ID: 1105806054

View in Genome Browser
Species Human (GRCh38)
Location 13:23952124-23952146
Sequence TGTCCACCTAGCCTTTGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 162}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105806042_1105806054 23 Left 1105806042 13:23952078-23952100 CCTTCCATCCGCTCCTCCGAAGG 0: 1
1: 0
2: 2
3: 9
4: 73
Right 1105806054 13:23952124-23952146 TGTCCACCTAGCCTTTGCCATGG 0: 1
1: 0
2: 0
3: 13
4: 162
1105806051_1105806054 -9 Left 1105806051 13:23952110-23952132 CCTCCTGCCACTTCTGTCCACCT 0: 1
1: 1
2: 3
3: 43
4: 468
Right 1105806054 13:23952124-23952146 TGTCCACCTAGCCTTTGCCATGG 0: 1
1: 0
2: 0
3: 13
4: 162
1105806046_1105806054 15 Left 1105806046 13:23952086-23952108 CCGCTCCTCCGAAGGGCCCTGCT 0: 1
1: 0
2: 2
3: 19
4: 217
Right 1105806054 13:23952124-23952146 TGTCCACCTAGCCTTTGCCATGG 0: 1
1: 0
2: 0
3: 13
4: 162
1105806048_1105806054 7 Left 1105806048 13:23952094-23952116 CCGAAGGGCCCTGCTGCCTCCTG 0: 1
1: 1
2: 3
3: 65
4: 494
Right 1105806054 13:23952124-23952146 TGTCCACCTAGCCTTTGCCATGG 0: 1
1: 0
2: 0
3: 13
4: 162
1105806049_1105806054 -1 Left 1105806049 13:23952102-23952124 CCCTGCTGCCTCCTGCCACTTCT 0: 1
1: 0
2: 2
3: 96
4: 687
Right 1105806054 13:23952124-23952146 TGTCCACCTAGCCTTTGCCATGG 0: 1
1: 0
2: 0
3: 13
4: 162
1105806050_1105806054 -2 Left 1105806050 13:23952103-23952125 CCTGCTGCCTCCTGCCACTTCTG 0: 1
1: 1
2: 4
3: 79
4: 625
Right 1105806054 13:23952124-23952146 TGTCCACCTAGCCTTTGCCATGG 0: 1
1: 0
2: 0
3: 13
4: 162
1105806047_1105806054 10 Left 1105806047 13:23952091-23952113 CCTCCGAAGGGCCCTGCTGCCTC 0: 1
1: 0
2: 1
3: 25
4: 238
Right 1105806054 13:23952124-23952146 TGTCCACCTAGCCTTTGCCATGG 0: 1
1: 0
2: 0
3: 13
4: 162
1105806045_1105806054 19 Left 1105806045 13:23952082-23952104 CCATCCGCTCCTCCGAAGGGCCC 0: 1
1: 1
2: 2
3: 7
4: 121
Right 1105806054 13:23952124-23952146 TGTCCACCTAGCCTTTGCCATGG 0: 1
1: 0
2: 0
3: 13
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105806054 Original CRISPR TGTCCACCTAGCCTTTGCCA TGG Intergenic
900072514 1:783273-783295 TGTCCACCTATCCTGTGCACTGG - Intergenic
900125471 1:1067243-1067265 TGTCCACCCTGCCCCTGCCATGG - Intergenic
901429168 1:9201987-9202009 TGCCCACCTACCCTCTGCGAAGG - Intergenic
905987858 1:42303597-42303619 TGTCTACTTAGCGTATGCCAGGG - Intronic
907611640 1:55877054-55877076 TTTCCACCTAGTCTGTGCCCAGG + Intergenic
910392497 1:86759370-86759392 TGTCCAGTTAGCTATTGCCATGG + Intergenic
910716517 1:90236799-90236821 TCTCCACCTCGCCTCTGCCGGGG + Intergenic
911942379 1:104063601-104063623 TGGCCAGCTAGCCTTTACAAGGG + Intergenic
917980760 1:180267464-180267486 TGTCCACCTTGGCTTTGCGAGGG - Intronic
921527490 1:216235707-216235729 TGAACAACTAGGCTTTGCCAAGG + Intronic
921683410 1:218061195-218061217 TTTCTACTTAGTCTTTGCCACGG - Intergenic
924281981 1:242447504-242447526 GGACCACCTAGCTTTTGCCTAGG - Intronic
1064371486 10:14755536-14755558 TGTCTACAGAGCCTTTGCCTGGG - Intronic
1067179346 10:43973161-43973183 CATCCACCTGGCCTCTGCCATGG + Intergenic
1069831573 10:71285194-71285216 GGCCCACCTGGCCTTTGCCTGGG - Intronic
1070631129 10:78085566-78085588 TGTGCACCTATAATTTGCCATGG - Intergenic
1071084967 10:81859531-81859553 TGGCCAACTAGTCTTTGACAAGG - Intergenic
1072424808 10:95320892-95320914 TGTCCACCAGGCATTTTCCATGG - Intronic
1073449046 10:103598759-103598781 TGGCCTCCTAGCCCTAGCCAGGG - Exonic
1074738356 10:116459707-116459729 TGGCCACCTTACCTTTGCCCTGG + Intronic
1076281659 10:129251502-129251524 TGTTCACCTAGGCCCTGCCAAGG + Intergenic
1076658808 10:132041674-132041696 TGCCCACCCAGCCTGGGCCACGG - Intergenic
1077586540 11:3458135-3458157 TGTCCACTTCTCCTTTCCCAGGG - Intergenic
1080759703 11:35236679-35236701 TCTCCACTGAGCCTTTGCCCCGG - Intergenic
1081821177 11:45996625-45996647 TGTACACCTAGCCTTTGCTCAGG - Intronic
1084049556 11:66590915-66590937 TGTCCACCTGGTCCTTGTCAGGG + Exonic
1084242539 11:67832166-67832188 TGTCCACTTCTCCTTTCCCAGGG - Intergenic
1085725469 11:78951121-78951143 TGTAAAGCTGGCCTTTGCCATGG + Intronic
1087009761 11:93502054-93502076 TGTTCCCTTAGCCTTTCCCACGG + Intronic
1088366384 11:109044569-109044591 TCTCCACGTAGCCTTTGGCAAGG + Intergenic
1090235178 11:125141754-125141776 TTTCCATCTTGCCTTTGCCTGGG - Intergenic
1090449484 11:126793547-126793569 TGTCCACCCAGCATCTGCCGTGG - Intronic
1090605333 11:128417171-128417193 TTGCCTCCTTGCCTTTGCCAAGG + Intergenic
1092412766 12:8266870-8266892 TGTCCACTTCTCCTTTCCCAGGG - Intergenic
1093767522 12:22982207-22982229 TGTGCGCCTAGAATTTGCCAGGG - Intergenic
1095546691 12:43379584-43379606 TGGTTCCCTAGCCTTTGCCAAGG - Intronic
1098643231 12:72864138-72864160 TGTCCACCAAGGGTTTGCTAAGG - Intergenic
1103524303 12:121557538-121557560 TGTCCACATTTCCTTTGTCATGG - Intronic
1103561246 12:121794226-121794248 TGCCCACCTCGCCTGGGCCAGGG + Exonic
1105806054 13:23952124-23952146 TGTCCACCTAGCCTTTGCCATGG + Intergenic
1106669408 13:31888686-31888708 CTTCCATCTAGCCTCTGCCAAGG + Intergenic
1107332021 13:39311693-39311715 TGTCCACCCAGCAAATGCCAAGG + Intergenic
1107922185 13:45220642-45220664 TGTCCATCTCGGCTTTACCAGGG - Intronic
1108436923 13:50410098-50410120 TTTCCACTTCGCCTTTTCCAGGG + Intronic
1112761173 13:102695146-102695168 TGCCCACCCAGCCTCTGCCTAGG + Intergenic
1113784076 13:112993297-112993319 TGCCCACCAAGCCTCTGCCCAGG - Intronic
1119114434 14:72006181-72006203 TGCCCACCTTGACTTTCCCAGGG + Intronic
1119171492 14:72539386-72539408 TCTACTCATAGCCTTTGCCATGG - Intronic
1119866849 14:77981264-77981286 GGTCCGCCGAGCCTTTGCCCAGG - Intergenic
1121242225 14:92439228-92439250 TGTCCGCCTGGCCTCTGCCCTGG + Intronic
1122883186 14:104699266-104699288 CGTCCACTCAGCCTGTGCCAAGG + Intronic
1124149795 15:27167351-27167373 TGTCCACCCTGCCTTTCTCACGG - Intronic
1124799516 15:32817284-32817306 AGTACATTTAGCCTTTGCCAGGG - Intronic
1124963977 15:34419607-34419629 TGTCCACCCAGCCCTTGCAGAGG + Intronic
1124980591 15:34565838-34565860 TGTCCACCCAGCCCTTGCAGAGG + Intronic
1126114870 15:45199266-45199288 TGCCCACCTAGGCTGTGTCACGG + Intronic
1128364359 15:66986873-66986895 TTTCCACCTGGTCTTGGCCAGGG + Intergenic
1128685595 15:69682712-69682734 AGTCAACCTGTCCTTTGCCATGG + Intergenic
1129242918 15:74262121-74262143 TGACTTCCTAGCCCTTGCCAGGG - Intronic
1133125794 16:3645252-3645274 TGGCCCCCTAGCCTTGGACAGGG + Intronic
1133306651 16:4813778-4813800 TGTCCACGTAGCACTTCCCAGGG + Exonic
1133353970 16:5122367-5122389 TGTCCACTTCTCCTTTCCCAGGG - Intergenic
1134180706 16:12045548-12045570 TAGCCTCCTAGCCTTTTCCAAGG + Intronic
1135307453 16:21379295-21379317 TAGCCTCCTAGCCTTTTCCAAGG + Intergenic
1136304198 16:29358433-29358455 TAGCCTCCTAGCCTTTTCCAAGG + Intergenic
1141555254 16:84832947-84832969 TGTCCACAAAGCCTCGGCCAGGG + Intronic
1144842151 17:18193772-18193794 TGTACAACTAGCCTTTGAGAAGG + Intronic
1148902441 17:50888433-50888455 TGGCCACCCAGCCTTGGCCATGG + Intergenic
1149899329 17:60459456-60459478 TGTCCACCTGTCCTTTCCCTGGG + Intronic
1150211762 17:63445862-63445884 GGACCAACCAGCCTTTGCCACGG - Intronic
1151776652 17:76208515-76208537 TGAACACCTAGTTTTTGCCAGGG - Intronic
1152001224 17:77646317-77646339 TGTCCACCCAGAGTTTCCCACGG - Intergenic
1152364599 17:79848135-79848157 TGTCCATCTGGCCTGTGTCAGGG + Intergenic
1156474176 18:37395159-37395181 TGTCCACTAAGGCTCTGCCAGGG - Intronic
1157222596 18:45838413-45838435 TGGCCACTTAGCATTTGCTAGGG + Intronic
1158638100 18:59178929-59178951 TACCCACCTCACCTTTGCCATGG + Intergenic
1160227979 18:77026002-77026024 TGTGCTCCCAGCCTGTGCCATGG + Intronic
1160668907 19:346967-346989 TGTGCACCTGCCCTTTACCAGGG - Intergenic
1160922946 19:1529151-1529173 TGCCCACCTGGGCTTTCCCAAGG + Intronic
1162464767 19:10832983-10833005 TGCCCACGTAGCCCCTGCCATGG - Exonic
1163568374 19:18065394-18065416 TGCCCACCCAGCCTTCTCCAGGG + Intronic
1163809758 19:19423542-19423564 TGACCACGTGGCCTTAGCCAGGG + Intronic
1165094419 19:33402614-33402636 TGTCCAGCAAGGCTTTCCCAGGG + Intronic
1166783774 19:45355698-45355720 TGGCCACCTGGTCATTGCCACGG + Exonic
1167838092 19:52091540-52091562 TATACAACTAGCCTTTGACAAGG + Intronic
925332664 2:3071094-3071116 TGTCCACCTGCCCCATGCCATGG + Intergenic
930606352 2:53497222-53497244 TCTCCTCCCAGCCTTTGCCCAGG + Intergenic
932435777 2:71701913-71701935 TGTCTATCTGGTCTTTGCCATGG - Intergenic
932785440 2:74597613-74597635 TTTCCTCCTAGACTTTGCCAGGG - Intronic
935067402 2:99661546-99661568 TGTCCAACCAGCCTGGGCCATGG - Intronic
935071872 2:99701562-99701584 TCTTCACCCAGCCTCTGCCAAGG + Intronic
936469578 2:112786843-112786865 TGTGCACTTATCCTATGCCATGG + Intergenic
943193754 2:184716974-184716996 TTTCCACCTAGGCTCTTCCAGGG - Intronic
946444403 2:219726000-219726022 TCCCCACCTGGCCTTTGGCAGGG - Intergenic
948704517 2:239780470-239780492 TGTCCACCTGGCTTTTGACAAGG - Intronic
1169020311 20:2326180-2326202 TGCCCACCTGGCCTGTGCCAAGG - Intronic
1169180065 20:3556438-3556460 TCTCCACAGAGCCTTTGCCTTGG + Intronic
1170800535 20:19586524-19586546 CTTCCCCCTACCCTTTGCCAGGG + Intronic
1171084857 20:22228582-22228604 TTTCCACATCTCCTTTGCCAAGG - Intergenic
1171174581 20:23041903-23041925 TTTTCAGCGAGCCTTTGCCAGGG - Intergenic
1174332374 20:49830480-49830502 TGTCCACGTAGCACTTTCCAGGG - Intronic
1174579949 20:51564245-51564267 TGTCCACCTACTGTGTGCCAAGG + Intergenic
1175807022 20:61835394-61835416 TGTCATCCTAGCCCTTGTCATGG - Intronic
1177480945 21:21687463-21687485 TGTTCACTTAGCATTTGCCTGGG - Intergenic
1178367423 21:31999136-31999158 TGTGAACCTTGCCTTTGACATGG + Exonic
1178614822 21:34123396-34123418 TGTGCACCTTGTCTTTGCCAAGG + Intronic
1182471513 22:30551279-30551301 TGTGCAACCAGCCTCTGCCAGGG - Intergenic
1183022449 22:35038306-35038328 TGTCCACCTTGTCCTAGCCAAGG + Intergenic
1183498770 22:38165474-38165496 TGTGCTCCTGGCCTTTGCCCAGG - Intronic
1183698642 22:39437560-39437582 TTTCCTCCGAGCCTTTGCCATGG + Intergenic
1184632416 22:45793630-45793652 TGTTCCACCAGCCTTTGCCAAGG + Intronic
951589421 3:24247065-24247087 TGTCTAGTTGGCCTTTGCCATGG - Intronic
953419634 3:42744404-42744426 TGTGCTCCTGCCCTTTGCCAGGG - Intronic
953590029 3:44242224-44242246 TTTCCACCTCGCCTCTCCCAGGG - Exonic
956460058 3:69462711-69462733 TGTACAGCAAGCCATTGCCAGGG - Intronic
957057866 3:75458059-75458081 TGTCCACTTCTCCTTTCCCAGGG - Intergenic
957478002 3:80751787-80751809 TCTACACCTTGCCTTTTCCATGG + Intergenic
960190497 3:114698854-114698876 TGTATACCTAGCACTTGCCATGG + Intronic
960407629 3:117281437-117281459 TCTGCACCTAGCTTCTGCCAAGG - Intergenic
960535656 3:118812136-118812158 CATCCACCTACCCTTTGCAAAGG - Intergenic
961094166 3:124140585-124140607 GGGTCATCTAGCCTTTGCCATGG - Intronic
961295585 3:125881652-125881674 TGTCCACTTCTCCTTTCCCAGGG + Intergenic
961890326 3:130125519-130125541 TGTCCACTTCTCCTTTCCCAGGG - Intergenic
962808213 3:138941516-138941538 GGTGCATCCAGCCTTTGCCAGGG - Intergenic
964851947 3:161104895-161104917 TGTCCACCTTGCCTTGCCCCAGG - Exonic
966926599 3:184648442-184648464 TGAGCACCTAGCATGTGCCAGGG + Intronic
967695331 3:192524538-192524560 TGTCCAACAAGCCTTTGATATGG - Intronic
969001736 4:3988069-3988091 TGTCCACTTCTCCTTTCCCAGGG - Intergenic
969889890 4:10250057-10250079 TGAAATCCTAGCCTTTGCCACGG + Intergenic
973177254 4:47222606-47222628 AGACCACCTAGCCATAGCCAAGG + Intronic
974823037 4:67092252-67092274 AATCCACCAAGCGTTTGCCAAGG + Intergenic
976225349 4:82791380-82791402 TGGCCACCAATCCATTGCCAGGG + Intronic
980259257 4:130426349-130426371 TAACCATCTAGCCTTTTCCATGG + Intergenic
982062157 4:151615543-151615565 TGTCCACTTAGCCTTTGGTGGGG + Intronic
983391206 4:167132672-167132694 TGTTCCCCTAGCTTCTGCCAAGG - Intronic
986944568 5:13000060-13000082 TGTCCATCTAGGCTTTGACTTGG - Intergenic
992743815 5:79799529-79799551 TGTCCACCCTGCCTTTGCCCTGG + Exonic
995260537 5:110098796-110098818 TGTGTACCTAGCCTTGGCAATGG + Intergenic
998515095 5:142745882-142745904 TGTCCCCCTTCTCTTTGCCAGGG - Intergenic
998643293 5:144036134-144036156 TGTCCACCTGGACTGTCCCAAGG - Intergenic
1000043337 5:157501372-157501394 TGTCTTCCTAGCACTTGCCATGG + Intronic
1002528042 5:179826034-179826056 TGTCCACCCAGCCTGTCCAAAGG + Intronic
1004792288 6:19040045-19040067 TTTCCTCCTAGCATTTTCCAGGG - Intergenic
1006287469 6:33107537-33107559 TGACCACCTAGCTTCTGCCTGGG - Intergenic
1008683917 6:53903348-53903370 TGCCCACCCACCCTTTGCCAGGG - Intronic
1010855618 6:80834844-80834866 TGTCCATGTAGCCATTGGCAAGG - Intergenic
1011151482 6:84278443-84278465 TCTCCACCTTCCCTTTGGCAAGG - Intergenic
1011169941 6:84494252-84494274 AGTCCACATAGCCATTGCTAGGG + Intergenic
1018081603 6:160263612-160263634 TGTGCACCTAGCCATGGGCAAGG + Intronic
1018467981 6:164069374-164069396 TGTCTCCCAAGCCTTTGCCAAGG + Intergenic
1024472291 7:49775885-49775907 CGTCCACGCAGCCCTTGCCACGG - Exonic
1025173863 7:56786561-56786583 TTTCCACTTAGCCTTTTTCATGG - Intergenic
1025698238 7:63791396-63791418 TTTCCACTTAGCCTTTTTCATGG + Intergenic
1025829967 7:65039852-65039874 TTTCCACTTAGCCTTTTTCATGG + Intergenic
1026569465 7:71516718-71516740 TGCCTACCAAGCCTGTGCCATGG + Intronic
1031118886 7:117698203-117698225 TGTCCACCCTGCCTTGGCAAGGG + Intronic
1032084920 7:128878875-128878897 TATCCACTTGGCCTTGGCCAGGG - Intronic
1033574756 7:142670117-142670139 TATCAACTTAGCCTTTGCCTAGG - Intergenic
1036375497 8:8196005-8196027 TGTCCACTTCTCCTTTCCCAGGG + Intergenic
1036749091 8:11431993-11432015 TGTTAGACTAGCCTTTGCCAGGG - Intronic
1036854036 8:12227144-12227166 TGTCCACTTCTCCTTTCCCAGGG - Intergenic
1036875408 8:12469642-12469664 TGTCCACTTCTCCTTTCCCAGGG - Intergenic
1040684269 8:49852218-49852240 TAGCCATCTATCCTTTGCCAAGG - Intergenic
1041688868 8:60669998-60670020 TGGCCACATAGCCAATGCCAGGG - Intergenic
1042894444 8:73651289-73651311 TGTCCACACAGCCTTCACCACGG + Intronic
1047711900 8:127560960-127560982 CGTGCTCCTAGCCTTTGCCTGGG - Intergenic
1055665194 9:78545922-78545944 TGTCCTCCTAGCATGTGGCATGG - Intergenic
1056276585 9:84999798-84999820 GGTCCACCTACCCTTCCCCAGGG - Intronic
1056382697 9:86069677-86069699 TGGCCACCTAGCCTTCCACATGG + Intronic
1056458016 9:86781970-86781992 TGTCCCCTTAGCCTCTTCCAAGG + Intergenic
1062102890 9:134737740-134737762 TGTCCACATTGCCTTTCCCAGGG + Intronic
1062168980 9:135123887-135123909 TGTCCACCCAGCACTTCCCAAGG - Intergenic
1203555944 Un_KI270743v1:208081-208103 TGTCCTCCCAGCCCCTGCCAGGG + Intergenic
1189344113 X:40227779-40227801 TCTCCACCTTCCCTTGGCCACGG + Intergenic
1190529293 X:51359156-51359178 TGTCCAATTTCCCTTTGCCATGG - Intergenic
1196396060 X:115262833-115262855 TTTCCTCCTAGCCTTTGCATGGG - Intergenic