ID: 1105806042

View in Genome Browser
Species Human (GRCh38)
Location 13:23952078-23952100
Sequence CCTTCGGAGGAGCGGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105806042_1105806054 23 Left 1105806042 13:23952078-23952100 CCTTCCATCCGCTCCTCCGAAGG 0: 1
1: 0
2: 2
3: 9
4: 73
Right 1105806054 13:23952124-23952146 TGTCCACCTAGCCTTTGCCATGG 0: 1
1: 0
2: 0
3: 13
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105806042 Original CRISPR CCTTCGGAGGAGCGGATGGA AGG (reversed) Intergenic
906199992 1:43953760-43953782 CCTTGGGAGTTGGGGATGGAGGG + Intronic
907920047 1:58903746-58903768 CCGCGGGAGGAGCGGGTGGAGGG + Intergenic
909939360 1:81592633-81592655 CTTTCGGAGAAGGGGAAGGAAGG + Intronic
910482531 1:87674226-87674248 CCTTGGGAGGAGTAGATGAAAGG + Intergenic
912067519 1:105762888-105762910 TCTACGGAGGAGAGGATGTATGG + Intergenic
915940511 1:160115687-160115709 CTTTCGGAGGAGGGGAAGGCGGG + Intergenic
917458294 1:175204771-175204793 CCTCCTGAGGAGCTGCTGGATGG - Intergenic
920327747 1:205179877-205179899 CCTTCTGAGTAGAGGATGGATGG - Intronic
920331378 1:205211071-205211093 CCTTCTGAGGAGGGGAGGAAGGG - Intronic
923558951 1:235023768-235023790 CCTTCGGGGGAGGGGTGGGAGGG + Intergenic
1063236235 10:4119296-4119318 CCTTAGGAGGAAGCGATGGATGG - Intergenic
1063320342 10:5046236-5046258 CCATAGGAGGAGGGAATGGAGGG - Intronic
1063948308 10:11199050-11199072 CCTTAGGAGGAGGGGTTGGTAGG + Intronic
1066470395 10:35692185-35692207 ATTTCTGAGAAGCGGATGGAAGG - Intergenic
1067570340 10:47366914-47366936 CCTCCTGTGGAGGGGATGGATGG + Exonic
1069616387 10:69809019-69809041 CCTTGGGAGTAGAGGATGGGAGG - Intronic
1074789186 10:116869103-116869125 CCTTTGGGGGACCAGATGGAAGG - Intronic
1075903017 10:126058142-126058164 CCTTGGGAGGAGGGAAAGGAGGG - Intronic
1079134595 11:17769281-17769303 CCTTGTGAGGAATGGATGGATGG + Intronic
1088940751 11:114453454-114453476 CCTCCTGAGGAGTGGTTGGAAGG - Intergenic
1089438456 11:118493102-118493124 CCTTCGGGGGAGCTGCGGGAAGG - Exonic
1092960933 12:13596470-13596492 CCTTCTGAGATGAGGATGGAGGG + Intronic
1095666987 12:44814140-44814162 CCTCAGGAGGAGCAGATGGAGGG + Intronic
1101238887 12:102818270-102818292 CCTACTGAGGAGAGGATAGAGGG - Intergenic
1103975652 12:124701031-124701053 CCTTCGGATGTGCAGATGGCCGG - Intergenic
1104326928 12:127808012-127808034 CCTTGCGAGGAGCAGATGGAAGG - Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1105846827 13:24300697-24300719 CCTTCAGAGGGGCTGCTGGAGGG + Intronic
1106171611 13:27293433-27293455 CCTTCCGATGAAAGGATGGAGGG - Intergenic
1107112663 13:36714787-36714809 CCTTGAGAGGAGGAGATGGAAGG + Intergenic
1110122905 13:71905362-71905384 CCTTAGGAGGAGAGGAAGAAAGG - Intergenic
1112160292 13:96860018-96860040 CCCTAGGAGGAGTGGTTGGATGG - Intergenic
1123043521 14:105500164-105500186 CCTTAGGAGGAGCTGGCGGAGGG - Intergenic
1126697908 15:51341452-51341474 CCTGCGGAGGAGGGGCTGGCAGG - Intergenic
1132663181 16:1070554-1070576 CCTTTGGAGGAGCGGAGGGAGGG + Intergenic
1142599220 17:1045116-1045138 GCTTCGGAGGAGCCGGAGGAAGG + Intronic
1143705280 17:8693449-8693471 CCACTGGCGGAGCGGATGGAGGG - Intergenic
1147574149 17:41588950-41588972 CCCTCGGAGGAGGGGGAGGAAGG - Intergenic
1148812456 17:50302389-50302411 CCTTGGTAGAAGCTGATGGAGGG + Intergenic
1155830223 18:30507666-30507688 CCTGCAAAGGAGCTGATGGAGGG - Intergenic
1157297528 18:46456964-46456986 CCTTCAGAGGACAGGATTGAGGG - Exonic
1157831368 18:50859779-50859801 CCTGCAGAGGAGGAGATGGAAGG - Intergenic
1160152538 18:76406109-76406131 CCTCCGGAGGAGGGGCTGCAGGG - Intronic
1161578054 19:5065761-5065783 CGTGCAGAGGAGGGGATGGATGG - Intronic
1161766728 19:6212659-6212681 CTTTCTGAGCAGCGGATCGACGG - Intergenic
926052476 2:9753826-9753848 CCGTCGGAGGGGCGGGTGGCAGG - Intergenic
926861404 2:17313608-17313630 CGTTTGGAGGAGGGGGTGGATGG + Intergenic
927853409 2:26513699-26513721 CCTTCCCAGGAGAGGATGGAGGG + Intronic
929896568 2:45966072-45966094 CCTTGGGAGGCGTGGATGGCTGG + Intronic
937316827 2:120937035-120937057 CCTTGGAAGGAGGGGATGGAGGG - Intronic
937922720 2:127143228-127143250 CCTTTGGAGGAGCAGAAGGATGG - Intergenic
948596594 2:239083311-239083333 CCTTAGGAGGAGCTGAGGGAGGG + Intronic
1168846980 20:952001-952023 GCTTCGGAGGAGGGAAGGGAGGG + Intergenic
1170029654 20:11931615-11931637 CCCTCTGAGAAGCAGATGGAAGG - Intergenic
1172155507 20:32820863-32820885 CCATCGGAGAAGCGGATGCCCGG - Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1176052775 20:63129286-63129308 CCTCCTGAGGAGCAGGTGGACGG - Intergenic
1176287491 21:5026024-5026046 CATGGGGAGGAGCGGCTGGATGG - Intronic
1179571858 21:42283205-42283227 CCTTCTGAGGGGGGGATGGCGGG + Intronic
1179613869 21:42569392-42569414 CCTTCGGAGGAGCAGCAGGGAGG - Intronic
1179869690 21:44237451-44237473 CATGGGGAGGAGCGGCTGGATGG + Intronic
1183469308 22:37997191-37997213 CCTTCAGAGGAGGGGATGGAGGG - Intronic
1184326765 22:43793800-43793822 CCTTCAGATGAACCGATGGATGG - Intronic
949347352 3:3089082-3089104 CCTAGGGAGGAGGGGAGGGAGGG + Intronic
949985025 3:9533805-9533827 CCTTTGGAGGAGTGACTGGAAGG + Intronic
962732710 3:138298664-138298686 CCTAAGGAGAAGAGGATGGAGGG - Intronic
985836128 5:2273153-2273175 CCTTCGCAGGAAAGGCTGGAGGG + Intergenic
996978444 5:129461296-129461318 CCTTTGGAGGAGCCCGTGGAGGG + Exonic
1001418975 5:171572512-171572534 CATTCGGTGTGGCGGATGGATGG - Intergenic
1006847982 6:37076475-37076497 CCTTAGGAGAAGCGGGTGAAGGG + Intergenic
1007096305 6:39215311-39215333 CCTTCAGAGCAGCGAGTGGAAGG - Intronic
1008629241 6:53348218-53348240 CCCTCCGAGGGGCGGACGGAAGG + Intronic
1022160971 7:27710818-27710840 CTTTCGGAGGCGAGGATGGGAGG + Intergenic
1022339637 7:29456192-29456214 CGTTCAGAGGAGCAGATGGGAGG - Intronic
1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG + Intronic
1032885036 7:136128375-136128397 CCTTTGAAGGAGTGAATGGAAGG + Intergenic
1034009533 7:147513933-147513955 CCTTCAGATGAGGGGAAGGAGGG - Intronic
1039799792 8:40944358-40944380 CCTTCTGAGGAGCAGAGAGAAGG - Intergenic
1045839982 8:106568412-106568434 TATTGGGAGGAGAGGATGGAAGG - Intronic
1049015414 8:139916503-139916525 CGTTCCGAGGAGTGGATGGAGGG - Intronic
1051072146 9:13183417-13183439 CCTTAGGAGGAGATGATGGAAGG + Exonic
1052165136 9:25317347-25317369 CTTTAGGAGGAGCTCATGGAGGG + Intergenic
1056787571 9:89604055-89604077 CCGTGCGAGGAACGGATGGAAGG + Intergenic
1062591997 9:137278444-137278466 CCTGCGGAGGGGCGGAGGGGCGG + Intronic
1186731507 X:12415375-12415397 ACTGGGGAGGAGAGGATGGATGG - Intronic