ID: 1105810697

View in Genome Browser
Species Human (GRCh38)
Location 13:23992667-23992689
Sequence CAGGGAGGGGCTGTAGCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 350}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105810697_1105810711 21 Left 1105810697 13:23992667-23992689 CCATGTGCTACAGCCCCTCCCTG 0: 1
1: 0
2: 3
3: 35
4: 350
Right 1105810711 13:23992711-23992733 GAGAGGGATCCTGCAAGCCTAGG 0: 1
1: 0
2: 1
3: 19
4: 193
1105810697_1105810707 4 Left 1105810697 13:23992667-23992689 CCATGTGCTACAGCCCCTCCCTG 0: 1
1: 0
2: 3
3: 35
4: 350
Right 1105810707 13:23992694-23992716 TGAAAGGGGCCCTGCAGGAGAGG 0: 1
1: 0
2: 1
3: 32
4: 284
1105810697_1105810701 -10 Left 1105810697 13:23992667-23992689 CCATGTGCTACAGCCCCTCCCTG 0: 1
1: 0
2: 3
3: 35
4: 350
Right 1105810701 13:23992680-23992702 CCCCTCCCTGAGCTTGAAAGGGG 0: 1
1: 0
2: 0
3: 17
4: 179
1105810697_1105810708 5 Left 1105810697 13:23992667-23992689 CCATGTGCTACAGCCCCTCCCTG 0: 1
1: 0
2: 3
3: 35
4: 350
Right 1105810708 13:23992695-23992717 GAAAGGGGCCCTGCAGGAGAGGG 0: 1
1: 1
2: 1
3: 48
4: 423
1105810697_1105810706 -1 Left 1105810697 13:23992667-23992689 CCATGTGCTACAGCCCCTCCCTG 0: 1
1: 0
2: 3
3: 35
4: 350
Right 1105810706 13:23992689-23992711 GAGCTTGAAAGGGGCCCTGCAGG 0: 1
1: 0
2: 2
3: 17
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105810697 Original CRISPR CAGGGAGGGGCTGTAGCACA TGG (reversed) Intronic
900366491 1:2313934-2313956 CAGAGTGGGGCTGGACCACAGGG - Intergenic
900689061 1:3968670-3968692 GAGGCAAGGGCTGCAGCACAGGG + Intergenic
900971886 1:5996381-5996403 CAGGGAGGGGCCTGAGCCCAGGG - Intronic
901078787 1:6571990-6572012 CAAGGAGGGGCTGTGGTCCAAGG - Intronic
901117310 1:6857565-6857587 TAGGGTCGGGCTGTAGGACAAGG + Intronic
901696470 1:11011820-11011842 GGGGGAGGGGCTGGAGGACAGGG + Intergenic
901773286 1:11542058-11542080 CAGGGAGGCACAGAAGCACAGGG - Intergenic
901981077 1:13034293-13034315 CAAGGAGGGCCTGAAGCCCATGG + Intronic
903137415 1:21318482-21318504 CAGTGAGAGGCTGAGGCACAAGG - Intronic
903372824 1:22847802-22847824 CATGGAGGGACTGGAGCACAGGG - Intronic
903451597 1:23457225-23457247 CAGGGTGGGGCTGTGGTACATGG - Intronic
903770262 1:25759379-25759401 CAGGGAGGGACTGTAGCTGCTGG - Intronic
904359548 1:29962987-29963009 CTGGGAGTGGCTGGAGGACAGGG - Intergenic
904359589 1:29963111-29963133 CTGGGAGTGGCTGGAGGACAGGG - Intergenic
904359599 1:29963142-29963164 CTGGGAGAGGCTGGAGGACAGGG - Intergenic
904359643 1:29963266-29963288 CTGGGAGTGGCTGGAGGACAGGG - Intergenic
904359654 1:29963297-29963319 CTGGGAGTGGCTGGAGGACAGGG - Intergenic
904359665 1:29963328-29963350 CTGGGAGTGGCTGGAGGACAGGG - Intergenic
904359687 1:29963390-29963412 CTGGGAGTGGCTGGAGGACAGGG - Intergenic
904395790 1:30220993-30221015 GAGTGAGGGGCTGTGACACAGGG + Intergenic
905462010 1:38128104-38128126 CAGGGAGGGGAGGGAGGACAAGG + Intergenic
906608597 1:47187436-47187458 GGGAGAGGGGCTGTAGCAGACGG + Intronic
907255983 1:53179581-53179603 CAGGTAGGTGCTGATGCACAAGG + Intergenic
907384693 1:54118415-54118437 GAGGCAGGGGCTGGAGCACAAGG - Intergenic
907761813 1:57368339-57368361 CAGGGAGGGGCTGAAGGATGGGG + Intronic
910437407 1:87219399-87219421 CAGGGAGGGGATGATGCTCAGGG + Intergenic
911054571 1:93699012-93699034 CAGGGAGGGGATGCAGCGCAGGG + Intronic
911719004 1:101169446-101169468 CAGGGAGGGGCACATGCACAAGG - Intergenic
912420232 1:109537679-109537701 CTGGGAGGGGCTTCAGGACACGG + Intergenic
913247440 1:116882440-116882462 GAGAGAGAAGCTGTAGCACATGG + Intergenic
914685026 1:149970892-149970914 CAGTGAGGGACTGCAGCACCTGG + Intronic
914689143 1:150010394-150010416 CCGGGAGGGGCGGGAGCAGACGG + Intronic
914814307 1:151052309-151052331 CAGGGAGAGGCTCTAGAACAAGG - Exonic
914831621 1:151174733-151174755 GAGGTAGGGGCTCCAGCACAGGG - Exonic
914980377 1:152409958-152409980 CACGGAGGGGCTAGAGAACAGGG - Exonic
915213510 1:154326157-154326179 CAGGAAGGGGCAGTAGCTCTGGG + Intronic
915468532 1:156112496-156112518 CAGGGAGGGGCTGAGGCAGTGGG + Intronic
915619763 1:157073993-157074015 CAGGGAGTGGCTGTTGTCCATGG - Intergenic
915648162 1:157288611-157288633 CAGGGAGGAGCTGTGGCAAGGGG + Intergenic
915922880 1:159990330-159990352 CCGGGAGGGTCCGGAGCACAGGG + Intergenic
916817244 1:168366098-168366120 CAGGGAAGGGCTGTAACAAGAGG - Intergenic
917647609 1:177044521-177044543 CAAAGATGGGCTGTAGCAAAGGG + Intronic
919781060 1:201221527-201221549 CAGGAAGGGGATGAAGCCCAGGG + Exonic
924382205 1:243475149-243475171 AGGAGAGGGGCTGTAGGACAGGG - Intronic
1063348813 10:5335986-5336008 CATGGAGGGGTTGGAGCGCAGGG + Intergenic
1065195831 10:23264725-23264747 CAGGGGGCAGCTGTAGCAGAAGG - Intergenic
1065686937 10:28294986-28295008 CCTGCAGTGGCTGTAGCACATGG + Intronic
1067107457 10:43375604-43375626 CAGGGTGGGGCTGGCGGACAGGG + Intronic
1067655636 10:48189388-48189410 CAGGCAGGAGCTGTACCTCACGG + Intronic
1069610138 10:69767431-69767453 CTGGGAGAGGGGGTAGCACAGGG + Intergenic
1069883569 10:71609258-71609280 CTGGGAGGGGCTGCAGCAGGGGG - Intronic
1069957812 10:72062342-72062364 CAGGGCTGGGCTGGAGGACACGG + Exonic
1070558805 10:77550349-77550371 CTGGGAGGTGCTGTAGCAGCTGG + Intronic
1070744042 10:78922061-78922083 CAGGGAGGGGCTGAGGCAGATGG - Intergenic
1071119545 10:82261680-82261702 CAGGGATGGGCTGAAACAAAGGG + Intronic
1073287851 10:102399315-102399337 CTGGTAGGGGCTGTAGGCCAGGG - Exonic
1073884107 10:108019011-108019033 AAGGCAGTGGCTGTAGCCCACGG + Intergenic
1074416807 10:113273928-113273950 CAGGGAGGGGGTGTTGGACTTGG - Intergenic
1074496256 10:113982716-113982738 GTGGGAGGGGCTGGAGCACCTGG - Intergenic
1074886672 10:117699430-117699452 CATGGTGAGGCTGCAGCACATGG + Intergenic
1075052728 10:119194796-119194818 AAGGGAGGGGATCTAACACAGGG - Intergenic
1076496020 10:130898412-130898434 CAAGGAGGGGGCGTGGCACAGGG - Intergenic
1076829748 10:132988533-132988555 CAGGGAGGGGCTGAGGCCCGGGG + Intergenic
1077073641 11:689896-689918 CTAGGAGGGGCTGAAGCCCAAGG - Intronic
1077579043 11:3405116-3405138 CAGGGAGGGGCTGGCACACCAGG - Intergenic
1077800209 11:5529317-5529339 CAGGGCGGGGCTGCAGTGCAAGG + Intronic
1078097696 11:8310822-8310844 CGGTGAGGGTCTGTGGCACAAGG - Intergenic
1078597124 11:12697145-12697167 CAGGGAGGGGTGGTACCACCAGG - Intronic
1078748567 11:14138624-14138646 CAGGCGGGGGCTGTAGGAAATGG + Intronic
1081783245 11:45728169-45728191 CAGGCAGGGGCTAGATCACATGG - Intergenic
1083266251 11:61548257-61548279 CAGGGAGGGGCTGCACCAGCAGG - Intronic
1083913904 11:65727699-65727721 CAGGGAGTGGCTGTTGTCCATGG - Intergenic
1084236065 11:67788635-67788657 CAGGGAGGGGCTGGCACACCAGG - Intergenic
1085466193 11:76725047-76725069 GAGGGAGGGGCTGGAGCCCATGG - Intergenic
1089332433 11:117699309-117699331 AGGGACGGGGCTGTAGCACACGG + Intronic
1089354001 11:117837932-117837954 CAGGCAGGGGCTGAGCCACATGG - Exonic
1090384332 11:126347917-126347939 CAGGGAAGGGCTGCTCCACAGGG - Intergenic
1090392053 11:126395096-126395118 CAGCCAGGGGCTGTGCCACAGGG + Intronic
1090447464 11:126776253-126776275 CAGGGAGGAGCTGGAGGACTTGG + Intronic
1090758582 11:129816033-129816055 CAGGGAGGGGCTCTGGGACAGGG + Intronic
1091563356 12:1630458-1630480 CAGGGAAGGGCTGTGGCATCTGG + Intronic
1092112646 12:5974736-5974758 CAGTGAGGAGCTGGAGCAGACGG + Intronic
1092207858 12:6626931-6626953 GAGGGAGGGGCTGTGGACCATGG + Intronic
1092406974 12:8227999-8228021 CAGGGAGGGGCTGGCACACCAGG - Intergenic
1092423604 12:8355339-8355361 CAGGGAGGAGCTGTATGAAAGGG + Intergenic
1094838609 12:34333767-34333789 CACGGAGGGCCTGGAGCCCACGG + Intergenic
1095998669 12:48111226-48111248 CAGGGAGAAGCTGTGACACAAGG - Intronic
1096626658 12:52899994-52900016 CAGGGAGCGGCTGTTGTCCATGG + Exonic
1096781664 12:53995589-53995611 CAGGGAGCGGCTCTAGCTCTGGG + Intronic
1096791450 12:54047597-54047619 CAGGGAGGGGACGAAGCCCAAGG + Intronic
1096837910 12:54362844-54362866 CAAGAAGGGGATGTAGCTCAGGG + Exonic
1097341557 12:58444148-58444170 CAGAGAGGTGATGTAACACATGG - Intergenic
1098319278 12:69224753-69224775 CAAGGAGGGTCAGTAGAACATGG + Intergenic
1099953425 12:89328862-89328884 CATGGAGGGGCAGTAGAAAATGG - Intergenic
1101384314 12:104242689-104242711 CAGGGTTGGGCTCTACCACAGGG - Intronic
1101521119 12:105483366-105483388 TTGGGAGGGGCTGAAGAACATGG + Intergenic
1102745514 12:115245510-115245532 CAGAGAGTCGCTGTAGCAAAAGG - Intergenic
1102976139 12:117208303-117208325 AAGGAAGGTGCTGGAGCACAGGG + Exonic
1103486479 12:121286351-121286373 CAGGGAAGGGCTGATGAACAGGG + Intronic
1103959909 12:124603011-124603033 CAGGGAGGGGCTGCAACATGGGG + Intergenic
1103984901 12:124760657-124760679 CAGGGAGGTGCTGGGGCTCAGGG + Intergenic
1105810697 13:23992667-23992689 CAGGGAGGGGCTGTAGCACATGG - Intronic
1108213294 13:48159580-48159602 CAGAGTGGGGGTGTAGCACATGG + Intergenic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1108617203 13:52145257-52145279 CTGGGAAGGGCTGGAGCAAAGGG - Intronic
1110633416 13:77736715-77736737 CAGGGAGGGCATGTAGGATAAGG - Intronic
1110829837 13:80018370-80018392 CAGGGCCTGGCTGTGGCACAAGG - Intergenic
1111076242 13:83239779-83239801 CAAGGAGGGGATGAAGGACAAGG + Intergenic
1113378809 13:109785553-109785575 CAGGGAGGCGCTGCAGGACGCGG + Exonic
1118000132 14:61515166-61515188 CAGGGAGGGGGTGAAGAACAAGG + Intronic
1119405749 14:74398105-74398127 TTTGGAGGGGCTGTAGCTCAGGG - Intergenic
1120822683 14:88927504-88927526 CAGAGATGGGCTGTAGGGCATGG + Intergenic
1121839382 14:97120036-97120058 CAGGGAGGGGTGGAAGAACAGGG + Intergenic
1122242639 14:100379019-100379041 GAGGGAAGGGCTGGAGCACAGGG + Intronic
1122825577 14:104368922-104368944 CATGGAGGGGCAGTGGCCCAGGG + Intergenic
1122975082 14:105167718-105167740 GAGGGAAGGGCTGGAGCACGAGG + Intronic
1123024481 14:105418328-105418350 TAGGCTGGGGCTGTAGGACAGGG + Intronic
1123041385 14:105491648-105491670 CAGGGAGTGGCGAGAGCACACGG - Exonic
1124095952 15:26648899-26648921 CAGGGAGGGGCTGGAGCTTGTGG + Intronic
1124958204 15:34373964-34373986 CAGGGAGAAGCTGGAGGACATGG + Intergenic
1125768762 15:42151596-42151618 CAAGGAGGGGCTGTAGGGCAGGG - Intronic
1125771124 15:42166727-42166749 CTGGGAGGGGCTCTTGTACATGG - Intronic
1126467271 15:48972635-48972657 CAGGGAGCGGCTGTTGTCCATGG - Intergenic
1127456252 15:59158559-59158581 GTGGGAGGGGCTGGAGGACAGGG + Intronic
1127969114 15:63945201-63945223 CACGGAGGGGTTAGAGCACAGGG - Intronic
1128783505 15:70378453-70378475 CAGGGAGGGGCTGGAGATCTGGG - Intergenic
1129172893 15:73818550-73818572 CAGCGTGGGGCTGTGGCACAGGG + Intergenic
1129189564 15:73929426-73929448 CAGTGAGGGGCTGCTGCTCATGG + Intronic
1129245568 15:74276837-74276859 CAGGGAGGACCTGAAGGACAAGG - Intronic
1131054900 15:89369296-89369318 CAGCGAGTGGCTGTAGACCAAGG + Intergenic
1131557392 15:93411845-93411867 CAGGGGAGGGCTGAAGCTCAGGG - Intergenic
1132075729 15:98818296-98818318 CAGAGAGGGTCTGTAGGCCATGG + Intronic
1132302486 15:100784551-100784573 CTGGGGAGGGCTGGAGCACAGGG + Intergenic
1132986417 16:2769849-2769871 CTGGGTGTGGCTGGAGCACAGGG - Intronic
1133022940 16:2974768-2974790 CAGGGAGGGGCGGAAGCAGGGGG + Intronic
1133282978 16:4677520-4677542 CAGGACGGGGCTGAAGGACACGG - Exonic
1133286249 16:4692181-4692203 CGGGGAGGGGCTGCAGCAAGGGG + Intergenic
1133347644 16:5081196-5081218 CAGGGAGGGGCTGGCACACCAGG - Intronic
1133388885 16:5393078-5393100 GAGGGTGGGGCTGTGGCTCAGGG + Intergenic
1134172269 16:11977543-11977565 AAGGGAAGGGCTGCAGGACAAGG - Intronic
1136186173 16:28590243-28590265 GAGGGAGGGGCTGGTGCCCAGGG + Intronic
1136639452 16:31550539-31550561 CAGAGAGGGGCTGCGGCAAAGGG - Intergenic
1137502692 16:49023703-49023725 CCCGGAGGGGATGCAGCACAAGG + Intergenic
1137605221 16:49782674-49782696 CAGGGAGAGGCAGTAGGAGAAGG - Intronic
1137609772 16:49810547-49810569 CAGGGTGGGGCTGTCCCTCAGGG - Intronic
1138410703 16:56837685-56837707 CAAGGAGAGGCTGAAGAACATGG + Exonic
1140133219 16:72182711-72182733 GAGGGAGAGGCTACAGCACAAGG - Intergenic
1141757229 16:85999314-85999336 CAGTGAGGGGCTTGAGCAGAGGG - Intergenic
1141790803 16:86232785-86232807 CGGTGAGGGGCTGGAGCTCACGG - Intergenic
1142366177 16:89650964-89650986 CTGGCAGGGGCTGTAGGGCAGGG + Intronic
1142787760 17:2237632-2237654 CAGGAAGAGGCTGTAACGCAGGG + Intronic
1142994078 17:3750751-3750773 CAGGGACGGGGTGGACCACAGGG + Intronic
1144099935 17:11934188-11934210 CAGGCAGGGGCTGAGGCAAAAGG + Intronic
1144441379 17:15285849-15285871 CACGCAGGGGCCGGAGCACAGGG + Intergenic
1144679569 17:17183861-17183883 AAGGGATGGGCTCTAGCTCAGGG - Intronic
1144767361 17:17740004-17740026 CAGGGTGGGGCTGCAGCATCTGG - Intronic
1145944051 17:28759683-28759705 CGGGTAGGGGCTGTAGCGCTGGG + Exonic
1146285724 17:31573004-31573026 AAGGAAGGGGCTGTAACCCAGGG + Intronic
1146472855 17:33138591-33138613 CAGGAAGGGGCTGGAGCAAAGGG - Intronic
1146816086 17:35943616-35943638 CTGGGAGGATCTGTAGAACAAGG + Exonic
1147262226 17:39215175-39215197 CAGGGAGGTGCCATAGCGCAGGG + Exonic
1147973670 17:44235311-44235333 CAGGGAGTGGCAGGAGCAGAGGG - Intergenic
1148848371 17:50541973-50541995 CAGAGAGGCGCTGTAGGTCATGG - Exonic
1151386669 17:73759272-73759294 CAGGGAGGGGCTGGAGCTCCTGG + Intergenic
1151477506 17:74352383-74352405 CAGGGAGGGGCTGATGACCAAGG + Intronic
1151667887 17:75556080-75556102 CAGGGACGGGCTGTAGCCGAGGG - Exonic
1151723729 17:75873110-75873132 CAGAGAGGGGCTGTGGCCGAGGG - Intergenic
1152570489 17:81119350-81119372 CTGGGCGGGGCTGTGGCAGAAGG - Intronic
1153456935 18:5293510-5293532 CAGATAAGGGCTGTAGCACTCGG + Intronic
1153664055 18:7352262-7352284 CAAGGATGGCCTGGAGCACAGGG - Intergenic
1154125516 18:11689361-11689383 CAGTGAGGGGCTGTGGCCCTCGG + Exonic
1154133895 18:11759752-11759774 CAAGGAGAGGCGGCAGCACACGG - Intronic
1155522053 18:26678087-26678109 CAGAGAGGGGCAGAGGCACAGGG + Intergenic
1156558135 18:38090497-38090519 CAGGAGGGGGCTATAGCACCTGG + Intergenic
1156892958 18:42210903-42210925 CAGGGAGGTGCTGTACTACTTGG - Intergenic
1157193815 18:45603649-45603671 CTGGGAGGGGCTGTATGAGAGGG - Intronic
1157508379 18:48248446-48248468 CAGGGAGGGCCAGTATCAAAAGG - Intronic
1157622209 18:49023165-49023187 CATAGAGGGGCTGAAGAACATGG - Intergenic
1158217842 18:55118770-55118792 CAGGGAGATGCTTTAGCACATGG + Intergenic
1158504547 18:58034920-58034942 CAGGGAGGGGCTGTTAGCCAGGG + Intergenic
1158557925 18:58490519-58490541 GAGGGAGGGGCCATAGCACTGGG - Intronic
1159607491 18:70490208-70490230 CACGGAGAGGCTGTGGGACATGG + Intergenic
1160239258 18:77111489-77111511 CAGGCAGGGGCAGCAGCAGAAGG + Intronic
1160509199 18:79443848-79443870 CTGGGAAGGGCTGTGCCACATGG + Intronic
1160537604 18:79603484-79603506 CGGGGAGGGGCTGTGGCCCTGGG - Intergenic
1160590902 18:79944178-79944200 CAGGGAGGGCCTGGGGCACCTGG - Intronic
1160700599 19:505157-505179 CAGGGAGGGGCTTCAGGTCATGG - Exonic
1163184515 19:15628589-15628611 CAGGGAGGGGCAGCACCTCAGGG - Exonic
1163439119 19:17312660-17312682 CAGGAAGCGGCTGCAGGACAGGG - Intronic
1166326227 19:42052760-42052782 CAGGGAGGGGGTGATCCACAGGG - Intronic
1167421625 19:49407331-49407353 CAGGAAGTGGCTGGTGCACATGG - Intronic
1167427805 19:49438429-49438451 CAGGAAGGGGCTGGAACAGATGG + Intronic
1167568497 19:50272035-50272057 CACTGAGGCCCTGTAGCACATGG - Intronic
1168163673 19:54531508-54531530 CAGGGTGGGACTGCAGGACATGG - Intergenic
1168282618 19:55313489-55313511 CAGGAAGGGCCTGTAGGCCATGG - Intronic
1168293400 19:55368095-55368117 CAGAGCGGGGCTGTTGCACTCGG + Intronic
1168573953 19:57492623-57492645 CAAGGATGGGGTATAGCACAGGG - Intronic
1168575615 19:57506129-57506151 CAAGGATGTGGTGTAGCACAAGG - Intronic
1168671324 19:58243523-58243545 CTGGGAGGGGGTGTTGTACAGGG - Intronic
925870666 2:8267148-8267170 GAGGGAGGGGGTTTAGCAGAAGG + Intergenic
926335452 2:11859294-11859316 GAGGGAGGGGCTGTAGGATAAGG + Intergenic
926794951 2:16611624-16611646 CAGAAAGGGGCTGTAGCTCGAGG + Intronic
927841632 2:26448811-26448833 CAGGCGGGGGCTGCAGCAGAGGG + Intronic
928140151 2:28721494-28721516 CATGGAGGGGCTGGATCCCAGGG - Intergenic
929437433 2:41939246-41939268 CAGGGAGGGGCTGTGGGAGGAGG + Intronic
930817390 2:55612473-55612495 CATGGAGGTGCTGAAGCAAAAGG + Intronic
931575989 2:63719311-63719333 CAGGGAGGGAATGTGGGACAGGG + Intronic
932144234 2:69304906-69304928 CAGGGTGGGGCTGTCGCTGAGGG + Intergenic
933728595 2:85440091-85440113 CGGGGAGGGTCTGTAGCACAGGG + Intergenic
935405299 2:102703071-102703093 CAGGGAGGTGAAGTGGCACACGG + Intronic
935582745 2:104772366-104772388 TCTGGAGGGGCTGTAGCTCAGGG + Intergenic
935742401 2:106161164-106161186 CAGGGCTGGGCAGGAGCACAAGG + Intronic
936475416 2:112835516-112835538 CAAGGAAGGGCTCTAACACAGGG - Intronic
937124644 2:119465830-119465852 CAGGGAGGAGCTGTAGCCCACGG + Exonic
937154335 2:119708008-119708030 AGAGCAGGGGCTGTAGCACAGGG - Intergenic
937286969 2:120760027-120760049 GAGGGAGGGGCTTTAGCCCTGGG + Intronic
938150080 2:128874902-128874924 CAGGCAGGGGCAGATGCACATGG + Intergenic
943064474 2:183071726-183071748 CAGGGAGTGGCTGTTGTCCATGG + Intergenic
944898378 2:204189000-204189022 CATGGAGTGGCTGAAGCACTGGG + Intergenic
947590690 2:231383399-231383421 CATGCAGGGGCTGTAGGCCAGGG - Intergenic
1170426453 20:16240049-16240071 CAGGGTGCTGCTGTAGGACAAGG - Intergenic
1170480543 20:16760886-16760908 CAGAGAGGGACTGCAGGACACGG + Intronic
1170678819 20:18507070-18507092 CAGGGAGGGGCTGAAAAACTTGG + Intergenic
1171389039 20:24789506-24789528 CAGGAAGGAGCTGAAGCAGAGGG - Intergenic
1172792985 20:37519094-37519116 CATGGAGTGGCTGAACCACAGGG + Exonic
1173298014 20:41776592-41776614 CAGGGAGAGGCCATAGCTCATGG + Intergenic
1173591935 20:44231571-44231593 CAGGAAGGGGCTGAGGCAGAGGG - Intergenic
1173818921 20:46008451-46008473 CTGGGAGGGGGTGTTGCAAAAGG + Intergenic
1174575281 20:51532844-51532866 CAGGGAGGGGCAGAGGCAAATGG + Intronic
1174686912 20:52465070-52465092 CAAGGAGGAGCTGCAGCCCACGG - Intergenic
1174737949 20:52983829-52983851 CAGGGAGAGGCTGAACCTCAGGG - Intronic
1175843523 20:62046631-62046653 CTGGGTGGGGCTGCCGCACACGG + Intronic
1176021528 20:62964625-62964647 CAGCGTGGGTCTGGAGCACATGG - Intronic
1176691511 21:9916482-9916504 CAGGGAGGGGCTGTAGGGGGTGG - Intergenic
1178375606 21:32065147-32065169 CAGGGAGGGGCTGTGTGTCATGG - Intergenic
1178448691 21:32671028-32671050 CAGGCAGGGGCTGTAGCATCTGG - Intronic
1178948283 21:36966289-36966311 CCGGGAGGGGCTGTTGCCCCGGG - Intronic
1180720849 22:17907292-17907314 CAGGGAAGAGGTGTAGGACATGG + Intronic
1180848046 22:18995113-18995135 CAGGGCTGCGCTGTAGCTCAAGG + Intergenic
1180887070 22:19253398-19253420 CAGGGAGGGACCGTGGCCCATGG - Intronic
1181111980 22:20607583-20607605 CTGGGAAGGGCTGCAGCACGTGG + Intergenic
1181911557 22:26242340-26242362 CAGGGAGGGGCTTGAGCCCAGGG - Intronic
1182462132 22:30490570-30490592 CAGGGAGGAGCTGTGGCCCACGG + Intronic
1183108891 22:35634041-35634063 CAGGGAGTGGCTGAATCATAGGG + Intronic
1183182318 22:36268404-36268426 CAGGGACGGGCAGTTGCACATGG - Intergenic
1183639720 22:39085446-39085468 CAGGGAGGGGCTGTAGAGCTGGG - Intronic
1183703270 22:39461743-39461765 ATGGGAGGGGCTGTAGCATCGGG - Intronic
1183741476 22:39670860-39670882 CAGGTAGTGGCTGGTGCACATGG - Exonic
1184196232 22:42930852-42930874 CAGGGAGGCTCTGGAGCACCTGG - Intronic
1184525429 22:45019982-45020004 CTGGGAGGGGCTGGGGCAGAAGG + Intergenic
1184554729 22:45227017-45227039 GAGGGAGCAGCTGAAGCACATGG - Intronic
1184668340 22:46000242-46000264 CAGGTAGGGGCTGTTTCACCTGG - Intergenic
1184767568 22:46579648-46579670 CAGGGAGGGGAGGGGGCACACGG - Intronic
1184929854 22:47672965-47672987 CATGGAGGGGCTGGTGCACCGGG - Intergenic
1185064141 22:48622286-48622308 CAGGGAGTGGCTGTTTCACATGG + Intronic
1185182481 22:49371472-49371494 CAGGGAGGGACTGCAGGACAGGG - Intergenic
1185389533 22:50551434-50551456 CAGGGAGGGGCTGCAGCTCTGGG + Intronic
950441266 3:13012061-13012083 TATGGAGGGGGTGTGGCACACGG + Intronic
951075229 3:18383133-18383155 CAGGCAGAGGATGAAGCACAGGG + Intronic
953407179 3:42665245-42665267 CAGGCAGGGGCTGGACCCCAGGG + Exonic
953718456 3:45335416-45335438 CAGGGAGGGCCTGGAGCCCAAGG + Intergenic
953741794 3:45544903-45544925 CAGGGAGGTACTGGAGCAGAGGG + Intronic
953812930 3:46129991-46130013 CAGAGAGGAGCTGGAGAACACGG + Intergenic
954297264 3:49681196-49681218 CTGGGGGTGGCTGTAGCACCCGG - Exonic
954369998 3:50165201-50165223 GAGGGAAGAGCTGGAGCACAGGG + Intronic
954826149 3:53375192-53375214 CTGGGAGGCGCTGTGGTACAGGG + Intergenic
956064190 3:65379584-65379606 GATGGAGGGGCTGCAGGACACGG - Intronic
958467084 3:94472014-94472036 CAGGGAGGGCCTACAGAACAGGG + Intergenic
959234155 3:103696503-103696525 CAGAGTGGGGCTGTAGGTCATGG + Intergenic
961561320 3:127732395-127732417 CAGGGAGGGACTTGAGTACAGGG + Intronic
961641209 3:128365761-128365783 CAGGGATTGGCTGTGCCACAAGG + Intronic
961885642 3:130094666-130094688 CAGGGAGGGGCTGGCACACCAGG - Intronic
962299470 3:134225118-134225140 CAGGGAGAGGCTTTTGCAGAAGG - Intronic
962323620 3:134413032-134413054 CAGGGATGGGATGGAGCAGAGGG + Intergenic
962505734 3:136045126-136045148 CTGGGAGGGGCTGGTGGACAGGG - Intronic
962805160 3:138921919-138921941 GAGAGAGGGCCTGCAGCACAGGG + Intergenic
963856523 3:150259328-150259350 AAGGGAGAGGCTGGAGGACAAGG + Intergenic
964360407 3:155889540-155889562 CACGTAGGTGCTGTAGCACTAGG + Intronic
965605725 3:170496171-170496193 CAGGGAGAGGCTGTTGTCCATGG - Intronic
965774001 3:172209683-172209705 CAGGGAGGGCCTGAAGCCTATGG - Intronic
965837366 3:172866903-172866925 CAATGAGGGGCTTTAGCACCCGG + Intergenic
968145192 3:196292717-196292739 CTGGGTGGTGCTGTAGAACAGGG - Intronic
969490308 4:7495859-7495881 CAGGGAGGAGCTGAGGCCCAGGG + Intronic
969759168 4:9169985-9170007 CAGGGAGGGGCTGGCACACCAGG + Intergenic
969819129 4:9707465-9707487 CAGGGAGGGGCTGGCACACCAGG + Intergenic
970573978 4:17409559-17409581 CAGGGAAGGGCAGTAACAAAAGG + Intergenic
973270487 4:48257533-48257555 CAGGGAGGTTCTGTAACACTTGG - Intronic
977903866 4:102453994-102454016 CAGGGAGGGGCTGAGGCAGGAGG + Intergenic
977928718 4:102729411-102729433 CAGGGAGCGGCTGTTGTCCATGG + Intronic
978313199 4:107409113-107409135 TAGAGAGTGGGTGTAGCACACGG + Intergenic
978822285 4:112979936-112979958 CAGGGAGGGGCTGAAGCCTGGGG - Intronic
979979084 4:127232397-127232419 CAAGGAGGGGGTATAGCACAGGG + Intergenic
984375325 4:178922281-178922303 CAGGGATGGCCTGAAGCCCAGGG + Intergenic
984828152 4:183946857-183946879 CAAGGAGGGGGTGGATCACAAGG - Intronic
985758357 5:1732501-1732523 CAGGGCCTGGCAGTAGCACAGGG - Intergenic
985848197 5:2369781-2369803 CAGGCAAGGGCTGTGCCACATGG + Intergenic
985852446 5:2398488-2398510 GAGGGAGGTGGTGTAGCTCAAGG + Intergenic
987292707 5:16523673-16523695 GAGGGAGGGAGTGTGGCACAAGG + Intronic
988421781 5:31014299-31014321 CAGAGAGGGGATTTAGAACAAGG + Intergenic
989232074 5:39098118-39098140 CAGGCATGAGCTGTAGCACCTGG + Intergenic
989620987 5:43384197-43384219 CAGGGAGGGGCATTGGCACCGGG + Intronic
990410245 5:55534727-55534749 CTGGGAGGGGCCGTAGCTCGGGG - Exonic
990900538 5:60744241-60744263 CAGGGAGCGGCTGTTGTCCATGG + Intergenic
993301151 5:86212170-86212192 CAGGAAGGGGCTGGAGAAGATGG + Intergenic
996432957 5:123401581-123401603 CAGGGAGCGGCTGTTGTCCATGG + Intronic
998093120 5:139382427-139382449 CAGGGAGGGGCTGGAGTCCCCGG + Intronic
1000098561 5:157992813-157992835 CAGGCAGAGGCTGTCGCACCTGG + Intergenic
1001905193 5:175466375-175466397 CTGGGAGGGAGTGCAGCACATGG - Intergenic
1003155775 6:3592882-3592904 CTGGGAGGGTCTGTTGCACATGG - Intergenic
1006102018 6:31691492-31691514 CAGGGAGGTGCTATAGCATTGGG + Intronic
1007397865 6:41587593-41587615 GAGGGAGGGGGTGGAGCCCACGG + Intronic
1007420468 6:41716267-41716289 TAGGGAGGGGGTGTACCACTGGG - Intronic
1010590511 6:77706791-77706813 CAGGGAGCCGGTGTATCACATGG - Intronic
1011082553 6:83505600-83505622 TAGGGAGGGACTGTAGGCCATGG + Intergenic
1012048343 6:94307513-94307535 CAGAGATGGTCAGTAGCACAAGG - Intergenic
1013177882 6:107692815-107692837 CAGGGTGGGGCTGCGGAACATGG + Intergenic
1015792949 6:136982303-136982325 CAGGGTGGGGAGGTAGGACAGGG + Intergenic
1016466098 6:144327176-144327198 CAGGGAGGGGGTGAAGGAGAGGG + Intronic
1018021023 6:159762310-159762332 GAGGGTGGGGCTGTAGCACCAGG - Intronic
1019321452 7:417296-417318 CAGGTAAGGGCTGAAGCCCAGGG - Intergenic
1019413641 7:917376-917398 CTGGGAGGGGTTGGAGCACTGGG + Intronic
1019661726 7:2227982-2228004 CAGGGAGGGCCTGGAGAACATGG - Intronic
1020319095 7:6927132-6927154 CAGGGAGGGGCTGGCACACCAGG - Intergenic
1021116441 7:16750833-16750855 CAGGTAGGGGCAGTAGAAGATGG + Intergenic
1022395234 7:29982400-29982422 CAGGCATGGGCTATAGCACCTGG - Intronic
1022516235 7:30976603-30976625 GAGGGAGGTGCTGTTGCCCACGG + Intronic
1023758907 7:43445271-43445293 GCAGGAGGGGCTGTAGCACGAGG - Exonic
1023868355 7:44249575-44249597 CAGGGAGGTGATGGACCACAGGG - Intronic
1023913070 7:44569077-44569099 AGGGGAGGGGCTGTGGCCCAGGG - Intronic
1026207647 7:68272119-68272141 CGGAGAGGGGCTGTAGTGCAGGG - Intergenic
1026381165 7:69800787-69800809 CAGGGAGGGGCTGGGGAAAAAGG - Intronic
1026498444 7:70922851-70922873 CAGGGACGGGTTGTGGAACAAGG + Intergenic
1029436191 7:100565281-100565303 CAGGGAAGAGCTGTTCCACAGGG - Exonic
1029595381 7:101535074-101535096 CATGGAAGGGCTGGAGGACAAGG - Intronic
1029736624 7:102469024-102469046 GTGGGCGGGGCTGAAGCACAGGG - Exonic
1030218069 7:107067050-107067072 CAGGGAGGGGGTGAAGCATGGGG - Intronic
1032719074 7:134536171-134536193 CAGGAAGAGGCTGCAGCATACGG - Intronic
1032724048 7:134574950-134574972 CAGGAAGAGGCTGCAGCATACGG - Intronic
1034105153 7:148483626-148483648 CAGGGAGGCGCTGGAGCTCAGGG + Intergenic
1034891743 7:154845854-154845876 CAGGGAGGGGCTGTGAAACATGG - Intronic
1035561020 8:603365-603387 CTGGGAGGGGCTGTCACATACGG - Intergenic
1036381316 8:8238016-8238038 CAGGGAGGGGCTGGCACACCAGG + Intergenic
1036847347 8:12178976-12178998 CAGGGAGGGGCTGGCACACCAGG - Intergenic
1036868712 8:12421297-12421319 CAGGGAGGGGCTGGCACACCAGG - Intergenic
1037228024 8:16619464-16619486 CTGTGAGGGGCAGTGGCACAGGG - Intergenic
1037553993 8:20004480-20004502 CAGGGAGGGCCTGAAGGCCAGGG - Intergenic
1040296587 8:46152123-46152145 CAGGTAGGGGCTATAGCCCCAGG - Intergenic
1041728188 8:61037925-61037947 CAGGGAGGGGCTTTCTCACAAGG + Intergenic
1041781098 8:61578959-61578981 CAGGGAGCGGCTGTTGTCCATGG - Intronic
1042703704 8:71644348-71644370 CAGAGAGGGAGTGTAGCACCTGG - Intergenic
1044881830 8:96731024-96731046 CGGGGAGTGGGTGTAGCAAATGG - Intronic
1044970858 8:97618227-97618249 CAGGGAGAATCTCTAGCACAAGG - Intergenic
1045354661 8:101374938-101374960 AAGGGAGGGGCTGGAGAACCAGG + Intergenic
1047360718 8:124166436-124166458 CAGGGTGGGGCTGGAGAAAAAGG - Intergenic
1049208940 8:141376480-141376502 CTGGGAGCGGCTGAAGCTCAGGG + Intergenic
1049210337 8:141383598-141383620 CGGGGTGGGGCTGCACCACACGG + Intergenic
1049210446 8:141384120-141384142 CAGGGAGGGGTTGGCGAACAAGG - Intergenic
1049312251 8:141939325-141939347 CCGGGAGAGGCTGGAGGACAAGG + Intergenic
1049411141 8:142474516-142474538 CAGAGAGGGGCAGCAGCACCAGG - Intronic
1049746685 8:144266065-144266087 CAGGCAGGCGCTGGCGCACATGG + Intronic
1053219827 9:36303026-36303048 TTTGGAGGGGCTGTAGCTCAGGG - Intronic
1053221938 9:36319494-36319516 CAGGGTAGGGCTGCAGCCCATGG - Intergenic
1053628443 9:39902561-39902583 CAGGGAGGGGCTGTAGGGGGCGG - Intergenic
1054215444 9:62348140-62348162 CAGGGAGGGGCTGTAGGGGGCGG + Intergenic
1054672037 9:67807207-67807229 CAGGGAGGGGCTGTAGGGGGCGG - Intergenic
1056923009 9:90808731-90808753 CAGGGAGGAGCGGGAGGACAAGG - Intronic
1058206663 9:102117419-102117441 GAGAGAGGGGCTATAGTACAGGG + Intergenic
1062035138 9:134379624-134379646 CAGAGAGGGGCTGGAGCAGGAGG - Intronic
1062388915 9:136326474-136326496 CAGGGAGGGGCTGGGGTGCACGG + Intergenic
1062566687 9:137166815-137166837 CAGGGAGGGGGAATAGCGCAGGG + Intronic
1185639745 X:1582718-1582740 TCGGGAGGGGCTGAGGCACAAGG - Intergenic
1185747623 X:2584661-2584683 CGGGGAGGGGCTGCGGCACTGGG + Intergenic
1185907788 X:3952416-3952438 CAGGGAGGGGCTATGGCAGGTGG + Intergenic
1187397448 X:18930920-18930942 CAGGGAGGGGAAGGAGCCCAGGG - Intronic
1188980082 X:36719801-36719823 CAGTGAGGGGCTGGAGCACAGGG + Intergenic
1189082993 X:37994226-37994248 CAATGAGGGGCTGGAGCATAGGG + Intronic
1189649861 X:43177469-43177491 CCAGGTGGGGCTGGAGCACATGG + Intergenic
1189893833 X:45632970-45632992 CAGGGAGCGGCTGTTGTCCATGG + Intergenic
1191220720 X:57985422-57985444 CAGGGAGTGGCTGTTGTCCATGG - Intergenic
1191881747 X:65849433-65849455 CAGAGAGGGGCTGGATCAAAGGG + Intergenic
1192234547 X:69287324-69287346 GAGGGAGGGGAGGAAGCACAGGG + Intergenic
1192312500 X:70028279-70028301 CAGGGAGGGCTTGTAACAGAAGG - Intronic
1193219315 X:78903493-78903515 CAGGGAGGGAAGGTAGAACAGGG + Intergenic
1195877962 X:109562124-109562146 CAGGGAGGTGATGGAACACAAGG - Intergenic
1195955333 X:110322982-110323004 CAGGCAGTGGCTGTGGCATAAGG - Intronic
1196181143 X:112690997-112691019 TTTGGAGGGGCTGTAGCTCAGGG + Intergenic
1198619257 X:138488365-138488387 CAGGGAGTAGCTGTTGCCCATGG + Intergenic
1199241599 X:145554017-145554039 CAGGTAGGGGCTGTCTCACATGG - Intergenic
1199773241 X:150988393-150988415 TTGGGAGAGGCTGTAGCTCAGGG + Exonic