-224039752 GCCCCTTCCCGGCCGCGTCCTGG - Intergenic
947107549 2:226683389-226683411 TCCACTTCCAGTCCAGGCACAGG + Intergenic
947588421 2:231370926-231370948 CTACCTTCCTGGCCAGGCCCTGG + Intronic
947634391 2:231672801-231672823 GCCCCTCCCTGGCCCAGCCCTGG - Intergenic
947740279 2:232481741-232481763 GCCCCCTCCGGGCCATCCCCTGG + Intronic
947743455 2:232495726-232495748 CTGACTTCCAGGCCAGGCCCTGG + Intergenic
947839830 2:233200582-233200604 GACCCTGCCAGGTCAGGCCTGGG - Intronic
947926241 2:233925018-233925040 GCCCCTCCCAGGCCAGCCACAGG - Intronic
948730969 2:239963522-239963544 GGCCCTTTGAGGCCAGCCCCAGG - Intronic
949010726 2:241676870-241676892 TCACCTTCCAGGCAGGGCCCAGG - Intronic
1169066806 20:2698413-2698435 GCCCCTGACATGCCAGCCCCTGG - Intronic
1169198322 20:3695038-3695060 GCCCCTTCCAGACCACCGCCAGG + Intronic
1169282159 20:4277183-4277205 GCCCCTTGCAGTCAAGGCCAGGG + Intergenic
1171034813 20:21706262-21706284 GCCCACTCCAAGCCAGACCCAGG + Intronic
1171782959 20:29437816-29437838 GCCCCTTGTAGGCAGGGCCCAGG + Intergenic
1172103130 20:32497696-32497718 GCTCCTTCCTGGCCCAGCCCAGG + Intronic
1172200425 20:33122417-33122439 GCCCCTCCCATCACAGGCCCAGG + Intergenic
1172244062 20:33433675-33433697 GGCCCTTGAAGGCCAGGCCTGGG - Intronic
1172304403 20:33871082-33871104 ACACCTGCCAGGCCAGGCCAGGG + Intergenic
1172444562 20:34986263-34986285 GCCCCCATCAGGCCAGGCCCTGG + Intronic
1172445434 20:34990833-34990855 GCCCCAGCCAGGCCAGCCCTGGG - Intronic
1173080733 20:39864588-39864610 AACCCTTCTAGGCCAGGGCCAGG - Intergenic
1173636920 20:44567715-44567737 ACACCTTCTGGGCCAGGCCCAGG + Intronic
1173790892 20:45827175-45827197 ACCCCTTTCAGGCCAGGCCTGGG - Intronic
1174085946 20:48007120-48007142 GTCCCTTCCAGGCCCAGTCCAGG + Intergenic
1174246933 20:49188404-49188426 CCCGCCTCCAGGCCCGGCCCCGG + Intergenic
1174274186 20:49391670-49391692 GGTCTCTCCAGGCCAGGCCCAGG - Intronic
1174280584 20:49435984-49436006 CCGCCCTCCAGGCCAGGACCAGG - Intronic
1174435623 20:50504771-50504793 GCTGCTTCTAGGCCAGGCCTTGG + Intergenic
1175215012 20:57387602-57387624 GCCCCATCCAGGCAGGGCTCTGG - Intergenic
1175216010 20:57391990-57392012 GCCCCCACCACCCCAGGCCCCGG + Intronic
1175762017 20:61567640-61567662 GCTCCTTCCAGGGGAGGACCCGG - Intronic
1175860340 20:62147149-62147171 GCTCCATGCAGGCCAGGCTCGGG - Intronic
1175877826 20:62238726-62238748 GCCGCCTCCAGCCCCGGCCCCGG + Intronic
1175913894 20:62416814-62416836 GCCGCTTCCTGGCCAGCTCCTGG + Exonic
1175931464 20:62495799-62495821 GCTCCTCCCAGCCCCGGCCCGGG + Intergenic
1175940980 20:62537453-62537475 GCCCCACCCCTGCCAGGCCCTGG + Intergenic
1175989182 20:62779043-62779065 GCCCCAGCCAGGACAGCCCCTGG + Intergenic
1176082750 20:63282167-63282189 GCCCCTTCCAGGGCCCTCCCAGG - Intronic
1176124997 20:63471412-63471434 GCCCCTTCCAGGCCCAGGGCTGG + Intronic
1176221042 20:63969555-63969577 GGCCCTGCCCGGCCAGGCCGAGG - Intronic
1176242067 20:64079813-64079835 GCCCCTCCCGGCCCGGGCCCGGG - Intronic
1176383874 21:6127405-6127427 GCTCCCTCCAGGCTGGGCCCAGG - Intergenic
1176454855 21:6899194-6899216 GTGCCTTGCAGCCCAGGCCCTGG + Intergenic
1176833028 21:13764242-13764264 GTGCCTTGCAGCCCAGGCCCTGG + Intergenic
1177637553 21:23806956-23806978 GCCCCTTTCTGGCCTGGCCAAGG + Intergenic
1178465752 21:32846233-32846255 GCCACTTCCAGGCAGGGCTCAGG - Intergenic
1178882595 21:36461099-36461121 GGCCCTACCAGGCCCCGCCCAGG - Exonic
1178919332 21:36728426-36728448 GCCCCATCCAGGCCCTGTCCAGG - Intronic
1179463356 21:41553123-41553145 GCCCCTCCCCGGCCAGGCACGGG + Intergenic
1179739599 21:43410833-43410855 GCTCCCTCCAGGCTGGGCCCAGG + Intergenic
1180049053 21:45323100-45323122 GCCCCGTGCAGGACAGGACCTGG - Intergenic
1180120898 21:45747517-45747539 GCCCCTCCCAGCCAAGACCCAGG + Intronic
1180696485 22:17754353-17754375 GCGCCTTCCTGGCGAGGCCGTGG - Intronic
1180755039 22:18155464-18155486 GCCCCTTCCTGGGCTGGCCGAGG + Intronic
1180950119 22:19717116-19717138 TCCACTTCCTGTCCAGGCCCTGG - Intronic
1181028479 22:20138792-20138814 GCCTCATCCAGGCCTGTCCCTGG - Intronic
1181030037 22:20145277-20145299 GTCCCAGCCGGGCCAGGCCCGGG - Intronic
1181079591 22:20405242-20405264 GCACCTTCCAGCCTTGGCCCTGG + Intronic
1181273366 22:21673700-21673722 GTCCCTTCCAGAGCAGGCCAAGG - Intronic
1181327416 22:22060729-22060751 GCCCCCTGCTGCCCAGGCCCAGG - Intergenic
1181566394 22:23741360-23741382 GCCACTTGCAGGCAATGCCCAGG + Intergenic
1181811526 22:25406108-25406130 GCCCCTTCCAGGCTGTGCCTGGG - Intergenic
1182475425 22:30574277-30574299 GCCCCTACCAGGCCACCCTCTGG + Intronic
1182576459 22:31276520-31276542 GGCGCGACCAGGCCAGGCCCGGG + Intronic
1183199121 22:36373647-36373669 GCCCCCTCCAGGACAGGGCCTGG + Intronic
1183217746 22:36492112-36492134 GCCCCTGGGAGGCCAGGCCATGG + Intronic
1183422183 22:37718261-37718283 GCCCCTTCCTGGGCTGGCCGAGG - Intronic
1183482844 22:38074578-38074600 GCTCCACCCAGGCCAGGCTCTGG - Intronic
1183486458 22:38089668-38089690 GTCCCCGCCCGGCCAGGCCCGGG - Exonic
1183585480 22:38750762-38750784 GCCCCTCCCATGCCCGGCCCTGG - Intronic
1184260522 22:43312762-43312784 GCACGTGCCAGGCCAGGCACAGG - Intronic
1184557442 22:45240935-45240957 GCCCCGGCCCGGCCCGGCCCCGG + Intergenic
1184608178 22:45586256-45586278 GACCCTTCCTAGCCAGGTCCTGG - Intronic
1184808651 22:46813560-46813582 GCTCCTACCAGGCGAGGCACAGG + Intronic
1185065818 22:48631217-48631239 CCCTCTGCCAGGCCAGGCCAGGG + Intronic
1185080773 22:48708304-48708326 GCAGCCACCAGGCCAGGCCCAGG - Intronic
1185157319 22:49201840-49201862 GCCCCAGCCAGTCCAGGCCTGGG + Intergenic
1185194183 22:49458173-49458195 CCCCCATCCTGGCCAGGCCTCGG - Intronic
950093760 3:10315959-10315981 GCTCTTTCCAGCCCTGGCCCTGG + Intronic
950104590 3:10380116-10380138 TCCCCTTCCATACCAGGGCCTGG + Intronic
950124711 3:10504391-10504413 GCCCCTTCCACGCTGGGCTCAGG + Intronic
950424962 3:12920287-12920309 GGCCCCTCCATGCCAGACCCTGG + Intronic
950738825 3:15033383-15033405 GTCCCTTGCATGCCAGGCACTGG - Intronic
952269379 3:31817132-31817154 GCCTCTTCCAGGCCCGCCCATGG - Intronic
952305159 3:32138964-32138986 GCCCCTTCCAGTCCACTCTCGGG + Intronic
952964110 3:38610503-38610525 GCCCCTACCCGACCAGACCCTGG - Intronic
953758350 3:45666649-45666671 AGCCCTGCCAGGGCAGGCCCTGG - Intronic
953931784 3:47009349-47009371 GCCCCCGGCAGGCCTGGCCCGGG + Exonic
953960227 3:47260800-47260822 GCCCCTCCCAGGCCCCACCCAGG - Intronic
954225415 3:49177895-49177917 GCTGATTTCAGGCCAGGCCCAGG - Exonic
954297875 3:49684277-49684299 TACCCTTCCAGGGCTGGCCCAGG + Intronic
954461613 3:50630052-50630074 TCCCCTTCTAGGCCAAGGCCAGG - Intronic
954610552 3:51942631-51942653 GCGCCTCCCAGGGCAGTCCCAGG - Exonic
954651614 3:52167672-52167694 GCCTCTTCCATGACAGTCCCTGG - Intergenic
954881067 3:53836323-53836345 AGCCCGACCAGGCCAGGCCCCGG + Intronic
956728593 3:72176948-72176970 GCCCCAGCCAGCCCAGCCCCTGG - Intergenic
956877087 3:73474706-73474728 GCCCCATCCATTTCAGGCCCTGG + Intronic
957082526 3:75648776-75648798 GCCCCTTGTAGGCAGGGCCCAGG - Intergenic
957277406 3:78108329-78108351 GCCCCTTCCTGGGCTGGCCGAGG + Intergenic
957371426 3:79300159-79300181 GCCCCTTCCTGGGCTGGCCAAGG + Intronic
957556358 3:81767808-81767830 GCCCCTTCCTGGGCTGGCCAAGG - Intergenic
958810807 3:98858345-98858367 GCCCCTTCCTGGGCTGGCCAAGG - Intronic
959632132 3:108518625-108518647 GCCCCAGCCAGGTCAGGCCTGGG - Intronic
960140062 3:114142961-114142983 GCCCCCAGCAGGCCTGGCCCTGG + Intronic
960541930 3:118871221-118871243 TGGCTTTCCAGGCCAGGCCCAGG + Intergenic
961035096 3:123636602-123636624 GCCCCTTTCAGGGCGGCCCCAGG - Intronic
961213694 3:125143807-125143829 GCCCCTTCCCTCCCAGGCCAGGG - Intronic
961360610 3:126364922-126364944 TCCCTTTCCAGGGCTGGCCCAGG - Intergenic
961372731 3:126441232-126441254 AGCCCCTCCAGGGCAGGCCCAGG - Intronic
961454783 3:127018561-127018583 GCCACCTCCGAGCCAGGCCCTGG + Intronic
961594646 3:128006784-128006806 GCCCGTTCAGAGCCAGGCCCCGG + Intergenic
962310634 3:134324511-134324533 GCACCTTCAATGCCAGCCCCAGG + Intergenic
962758196 3:138484595-138484617 GCCCCTTTCAGGGCTGGCCAAGG + Intergenic
962843521 3:139255799-139255821 GCAGCTGCCAGGCCAGGCTCTGG - Intronic
963251542 3:143108707-143108729 GCCCTTTCCAGTCCAAGCCTTGG - Intergenic
963259163 3:143176349-143176371 GCCTCCTCCAGGCGGGGCCCGGG + Intergenic
963603142 3:147393914-147393936 TCGCCTTCAAAGCCAGGCCCCGG + Intronic
964198107 3:154087976-154087998 GCCCCTTCCTGGGCTGGCCGAGG + Intergenic
964460362 3:156918437-156918459 TCCCATTCCAGGCCAGGAACAGG - Intronic
964791812 3:160460220-160460242 GCCTCTTCCAGGCCTGCCCATGG - Intronic
965040238 3:163498963-163498985 GCCCCTTCCTGGGCTGGCCTAGG + Intergenic
965596840 3:170419000-170419022 GCACTGTCCAGCCCAGGCCCAGG + Exonic
966818286 3:183906542-183906564 GCACCCTCCCTGCCAGGCCCTGG + Intergenic
967930417 3:194686730-194686752 GCCCCTGCCAGGCTCGGCCCGGG - Exonic
967975990 3:195035098-195035120 GCCCTTTGCAGGTGAGGCCCTGG - Intergenic
968007343 3:195251872-195251894 GCCCCTTCCAGGCGTGACCCTGG + Intronic
968360831 3:198145536-198145558 CCCTCTTCCAGGACAGGCTCTGG + Intergenic
968501439 4:951974-951996 GCCCATCCCAGGCCTGTCCCTGG + Intronic
968633874 4:1667751-1667773 GCCACAGCCAAGCCAGGCCCAGG + Intronic
968640819 4:1713549-1713571 TCCCCTTCCTCCCCAGGCCCTGG + Intergenic
968657992 4:1786880-1786902 GCCCCTTCCCTGGCATGCCCTGG + Intergenic
968905712 4:3449709-3449731 CCCCCTCCCAGGCCAGCCCCAGG + Intergenic
968915568 4:3495715-3495737 TCCCCTGCCTGGCCAGGCCCAGG - Intronic
968962519 4:3752774-3752796 CTCCCTGCCAGGCCAGGCTCAGG - Intergenic
968999026 4:3965114-3965136 GCCCCTTCCTGGGCTGGCCGAGG - Intergenic
969304568 4:6318377-6318399 GCCCCCGCCAAGCCAAGCCCCGG + Intergenic
969440682 4:7215068-7215090 GCCCCTTCCTGGGCTGGCCAAGG + Intronic
969442350 4:7224797-7224819 TCCCCTTCCAGGACAGTCCTGGG + Intronic
969463347 4:7340467-7340489 GCACCTTCCAGGGTAGGCGCTGG - Intronic
969477980 4:7432042-7432064 GCCCCCTCCAGGAGAGCCCCTGG - Intronic
969577360 4:8044211-8044233 GTCCCCGCCAGGCCAGGACCTGG - Intronic
969814876 4:9679801-9679823 GCCCCTTCCTGGGCTGGCCGAGG + Intergenic
971852036 4:31996328-31996350 GCCCCTTCCTGGGCTGGCCGAGG + Intergenic
971942896 4:33238472-33238494 TCTCTTTCCAGGCCAGGGCCTGG + Intergenic
972467462 4:39371111-39371133 GCCCCTCCCATCACAGGCCCAGG + Intergenic
972734822 4:41830371-41830393 GCTCCTTCCAAACCAGGCCCTGG - Intergenic
975440014 4:74399483-74399505 GCCCCTTCCTGGGCTGGCCGAGG - Intergenic
976075756 4:81297833-81297855 GCCCCTCCCATCACAGGCCCAGG + Intergenic
976790797 4:88876128-88876150 CCCCATCCCAGGACAGGCCCTGG - Intronic
978399322 4:108314146-108314168 GCCCCTTCTAAGCCAGTCCTGGG - Intergenic
978600537 4:110422769-110422791 CCCCGATCCATGCCAGGCCCTGG - Intronic
979276065 4:118815475-118815497 ACCTCTTCCAGGCCAGACCTTGG - Exonic
979899772 4:126201711-126201733 GCCCCTTTCAGGGCTGGCCAAGG - Intergenic
980923960 4:139115515-139115537 GGCGCGGCCAGGCCAGGCCCGGG - Intronic
981642991 4:146967041-146967063 GCCCTTTCCATCACAGGCCCAGG + Intergenic
981751423 4:148095762-148095784 GCCCATTCCTGGGCAGGCACTGG - Intronic
982219495 4:153112461-153112483 GCCCCTTCCTTGCTTGGCCCTGG + Intergenic
982863326 4:160481709-160481731 GCCCCTTTCAGGGCTGGCCAAGG + Intergenic
983026039 4:162739480-162739502 GCCCCTTTCTGGGCAGGCCAAGG + Intergenic
983060283 4:163152785-163152807 GCCCCTTTCTGGGCAGGCCAAGG + Intronic
983064142 4:163190126-163190148 GCCCCTTTCTGGGCAGGCCAAGG - Intergenic
983580928 4:169309366-169309388 GCTCCTGTCAGGCGAGGCCCTGG + Intergenic
983800988 4:171929734-171929756 GCCCCTTTCAGGCCAGGGGTGGG - Intronic
984241882 4:177227947-177227969 GCCCCTTCCTGGGCGGGCCAAGG - Intergenic
984706071 4:182848167-182848189 GCCCCTTCCACCCCACGCCCAGG + Intergenic
985784935 5:1888368-1888390 GCCCCAGCCAGGCCAGTGCCTGG - Intergenic
986288421 5:6378307-6378329 CACGCTTCCCGGCCAGGCCCTGG + Intronic
986339766 5:6778989-6779011 TCCCATTCAAGGCCAGGCACGGG - Intergenic
986697941 5:10375098-10375120 GCCCCTTTCTGGCCTGGCCAAGG + Intronic
988152282 5:27399797-27399819 CCCCATCCCAGGACAGGCCCCGG - Intergenic
988201832 5:28078073-28078095 GCCCCTTCCTGGGCTGGCCAAGG - Intergenic
990340045 5:54813298-54813320 GGACCTTCCAAGCCAGGCACGGG - Intergenic
991562064 5:67964314-67964336 GCCTGTTCCAGCCCAGCCCCAGG - Intergenic
994043567 5:95284501-95284523 CCTCCTTCCAGGCCCGGCTCTGG - Exonic
994841331 5:104928931-104928953 GCCTCTTCCTGGGCTGGCCCAGG + Intergenic
994932486 5:106206465-106206487 GCCCCTTCCTGGGCTGGCCAAGG - Intergenic
995809006 5:116084464-116084486 GCCGCTTCCTGGGCAGGCTCGGG + Intergenic
996530339 5:124521563-124521585 GCCCCTTCCTGGGCTGGCCGAGG + Intergenic
997129550 5:131263708-131263730 GCCCCTTCCCACCCCGGCCCGGG - Intronic
997199628 5:132002104-132002126 GATCCTTCCACGCCAAGCCCTGG + Intronic
997367485 5:133335280-133335302 GCCTCTCACAGGCCATGCCCTGG + Intronic
997624967 5:135325273-135325295 GCCCCTTGCAGGCCTGGCTAGGG + Intronic
997628121 5:135345172-135345194 ACCCCTTCCAGGCTAGTCTCAGG - Intronic
998097186 5:139402721-139402743 GCCCCTTCTACTCCAGCCCCAGG - Intronic
998139186 5:139690346-139690368 TCCCCTTCAAGGCCCAGCCCTGG - Intergenic
998177633 5:139911626-139911648 GCCTCTTCCAGGGCATGCCTTGG + Intronic
998462714 5:142321390-142321412 GTCCCTTCCAGACCAAGCCAGGG - Intronic
998529889 5:142874802-142874824 GCCCCTTCCAGCCCGGGGCCTGG + Intronic
999079064 5:148826447-148826469 GCCCCGCCCGGGCCAGCCCCAGG + Exonic
999879423 5:155845030-155845052 CCCCCATCCATGACAGGCCCCGG + Intergenic
999947266 5:156610828-156610850 GGACCCTCCAGGCCAGGCGCAGG + Intronic
1000728549 5:164802127-164802149 GCCCCTCCCATCACAGGCCCGGG - Intergenic
1001081697 5:168672133-168672155 CCTGCTTCCAGGCCAGTCCCAGG - Intronic
1001491887 5:172161880-172161902 GTCCCTTGCAGGCCAGAGCCTGG + Intronic
1001600715 5:172926446-172926468 TCCACCTCCAGGCCTGGCCCTGG - Intronic
1001858498 5:175033111-175033133 GCAGCTGCCAGGCCTGGCCCTGG + Intergenic
1002105254 5:176876808-176876830 GGCCCTTCAATGCCAGGCCAGGG + Intronic
1002182944 5:177440978-177441000 GGCCCTTCCAGTCCAGGTCTGGG - Exonic
1002190198 5:177473768-177473790 CCCCCTTCCCGGCCTGCCCCGGG + Intronic
1002306409 5:178286418-178286440 CCCTTCTCCAGGCCAGGCCCAGG + Intronic
1002526994 5:179820565-179820587 GCCCCTCCCAGGCTTGGGCCTGG - Intronic
1002533965 5:179865986-179866008 GCCAGCCCCAGGCCAGGCCCTGG + Intronic
1003147905 6:3524386-3524408 GCCCCTTCCAGCTCATCCCCTGG + Intergenic
1003370598 6:5522242-5522264 GCCCCTTCCAGGTCTGGGCTTGG - Intronic
1003435279 6:6082351-6082373 GCCCCTCACAGTCCAAGCCCTGG - Intergenic
1003649026 6:7941249-7941271 TCACCTTCCGGGCCCGGCCCTGG + Intronic
1003783468 6:9456302-9456324 GCCCCTTGTTGGCCAGGCCTGGG + Intergenic
1004486327 6:16069607-16069629 GCCCCTTTCTGGGCAGGCCAAGG - Intergenic
1005496172 6:26389808-26389830 CCCCCTTCTGGGCCCGGCCCTGG + Intronic
1005975120 6:30792033-30792055 GCCTCTTCCATGCCAGACACTGG - Intergenic
1006187585 6:32189870-32189892 GCCCCCTCCAGGCGGGGGCCGGG - Exonic
1006408674 6:33859568-33859590 TGCCCCTCCAGGACAGGCCCAGG - Intergenic
1006796942 6:36737900-36737922 GCCCCTTCCAGGCAGGACTCAGG + Intergenic
1006935597 6:37715474-37715496 GCCCCTTGCAGGGCAGGACAGGG - Intergenic
1007111654 6:39316359-39316381 GCGCCAGCCACGCCAGGCCCAGG + Intronic
1007700455 6:43763308-43763330 CCAGCTTCCAGCCCAGGCCCAGG + Intergenic
1007988381 6:46230563-46230585 GCACCCTCCAAGCCAGGCACAGG + Intronic
1008248498 6:49207906-49207928 GCCCCTCCCATCACAGGCCCAGG - Intergenic
1009470226 6:64023716-64023738 GCCCCTTTCTGGGCAGGCCAAGG + Intronic
1009510844 6:64548083-64548105 GCCCCTTCCTGGGCTGGCCGAGG - Intronic
1009619998 6:66063566-66063588 GCCCCTTTCATGCCAGGGCCAGG + Intergenic
1009995175 6:70888829-70888851 GCACCTTCCGTGCTAGGCCCAGG - Intronic
1011326526 6:86154265-86154287 GCCTCTTCCAGGCTGGGTCCAGG + Intergenic
1012413215 6:98983851-98983873 GCCCATTTCAGGGCTGGCCCTGG - Intergenic
1012744298 6:103064785-103064807 CCCCATCCCAGGACAGGCCCCGG + Intergenic
1012850939 6:104446276-104446298 GCCGCTTCCTGGGCTGGCCCAGG + Intergenic
1013380576 6:109565929-109565951 GCCACCACCAGGCCAGTCCCAGG - Intronic
1013963501 6:115928459-115928481 GCCCCTTCCTGGGCTGGCCGAGG - Intergenic
1014191463 6:118501249-118501271 CCACCTCCCATGCCAGGCCCAGG + Intronic
1014460313 6:121686832-121686854 GCCCCTTTCTGGGCAGGCCAAGG - Intergenic
1014738938 6:125125793-125125815 GCCCCTTCCTGGGCTGGCCCAGG + Intronic
1015799220 6:137044266-137044288 GCCCCTCGCCGGCCAGTCCCAGG - Intronic
1016862108 6:148731093-148731115 GCCCCTTCCAGGCCTTGCACCGG - Intergenic
1016935428 6:149446135-149446157 GCCCCTTCCAGGGAAAGCCAAGG + Intergenic
1017622036 6:156309087-156309109 TCCCCTTTCCTGCCAGGCCCCGG - Intergenic
1017714617 6:157200300-157200322 GACCCTTTCAGGCCGGCCCCTGG + Intronic
1017852139 6:158314067-158314089 GCCCCTTCCAGGACAGGCACAGG - Exonic
1018696251 6:166393766-166393788 GCCCCTTCCTGGGCTGGCCGAGG - Intergenic
1019259180 7:71118-71140 CCCTCTTCCAGGACAGGCTCTGG - Intergenic
1019388169 7:770396-770418 GCCCCATCCAGCACAGGCCCAGG - Intronic
1019472418 7:1227979-1228001 GGCCCTTCCTGGCCTGCCCCGGG + Intergenic
1019513911 7:1431448-1431470 GGCCCCTCCAGGCCGGGCACAGG - Intronic
1019577069 7:1742677-1742699 GGCCACTCCAGGCCAAGCCCTGG + Intronic
1020008228 7:4793469-4793491 GCCCCTTTCAGGGCTGGCCAAGG + Intronic
1023922458 7:44640047-44640069 ACTCCTTCCAGCCTAGGCCCTGG - Intronic
1024465845 7:49711194-49711216 GCCCCTTCCTGGGCTGGCCGCGG + Intergenic
1025144144 7:56490445-56490467 GTCTCTTCCAGGCCAGGTCTTGG + Intergenic
1025261729 7:57424824-57424846 GCCCCAGCCCGGCCCGGCCCGGG + Intergenic
1026846947 7:73703896-73703918 GCCCCCTCCGTCCCAGGCCCGGG + Intronic
1027051551 7:75024552-75024574 GACCCCTCCAGGGCAGGGCCGGG + Intronic
1028303350 7:89229148-89229170 GCCCCTTCCTGGGCTGGCCAAGG - Intronic
1029381789 7:100219947-100219969 GCCCCCTCCAGTCCAGGTTCTGG - Exonic
1029444320 7:100604244-100604266 CCCCCCTCCAGGCCCCGCCCCGG + Intronic
1029460910 7:100693696-100693718 GCCCCTGCCAAGCCCTGCCCTGG - Intergenic
1029614232 7:101646115-101646137 CCCCCCACCACGCCAGGCCCTGG + Intergenic
1030179437 7:106690156-106690178 GCACCCTCCAAGCCAGGCACGGG + Intergenic
1033159427 7:138982489-138982511 GCCCCTTCAAGGGCTGGGCCTGG - Intergenic
1034951011 7:155297423-155297445 GCCGCCTCCCGGCCAGGCGCGGG + Intergenic
1034967170 7:155398569-155398591 GCCCCTTCCTGGGCTGGCCAAGG - Intergenic
1035637924 8:1161275-1161297 GCCTGTTCCACACCAGGCCCTGG - Intergenic
1035727425 8:1833643-1833665 CCCCTTTCCATGCCAGGCCCCGG + Intronic
1035774355 8:2176252-2176274 GTCCCTTCCCTGCCAGGCGCAGG - Intergenic
1036378211 8:8218833-8218855 GCCCCTTCCTGGGCTGGCCGAGG + Intergenic
1036383321 8:8254462-8254484 GCTGCTTCCAGGCCCCGCCCAGG - Intergenic
1036390304 8:8318886-8318908 GCACCCTCCAGGCCGGCCCCGGG - Exonic
1037273541 8:17155911-17155933 GCCCCTCCCATGCCAGACGCCGG + Intergenic
1037602050 8:20405473-20405495 CCCCCTACCATGCCAGGCCATGG - Intergenic
1037761687 8:21745813-21745835 TCTCCTTCCAGGCCCGGCCCAGG + Intronic
1037766079 8:21773173-21773195 GCCCCATCCAGTCCAGCCCTTGG + Intronic
1038533758 8:28339244-28339266 GCCTCCTCCATGCCAGGCTCGGG - Exonic
1038581227 8:28750969-28750991 GCCCCTTCCAGCAGAGGCTCTGG - Exonic
1039482108 8:37881865-37881887 GACAATTCCAGGCCAGGCCCTGG - Intronic
1040274466 8:46000259-46000281 CCCCCTCCCATGACAGGCCCTGG + Intergenic
1040806890 8:51405199-51405221 GCCCCTTTCTGGGCTGGCCCAGG - Intronic
1041642563 8:60218855-60218877 GCCCCATCCAGGTCAGACTCAGG - Intronic
1042611749 8:70608021-70608043 GCCACCTCCAGCCCGGGCCCGGG - Intronic
1043640109 8:82441362-82441384 GCCCCTTTCCGGGCAGGCCAAGG + Intergenic
1043915922 8:85921936-85921958 GCTACTTGCAGGCCAGGCACGGG + Intergenic
1044934163 8:97277525-97277547 GCCGCGGCCAGGCCCGGCCCGGG - Exonic
1045100049 8:98835088-98835110 GCCTCTTCCAACCCATGCCCAGG - Intronic
1045306078 8:100957528-100957550 GCCCCTTCCTGGGCTGGCCGAGG - Intergenic
1045743392 8:105387711-105387733 GCCCCTTCCTGGGCTGGCCGAGG - Intronic
1047545605 8:125813604-125813626 GCCCCTCCCATCACAGGCCCTGG + Intergenic
1048918330 8:139204917-139204939 AACCCTTGCAGGGCAGGCCCGGG - Intergenic
1049159579 8:141088849-141088871 CCCCGGGCCAGGCCAGGCCCTGG + Intergenic
1049356491 8:142191710-142191732 GCCCTTTCCAGGACACACCCAGG - Intergenic
1049405341 8:142449797-142449819 GCCGCGTCCTGGCCCGGCCCGGG + Exonic
1049459474 8:142717993-142718015 GGCCCTTCCAGCTCAGACCCTGG - Intergenic
1049529739 8:143148302-143148324 GCCCTCCCCAGGCCAGGTCCTGG + Intergenic
1049586444 8:143434690-143434712 GGCCCTTCCAGGCCCCTCCCAGG - Intergenic
1049592567 8:143469216-143469238 GGTCCTGCCAGCCCAGGCCCTGG - Intronic
1049678449 8:143904081-143904103 AGCCCTTCCATGCCAGGCCCAGG + Intergenic
1049686119 8:143939965-143939987 GCTCCCTCCAGGCCTGGGCCAGG + Intronic
1049832792 8:144713094-144713116 GCCCCTTCCTTGCCCGGACCCGG + Intergenic
1051629199 9:19127222-19127244 GCCCCTACCCAGCCAGGACCTGG + Intronic
1051897976 9:22008763-22008785 GCCCCCTGCCGGCGAGGCCCTGG + Intronic
1052220679 9:26017841-26017863 GCCCCTTCCATCGCAGGACCAGG - Intergenic
1052996429 9:34553760-34553782 GCCCCTTCCAGGCCCAGGCTGGG + Intronic
1053283391 9:36835855-36835877 CCCACGGCCAGGCCAGGCCCAGG - Exonic
1053285044 9:36844814-36844836 GCCCCTTGAAGGCCAGGCTGGGG - Intronic
1053489181 9:38487060-38487082 GCCCCTCCCATGCCAGGGCAGGG + Intergenic
1055639448 9:78308188-78308210 GCCCCATCCAGGTGAGGACCAGG + Intronic
1056331189 9:85522703-85522725 GCGCCTGCGCGGCCAGGCCCGGG + Intergenic
1056752778 9:89364085-89364107 GCCACCTCCAGGGCAGTCCCAGG - Intronic
1056867501 9:90242348-90242370 GACCCATATAGGCCAGGCCCTGG + Intergenic
1057276508 9:93678486-93678508 GCCCCTGCCCTGCCAGTCCCAGG - Exonic
1057443012 9:95095687-95095709 CCTCCTTTCAGGCCAGGCCGTGG - Intergenic
1057773033 9:97984047-97984069 GCCCCTTCCCCGGCCGGCCCGGG - Intronic
1057898138 9:98925823-98925845 GCCCATTCAGGGCCAGGACCAGG + Intergenic
1059338245 9:113582512-113582534 GCCCCTCCCAGTCAAGGACCAGG - Intronic
1059435759 9:114275400-114275422 GCCCTTCGCAGCCCAGGCCCAGG + Intronic
1060228301 9:121809431-121809453 GCCCCTTCTGCGCCAGGCCCTGG + Intergenic
1060305434 9:122406575-122406597 GCCCCTTCCTGGGCTGGCCGAGG - Intergenic
1060407355 9:123379451-123379473 GCCCCTCACAGACCAGGCACGGG - Intronic
1060432730 9:123564405-123564427 GGGCCTTCCAGGCCAGGCTAGGG - Intronic
1060517606 9:124275740-124275762 GCCTTTGCCAGGCCAGGCCCTGG - Intronic
1060727621 9:126016652-126016674 GGCCCTGCTAGGCCTGGCCCTGG + Intergenic
1060778454 9:126393774-126393796 GCCCCTGCCAGCCCTGGCCAGGG - Intronic
1061057969 9:128234162-128234184 GCGCCTTCCACTCCTGGCCCTGG + Intronic
1061141711 9:128771570-128771592 GCCCCGTCCAGGGTAGGTCCCGG - Exonic
1061407693 9:130401782-130401804 CTTCCTTCCAGGCCAGGCGCAGG + Intronic
1061413017 9:130431216-130431238 GCCCCTCCCAGCCCAGGTTCAGG - Intronic
1061743885 9:132725954-132725976 CCTGCTTCCAGGCCAGGCCATGG - Intronic
1062030583 9:134360172-134360194 GCAGCTTCCAGGCCCTGCCCAGG - Intronic
1062059418 9:134486888-134486910 GCCTCTTCCTGGCCAGGACCAGG + Intergenic
1062140504 9:134955253-134955275 GCCTCCTCAAGCCCAGGCCCTGG - Intergenic
1062140550 9:134955507-134955529 GCACCTGCCATGCCAGCCCCAGG - Intergenic
1062344715 9:136109453-136109475 GCCCCTTCCAGTCTCCGCCCAGG + Intergenic
1062402795 9:136379775-136379797 GCCTCTTCCCCGCCAGGGCCAGG + Intronic
1062425020 9:136502155-136502177 CCACCTCCCACGCCAGGCCCGGG - Intronic
1062464965 9:136676898-136676920 GCCCCTGCCTGGCCCCGCCCAGG + Intronic
1062568204 9:137172577-137172599 GCCCCTTCCTGCCCCAGCCCTGG - Intergenic
1062609633 9:137368213-137368235 GCCCCATCCAGGCCAAGCCCAGG - Intronic
1062745536 9:138209367-138209389 CCCTCTTCCAGGACAGGCTCTGG + Intergenic
1203442978 Un_GL000219v1:28651-28673 GCCCCTTGCAGGCAGGGCCCAGG + Intergenic
1203513786 Un_KI270741v1:147560-147582 GCCCCTTGCAGGCAGGGCCCAGG + Intergenic
1185729665 X:2451297-2451319 GCCCCTTCCACCCTGGGCCCTGG + Intronic
1185730366 X:2456679-2456701 GCCCCTTCCACCCTGGGCCCTGG + Intronic
1185731859 X:2468027-2468049 GCCCCTTCCACCCTGGGCCCTGG + Intronic
1185732631 X:2473679-2473701 GCCCCTTCCACCCCGGGCCCCGG + Intronic
1185733230 X:2477901-2477923 GCCCCTTCCACCCCGGGCCCGGG + Intronic
1185893591 X:3840559-3840581 GCCCCTCCCATCACAGGCCCAGG + Intronic
1185898706 X:3878983-3879005 GCCCCTCCCATCACAGGCCCAGG + Intergenic
1185903823 X:3917412-3917434 GCCCCTCCCATCACAGGCCCAGG + Intergenic
1187719307 X:22134794-22134816 GCCCCTTCCCAGCAAGGCCTGGG + Intronic
1187944757 X:24415579-24415601 GCCCCTCCCAACACAGGCCCAGG + Intergenic
1189368273 X:40406832-40406854 GCCCCTTCCAAGCTTGGCTCAGG - Intergenic
1189373018 X:40445178-40445200 CCCCATTCCAGCCCAGCCCCCGG + Intergenic
1189810514 X:44776825-44776847 GCCATTTCCAGCCCAGGCCCTGG + Intergenic
1189896893 X:45665189-45665211 GCCCCTTCCTGGGCTGGCCAAGG - Intergenic
1190708383 X:53048864-53048886 TCCCCATCCCCGCCAGGCCCGGG + Intergenic
1191847891 X:65562286-65562308 ATCCTTTCCTGGCCAGGCCCTGG - Intergenic
1192158087 X:68761567-68761589 ACCCCTCTCAGGCCAGGCCCTGG - Intergenic
1192501190 X:71653571-71653593 GCCCCTCCCATCACAGGCCCAGG - Intergenic
1192582695 X:72298283-72298305 GCCTATTCCAGGCCAGGACTTGG + Intronic
1193400865 X:81040589-81040611 GCCCCTTCCCTGACAGTCCCTGG - Intergenic
1193724863 X:85026333-85026355 GCCCCTCCCATCACAGGCCCAGG - Intronic
1193747272 X:85297832-85297854 CACCCTTCCTGGACAGGCCCTGG + Intronic
1195060700 X:101191451-101191473 CTCCCTCCCCGGCCAGGCCCGGG - Intergenic
1195256261 X:103094053-103094075 GCCCCTTCCTGGGCTGGCCGAGG + Intergenic
1195259416 X:103117482-103117504 GCCCCTTCCTGGGCTGGCCGAGG - Intergenic
1195919090 X:109964553-109964575 GCCCATTCCATACCAGGCCATGG - Intergenic
1197331239 X:125155881-125155903 GCCCCTTCCTGGGCTGGCCGAGG - Intergenic
1198128550 X:133671809-133671831 CCCCATCCCACGCCAGGCCCCGG + Intronic
1199574717 X:149302392-149302414 GCCACAGCCAGGCCAGACCCTGG - Intergenic
1201349522 Y:13024033-13024055 GCCACTGCCAGGCCAGAACCAGG - Intergenic