ID: 1105814293

View in Genome Browser
Species Human (GRCh38)
Location 13:24020106-24020128
Sequence AGGGAGAAGCTGTATGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 277}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105814293_1105814297 4 Left 1105814293 13:24020106-24020128 CCAGCTGCATACAGCTTCTCCCT 0: 1
1: 0
2: 1
3: 23
4: 277
Right 1105814297 13:24020133-24020155 GCATGAAACACACCAACATTTGG 0: 1
1: 0
2: 1
3: 16
4: 173
1105814293_1105814298 5 Left 1105814293 13:24020106-24020128 CCAGCTGCATACAGCTTCTCCCT 0: 1
1: 0
2: 1
3: 23
4: 277
Right 1105814298 13:24020134-24020156 CATGAAACACACCAACATTTGGG 0: 1
1: 1
2: 2
3: 25
4: 238
1105814293_1105814301 26 Left 1105814293 13:24020106-24020128 CCAGCTGCATACAGCTTCTCCCT 0: 1
1: 0
2: 1
3: 23
4: 277
Right 1105814301 13:24020155-24020177 GGATGATGACTTGAGGAATTTGG 0: 1
1: 0
2: 2
3: 11
4: 192
1105814293_1105814300 19 Left 1105814293 13:24020106-24020128 CCAGCTGCATACAGCTTCTCCCT 0: 1
1: 0
2: 1
3: 23
4: 277
Right 1105814300 13:24020148-24020170 ACATTTGGGATGATGACTTGAGG 0: 1
1: 0
2: 1
3: 22
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105814293 Original CRISPR AGGGAGAAGCTGTATGCAGC TGG (reversed) Intronic
900140784 1:1138816-1138838 AGGGAGAAGCTCTCTGAAGACGG + Intergenic
900409822 1:2507469-2507491 AGGGAGAAGCTGGAGCCAGGGGG + Intergenic
900773807 1:4566471-4566493 AGGAAGTTGCTGTTTGCAGCAGG - Intergenic
900948728 1:5845680-5845702 ACAGAGCTGCTGTATGCAGCAGG - Intergenic
901640117 1:10688855-10688877 AGGGAGAAGCTGGGAGCAGGAGG - Intronic
901670031 1:10850638-10850660 AGAGAGGAGCTGTGTGCAGTAGG - Intergenic
901770010 1:11525223-11525245 AGGGAGAGCCTGTAGACAGCGGG - Exonic
907372892 1:54014445-54014467 GGGGAGAGGCTGCTTGCAGCGGG - Intronic
908093015 1:60706624-60706646 AGAGAGAATCTGTATGCATGGGG + Intergenic
908439243 1:64136904-64136926 GGTGAGAAGCTGGGTGCAGCTGG - Intronic
908886960 1:68800376-68800398 AGTGAGTAGCTGTCTGCAACAGG + Intergenic
909146781 1:71944400-71944422 AGGGATAAGGTGTATGTACCTGG - Intronic
910879028 1:91905868-91905890 AGGAAGAAGCTATCTGCAGATGG - Intronic
912474330 1:109925922-109925944 AGGGAGGAGCAGTATGGAGGGGG - Intronic
912816459 1:112832653-112832675 AGGAAGGAGCTTTATTCAGCTGG - Intergenic
913972146 1:143423603-143423625 AGGGAGTGGCTCTGTGCAGCCGG + Intergenic
914066527 1:144249216-144249238 AGGGAGTGGCTCTGTGCAGCCGG + Intergenic
914112626 1:144717138-144717160 AGGGAGTGGCTCTGTGCAGCCGG - Intergenic
915320218 1:155052156-155052178 AAGCAGAGGCTGTAGGCAGCGGG + Intronic
915650124 1:157303567-157303589 AGGGAGAAGGTGCATGAAGATGG + Intergenic
919801252 1:201355950-201355972 ACTGAGGAGCTGGATGCAGCGGG - Intergenic
920380190 1:205530624-205530646 AGGGAGAAGATGGAGGCAGCTGG - Exonic
922195201 1:223353678-223353700 AGGGAGAATCTGTATCCGGAGGG + Intronic
923037341 1:230293518-230293540 AGTGAGCAGCTGAACGCAGCTGG + Intergenic
923629956 1:235643142-235643164 AGGCAGAAGCAGGAAGCAGCAGG - Intronic
1063093135 10:2885625-2885647 AGGAAAAAGCTGGATGCAACTGG - Intergenic
1065128748 10:22599649-22599671 AGGGCAAAGCTGTATGATGCAGG + Intronic
1065998917 10:31086158-31086180 AGAGGGAAGCTGTGAGCAGCAGG + Intergenic
1069191172 10:65492552-65492574 AGGAAGAAACTGCCTGCAGCTGG - Intergenic
1072853360 10:98920907-98920929 TGGACGAAGCTGTTTGCAGCAGG - Intronic
1074110174 10:110417348-110417370 AGGGAGGACCTGAATGCAGGGGG + Intergenic
1075169759 10:120102211-120102233 AGGGAGAAGCTGAATTGAGGAGG + Intergenic
1075406600 10:122199617-122199639 AGGGAGAGTCTGTAAGCACCTGG - Intronic
1075955644 10:126520649-126520671 AGGGAGCAGCTGGATACAACAGG + Intronic
1077307716 11:1875430-1875452 AGGGAGTGGCTCTGTGCAGCTGG - Intronic
1077723477 11:4650343-4650365 AGGGAGAAGCTCTAAGAAGGAGG + Intronic
1078334379 11:10451813-10451835 ATGGAAAAGCTGCCTGCAGCTGG + Intronic
1078436945 11:11333142-11333164 AGGGAAAAGCTTTATTCAGATGG - Intronic
1084412919 11:69014388-69014410 AGAGAGAGGCTGGAGGCAGCAGG + Intergenic
1084566602 11:69932166-69932188 AGGGAGCAGCAGTCTGCTGCTGG - Intergenic
1085039041 11:73316149-73316171 AGGGAGAGGCTCTATGAAGAGGG + Intronic
1088976600 11:114821812-114821834 AGGGAGCAGCTCTAGGCTGCAGG - Intergenic
1089534856 11:119154686-119154708 AGGGAGATGCTTTTTGAAGCTGG + Intronic
1091014601 11:132038840-132038862 AGGGAGACGCTGAGTGCAGGAGG - Intronic
1091240818 11:134050968-134050990 AGGGAGCAGCCGTGTGCAGGTGG + Intergenic
1091540191 12:1453420-1453442 AGGGAAAAGCTGTGTGCTTCTGG - Intronic
1092423605 12:8355340-8355362 AGGGAGGAGCTGTATGAAAGGGG + Intergenic
1092798516 12:12139108-12139130 AGGGAGAAACTGAATAAAGCAGG - Intronic
1092924106 12:13258262-13258284 AGGAAGAGGCAGTCTGCAGCTGG + Intergenic
1093173192 12:15882213-15882235 AGGGAGACGCTCTAGGCACCGGG - Intronic
1098671559 12:73235952-73235974 AGGAAGATGCTGGCTGCAGCTGG - Intergenic
1100894745 12:99168688-99168710 AGGTAAAAGCTCTAGGCAGCGGG + Intronic
1102326872 12:111993251-111993273 AGTGAAATGCTGTATGCAGGTGG + Intronic
1103039107 12:117680109-117680131 AGAGAGAAGCTGTATGCTGAGGG - Intronic
1103080537 12:118020295-118020317 AGGGAGTGGCTGTAGGCACCTGG - Intronic
1103282518 12:119771689-119771711 AAGGAGAAGCTGGAGGCAGATGG + Intronic
1104187759 12:126448987-126449009 AGGGAGCAGCTGTCTGAATCTGG - Intergenic
1104292214 12:127481225-127481247 AGGAAGAGGCTTTATTCAGCCGG - Intergenic
1104547803 12:129727985-129728007 AGAGAAAAGCTGGATACAGCCGG - Intronic
1105814293 13:24020106-24020128 AGGGAGAAGCTGTATGCAGCTGG - Intronic
1106092550 13:26610303-26610325 AGGGAGAAGGTGGCTACAGCTGG - Intronic
1106923359 13:34588380-34588402 AGGGAGAAGCTGCGTGCCCCTGG - Intergenic
1108260092 13:48647323-48647345 AGGGAAAAGCTGCATGCATAAGG + Intergenic
1108525836 13:51285290-51285312 AGGGAGAAGCTGTCCACAGTTGG - Intergenic
1108642116 13:52392798-52392820 AGGGAGTAGCTATAAGCAGTAGG + Intronic
1110761246 13:79232838-79232860 AGGGAGTAACTGGATGCAGATGG - Intergenic
1111397150 13:87678038-87678060 GGGGAGAAAGTGTAAGCAGCGGG - Exonic
1112219344 13:97472048-97472070 AGGGAGAAGTTGTGTGATGCAGG + Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113521569 13:110945810-110945832 AAGGAGATGCTGTCTGCAGAGGG - Intergenic
1117868233 14:60171350-60171372 AGGAAGGAGCTTTATTCAGCTGG - Intergenic
1120085151 14:80263478-80263500 AGTGAGAAACTGAATGCAGGGGG + Intronic
1121591489 14:95115958-95115980 TGGAAGAAGGTGTCTGCAGCAGG - Intronic
1122750206 14:103927810-103927832 TGGGAGAAGTTCTTTGCAGCCGG - Intronic
1124638961 15:31383164-31383186 AGGGAGCAGCTGTGTTCATCAGG - Intronic
1125385312 15:39130686-39130708 AGGAAGCAGCTGGATGCAGATGG + Intergenic
1125810928 15:42540530-42540552 AGGGACAAGCTGTATAAAGGAGG + Exonic
1126229900 15:46312382-46312404 TGGGAGAACCTGTATGTAGCAGG + Intergenic
1126309749 15:47302066-47302088 GGGGATAAACTGTATGCAGTAGG - Intronic
1128527514 15:68422524-68422546 AGGGGGAGGCTGGATACAGCAGG - Intronic
1129116935 15:73369626-73369648 AGGGACAAGCCGGCTGCAGCGGG + Intergenic
1130060016 15:80563007-80563029 AGGGAGAAGCTGCAGGCAGTGGG - Intronic
1130360752 15:83183393-83183415 AAGGAGAAGTTGTAGACAGCAGG - Intronic
1130509409 15:84576410-84576432 AGGAAGGAGCTTTATTCAGCTGG + Intergenic
1130560421 15:84953908-84953930 AGGGTGTAGCTGCAGGCAGCTGG + Intergenic
1132643079 16:986837-986859 AGGGAGACGCTGCATGAAACGGG - Exonic
1133051289 16:3118836-3118858 GGGGAGATGCTGTCTGCAGCTGG + Intronic
1133837564 16:9380281-9380303 TGGGAGGAGATGTATGCAGTGGG + Intergenic
1136043206 16:27596443-27596465 AGGAAGACCCTGTAGGCAGCTGG + Intronic
1136540758 16:30926567-30926589 AGGGGGACGCAGGATGCAGCTGG - Intronic
1137690451 16:50423205-50423227 AGGGACAGGCTGTTAGCAGCTGG + Intergenic
1139895299 16:70283718-70283740 AGGGACCACCTGTATGTAGCAGG + Intronic
1140843011 16:78859305-78859327 AGGGAGAAGGGGAATTCAGCAGG - Intronic
1141611699 16:85185304-85185326 AGAGAAAACCTGTGTGCAGCTGG - Exonic
1141809976 16:86369252-86369274 AGGTAAGAGCTGTATGCAGGTGG - Intergenic
1142164799 16:88580531-88580553 AGGAAAAAGCTGGAAGCAGCCGG - Intronic
1142587190 17:980666-980688 AGGGAGAAGCTGGATTAAACAGG + Intergenic
1143868953 17:9944259-9944281 AGGGAAAAGCTGTAAGGAGGAGG - Intronic
1144403888 17:14933815-14933837 ATGGAGAAGCTGTATCCAGATGG - Intergenic
1146892179 17:36513358-36513380 AGGGAAAAGCTCTATGCAAAGGG + Intronic
1146953503 17:36922503-36922525 AGGGAGCAGCTGTATGTGCCAGG - Intergenic
1148572934 17:48684980-48685002 AAAGAGCAGCTGTTTGCAGCAGG + Intergenic
1148701856 17:49592345-49592367 ATGGAGGAGCTTTAGGCAGCAGG - Intergenic
1149635884 17:58168865-58168887 AGGAAGACACTGGATGCAGCTGG - Intergenic
1150437991 17:65168840-65168862 AGGGACAAGCTGTACAGAGCTGG + Intronic
1151399288 17:73845159-73845181 ATGGAGAAGCTGTGTGATGCTGG - Intergenic
1151948222 17:77330907-77330929 AGGGACAAGCTGTGTGGGGCTGG - Intronic
1152280065 17:79379944-79379966 AGGGAGAAGCTGTACCAAGGAGG - Intronic
1152603595 17:81277833-81277855 ATGGAGCATCTGTGTGCAGCCGG + Intronic
1152935839 17:83136248-83136270 AGGGAGGAGCTGTGACCAGCAGG + Intergenic
1153557725 18:6333617-6333639 ATGGAGAAGCAGGATGCAGGTGG + Intronic
1155354073 18:24934797-24934819 AGCGAAAGGCTGTATGCACCAGG + Intergenic
1157187389 18:45552326-45552348 AAGGAGAAGGGGAATGCAGCTGG + Intronic
1157200938 18:45659023-45659045 AGGGTGAAGCTACATGCACCGGG + Intronic
1157430265 18:47619136-47619158 AGGGAGAAGCTGAGGGCTGCAGG - Intergenic
1158186747 18:54780049-54780071 AGGGAGAAGCTGTCAGGAGAGGG - Intronic
1160308216 18:77761095-77761117 AAGGAGAAGCAGGCTGCAGCAGG - Intergenic
1160436872 18:78858538-78858560 AGGGAGAAGCTTTCTGCCTCTGG - Intergenic
1160533878 18:79580964-79580986 AGGGAGAAGCTGTCTGCTGGTGG - Intergenic
1163377878 19:16944826-16944848 GGAGAGCAGCTGTTTGCAGCTGG + Intronic
1165860167 19:38905244-38905266 GTGGAGAAGCTGTACGCAGCAGG + Exonic
1166631354 19:44410457-44410479 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1202648894 1_KI270706v1_random:163157-163179 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1202649372 1_KI270706v1_random:166431-166453 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
925193928 2:1908294-1908316 AGGGAGAAGCTCATGGCAGCTGG - Intronic
927826224 2:26311848-26311870 AAGGAGATGCTGTAGTCAGCAGG + Exonic
927864526 2:26580171-26580193 GAGAAGAAGCTGTGTGCAGCAGG + Intergenic
927937583 2:27084310-27084332 AGGGAGAAGATGGATGGAACAGG - Intronic
928419280 2:31125010-31125032 AGAGAGAAGTTGCATCCAGCAGG - Intronic
930707602 2:54520041-54520063 AGGGAGCAGCTGTCAGCACCGGG + Intronic
930739386 2:54814455-54814477 AGGGAGGAGATGAATGCAGCCGG - Intronic
933935787 2:87202797-87202819 AGGAAGAGGCTCTATTCAGCTGG + Intergenic
933936142 2:87205221-87205243 AGGAAGAGGCTTTATTCAGCCGG + Intergenic
934176843 2:89584540-89584562 AGGGAGTGGCTCTGTGCAGCCGG + Intergenic
934287150 2:91658900-91658922 AGGGAGTGGCTCTGTGCAGCCGG + Intergenic
935073980 2:99722603-99722625 AGGCAGTAGCTGTAGGCAGTAGG + Intronic
936357361 2:111763033-111763055 AGGAAGAGGCTCTATTCAGCTGG - Intergenic
937584502 2:123530168-123530190 AGGGAGATGCTGTATCCACTAGG - Intergenic
938541628 2:132288041-132288063 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
940317077 2:152336503-152336525 TGGGAGAAGCGGAATGCAGGAGG - Intronic
943407764 2:187510880-187510902 AGTGAGGAGCTTTATTCAGCTGG - Intronic
944250422 2:197575425-197575447 AGGCAGAAGCAGTTTGCAGCAGG - Intronic
944352552 2:198746041-198746063 GGGGAGAAGCAGTGTGCAGCAGG + Intergenic
948332716 2:237182835-237182857 ATGGGGAAGCTGTATGCAGCTGG + Intergenic
948361308 2:237422393-237422415 AGGGAGAAGCCTTATGGAGATGG - Intronic
948621875 2:239240550-239240572 AGGGGGAACCTGCTTGCAGCAGG - Intronic
1171464712 20:25319458-25319480 AGGGAGAGGCTGAAAGCACCAGG - Intronic
1172005413 20:31815991-31816013 AGGGAGCAGCTGGCTGGAGCAGG + Intergenic
1172172401 20:32946286-32946308 AGGGAGAAGCTGGAAGCTGGTGG + Intronic
1173466455 20:43285961-43285983 GTGGAAAAGCTGTATGGAGCAGG - Intergenic
1173673127 20:44811352-44811374 AGGGTGAAGGTGTGTGCATCTGG - Intergenic
1174536467 20:51255100-51255122 ATGGAAAAGCTCGATGCAGCAGG - Intergenic
1175295574 20:57906661-57906683 AGAGAGAGGGTGCATGCAGCTGG - Intergenic
1175319158 20:58073262-58073284 AGGGAGACCCTGTACACAGCAGG + Intergenic
1175348642 20:58301725-58301747 AAGGAAGAGCTGTATGCAGGAGG + Intergenic
1175546294 20:59780184-59780206 TGGGAGAAGCTGTCTGCAGGAGG - Intronic
1175660418 20:60807935-60807957 AGTGAGGAGCTGTATCCATCTGG - Intergenic
1176602449 21:8806115-8806137 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1176602928 21:8809384-8809406 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1176611894 21:8991218-8991240 AGGGAGAAGCTGGCTGAGGCAGG - Intergenic
1177198246 21:17925363-17925385 TGGGTGAAGATGTATGCACCTGG + Intronic
1177375865 21:20270331-20270353 AGGAAGAGGCTTTATTCAGCCGG + Intergenic
1177821049 21:26031341-26031363 AGAGAGAAGCTGCATGCTTCTGG + Intronic
1178980394 21:37258574-37258596 AGGCAGAAGGTGTAGGCTGCAGG + Intronic
1179269278 21:39837799-39837821 AGGGAGAAGCTGTGTGTCCCTGG + Intergenic
1179468760 21:41596703-41596725 ACCGAGAAGCTGGAAGCAGCAGG + Intergenic
1179668993 21:42932359-42932381 AGGGAGTGGCTGTAATCAGCTGG - Intergenic
1179669624 21:42937476-42937498 AGGGAGTGGCTGTAATCAGCTGG - Intergenic
1180138408 21:45876055-45876077 AGTGGGAAGCTGAACGCAGCAGG - Intronic
1180146952 21:45926915-45926937 GGGGAGAAGATCTGTGCAGCAGG + Intronic
1180344734 22:11697668-11697690 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180345214 22:11700941-11700963 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180352557 22:11816662-11816684 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180352994 22:11819182-11819204 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180385698 22:12175695-12175717 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180958968 22:19754164-19754186 GGGGACCAGCTGTATGCGGCTGG + Intergenic
1182548109 22:31087117-31087139 ACGGAGGATCTGTATGTAGCAGG + Intronic
1182550001 22:31095760-31095782 AAGGAGCAGCTGGATCCAGCAGG - Intronic
1182609749 22:31537294-31537316 AGGCAGAAGCAGAATGCAGTGGG - Intronic
1182780579 22:32864282-32864304 GGGGAGGAGCTCTAAGCAGCAGG - Intronic
1182797445 22:33001040-33001062 TGGGAGAAGCTGTATGTTGGTGG + Intronic
1184106313 22:42369253-42369275 CGGGCGAAGCTGGCTGCAGCGGG + Intergenic
953136392 3:40185828-40185850 CAGGAGAAGCTGTAGACAGCAGG + Intronic
955343499 3:58143696-58143718 AGGGAGCAGCTCTCGGCAGCAGG + Intronic
957021796 3:75136514-75136536 AGGAAGAGGCTTTATTCAGCTGG - Intergenic
960739561 3:120818049-120818071 AGATAGAAGCTGTATGCTACAGG + Intergenic
962845967 3:139274164-139274186 AGGGAGGAGCTGCATGGGGCTGG - Intronic
963709087 3:148725777-148725799 AGGGAGAACCTGTCTCCGGCCGG - Intronic
965604563 3:170485515-170485537 AGGGGGATGTTGGATGCAGCTGG + Intronic
967031848 3:185615299-185615321 ATGGTGAAGCTGTGTGCAGTGGG + Intronic
968047441 3:195632020-195632042 AGGGAGGAGCTGTGTGAACCTGG - Intergenic
968307172 3:197657904-197657926 AGGGAGGAGCTGTGTGAACCTGG + Intergenic
969342417 4:6550416-6550438 AGGGTGAAGTTCTGTGCAGCTGG - Intronic
969574739 4:8030299-8030321 CAGGAGCAGCTGTTTGCAGCAGG + Intronic
970905056 4:21205956-21205978 AGGCAGAACCTGAATGCAGATGG - Intronic
971346319 4:25815084-25815106 AGGGAGAAGAGGAAGGCAGCTGG + Intronic
972652230 4:41029268-41029290 AGGGAGAAGCTAAATAAAGCTGG + Intronic
973375099 4:49280976-49280998 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973375998 4:49286998-49287020 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973376923 4:49293161-49293183 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973377843 4:49299316-49299338 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973378787 4:49305596-49305618 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973379431 4:49310058-49310080 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973380304 4:49316054-49316076 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973381227 4:49322220-49322242 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973382312 4:49329265-49329287 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973385851 4:49513877-49513899 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
976100430 4:81556717-81556739 AGGCAGATTCTGTAAGCAGCAGG - Intronic
978469964 4:109054781-109054803 AGGACGAAGCTGTTTGCAGATGG + Intronic
981046702 4:140271402-140271424 AGACAGAAGTTGGATGCAGCTGG + Intronic
984937052 4:184898549-184898571 TGGGAGAAGCTGAGGGCAGCAGG + Intergenic
985744169 5:1637144-1637166 AGGGAGGAGCTGTGTGAACCTGG + Intergenic
986531460 5:8740792-8740814 AGGGAGAGTCTGTATGGAGTGGG - Intergenic
991042131 5:62187242-62187264 AGGGAAATGCTGGATGCTGCAGG + Intergenic
991422941 5:66459978-66460000 AGGAAGAAGGTGTATACAGTAGG - Intergenic
992016993 5:72585492-72585514 TGGGAGAACCAGTATGCAGGAGG - Intergenic
995543667 5:113208410-113208432 ACCCAGAAGCTGTGTGCAGCTGG + Intronic
996224866 5:120979664-120979686 ATGGGGAGGCTGTATGAAGCAGG + Intergenic
997749264 5:136328883-136328905 AGGTAGAAGGTGCAGGCAGCAGG + Intronic
998007891 5:138669309-138669331 AAAGAGAAGCTGCAAGCAGCAGG + Intronic
999680677 5:154057032-154057054 AGGGTGAAGCTACATGCAGAGGG - Intronic
1000230075 5:159307619-159307641 AGGGAGAAGCTGTGTGCCTTGGG - Intergenic
1003766658 6:9244879-9244901 AGGGAGAAGGTGTATGTTCCAGG + Intergenic
1004394963 6:15239612-15239634 GGGGAGGAGCTGTATGAATCAGG - Intergenic
1006945731 6:37783486-37783508 ATGGAGAAGCTGACTCCAGCCGG + Intergenic
1007398267 6:41589555-41589577 AGGGAGAGGCTTCATGGAGCTGG + Intronic
1007733386 6:43965381-43965403 AGGAGGAAGCTGTCAGCAGCAGG - Intergenic
1010585326 6:77651144-77651166 AGGGAGAAGCTTCATGGAGGAGG + Intergenic
1011633752 6:89352303-89352325 AGGGAGAGGCTGGGTGCTGCGGG + Intronic
1013416988 6:109934124-109934146 AGGGAGAAACTGCATGAACCTGG + Intergenic
1013428262 6:110034241-110034263 AGGAAGGATCAGTATGCAGCAGG - Intergenic
1013470516 6:110460165-110460187 AGGGAGCATCAGGATGCAGCGGG - Intronic
1013646748 6:112150077-112150099 AGAGGGAAGCTGTTTACAGCTGG + Intronic
1015769623 6:136755231-136755253 AGAGAGGAGCTGGATGCGGCTGG - Intronic
1015952884 6:138571854-138571876 AGAGAGAACCTGTATTCGGCTGG + Exonic
1017905417 6:158754744-158754766 AGGTAGATTCTGTATGTAGCAGG + Intronic
1018190073 6:161302850-161302872 AGGGAGGAGCTGGATGAACCTGG + Intergenic
1018907071 6:168081705-168081727 AGGGAGAAGCTGGATGCAAAAGG + Intergenic
1019664907 7:2247039-2247061 AGGGCGAGGCTGTTTGCTGCTGG - Intronic
1019901296 7:4022589-4022611 ATGGAGAAGCTGTCTGCTGCAGG + Intronic
1020743776 7:12055439-12055461 AGGGGGAAGCAGTATTCAGCAGG - Intergenic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1023639170 7:42240549-42240571 AGGGAGAAGCTGCAAGCCACGGG - Intergenic
1024406987 7:48993178-48993200 AGGGAGTACCTGTAAGAAGCAGG - Intergenic
1025194751 7:56924062-56924084 AGGGAGACACTGTGTGCATCAGG - Intergenic
1025677201 7:63652881-63652903 AGGGAGACACTGTGTGCATCAGG + Intergenic
1025996640 7:66531518-66531540 AGGGAGGAGCTGCAGGGAGCTGG - Intergenic
1026988693 7:74570921-74570943 AGGGAGGAGCTGTGGGGAGCTGG - Intronic
1028556687 7:92133735-92133757 ACGGAGATGCTGTTGGCAGCTGG - Intronic
1029871367 7:103696546-103696568 AGGGACAAGGTATAGGCAGCTGG - Intronic
1030947728 7:115746141-115746163 GGAGAGAAGATGTATGCTGCTGG - Intergenic
1033255530 7:139798173-139798195 GGGGAGAAGATGGATGAAGCAGG + Intronic
1034965384 7:155387473-155387495 AGGGAGAGGGTGTGTGCAGCTGG + Intronic
1034985998 7:155515702-155515724 AGGGAGAAGTTGTCTGGAACTGG + Intronic
1037608036 8:20453930-20453952 AGTGAGAAGCTATATTCAGAAGG + Intergenic
1038342189 8:26695796-26695818 GGCGAGAAGGTGTCTGCAGCAGG - Intergenic
1038934736 8:32236346-32236368 AGAAGGAAGTTGTATGCAGCAGG - Intronic
1039278889 8:35960162-35960184 AGGAAGAGGCTTTATTCAGCTGG - Intergenic
1039719466 8:40147061-40147083 AGGCAGAAGCCGAATGCTGCAGG - Intergenic
1041050320 8:53927804-53927826 AAGGAGAAGATGTATGAAGCTGG + Intronic
1041712105 8:60904040-60904062 AGCAAGAACCTGTATGCTGCGGG - Intergenic
1042440003 8:68814488-68814510 AGGTAGATGCTGGATACAGCTGG - Intronic
1045114708 8:98970506-98970528 AGGGAGCAGCTATATGCTGAAGG - Intergenic
1046524616 8:115368800-115368822 AGGGAGGTGCTGTATGAAGCTGG - Intergenic
1046869826 8:119193488-119193510 AGGGAGAAGCATTTTGAAGCAGG + Intronic
1047402330 8:124557504-124557526 GGGGAGAAGCAGAAAGCAGCCGG - Intronic
1047791842 8:128211235-128211257 AGGGAGAAACTATATGAAGCTGG + Intergenic
1048317338 8:133371880-133371902 ATGGAGAAGCTGTTTCCAGTAGG + Intergenic
1048861837 8:138729545-138729567 AGAGAGAAGCTGGAAGCAGCTGG + Intronic
1050388169 9:5111770-5111792 AAGGAGAAGGTGGATGCAGCCGG - Intronic
1051201725 9:14633823-14633845 TGGCTGCAGCTGTATGCAGCGGG - Intronic
1052552233 9:29966954-29966976 AAGGAGAAGCTCTGTGGAGCTGG + Intergenic
1052730358 9:32278069-32278091 AGGAAGAAGCTGGGTGCAGCTGG - Intergenic
1053199031 9:36140342-36140364 AGGGAGAAGCTGTGTGGGCCAGG + Intronic
1053317731 9:37066441-37066463 AGGGAGTGGCTGTATGAAGAAGG + Intergenic
1053320798 9:37097004-37097026 ACTGAGAAGCTGTCTGCTGCAGG + Intergenic
1053322108 9:37107882-37107904 AGGGAGTGGCTGTATGAAGAAGG + Intergenic
1057797459 9:98169128-98169150 AGGCAGAAGCCGTCTGCAGCCGG + Intronic
1057803991 9:98207881-98207903 AGGCAGCTGCTGTCTGCAGCAGG - Intronic
1057977058 9:99616921-99616943 AGGGAGCAGAAGGATGCAGCAGG + Intergenic
1058686756 9:107487474-107487496 AGGGGGAAGTCGTGTGCAGCCGG + Exonic
1060346531 9:122821755-122821777 AGGAAGCAGCTGTGAGCAGCAGG + Intronic
1062271822 9:135713385-135713407 AGGCTGAAGCTGCAGGCAGCAGG - Intronic
1062716249 9:138011649-138011671 GGTGGGAAGCTGGATGCAGCCGG + Intronic
1203698817 Un_GL000214v1:119225-119247 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203699773 Un_GL000214v1:125523-125545 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203479507 Un_GL000224v1:113-135 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203480473 Un_GL000224v1:6409-6431 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203481440 Un_GL000224v1:12737-12759 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203482404 Un_GL000224v1:19046-19068 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203548993 Un_KI270743v1:152910-152932 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203549457 Un_KI270743v1:155639-155661 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203550415 Un_KI270743v1:161951-161973 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203569112 Un_KI270744v1:115471-115493 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203570061 Un_KI270744v1:121760-121782 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1186021658 X:5263502-5263524 AGGCAGAGGCTGTAGTCAGCCGG + Intergenic
1188605691 X:32026796-32026818 AGAGAAAAGCTGTTTGCAGATGG - Intronic
1189291296 X:39887749-39887771 GGGGAGAGGCTGGATCCAGCTGG + Intergenic
1189388116 X:40554169-40554191 AGTGAGATGCTGTATGCTCCAGG - Intergenic
1190500276 X:51069123-51069145 AGGGAAAAATTGTATGCTGCTGG + Intergenic
1194989962 X:100536817-100536839 AGGGAGAAGCTGAAAGCTGGGGG + Intergenic
1197889689 X:131256950-131256972 AGGGAGAAGTGATTTGCAGCTGG + Intergenic