ID: 1105815039

View in Genome Browser
Species Human (GRCh38)
Location 13:24027569-24027591
Sequence AACCCAAGAATGTAGAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 397}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105815039 Original CRISPR AACCCAAGAATGTAGAAGAA AGG (reversed) Intronic
901101660 1:6723826-6723848 AACCCAAGCATGCAGAGGCATGG - Intergenic
901305020 1:8226613-8226635 AACCTAAGAGGGTAGAGGAAAGG - Intergenic
902664434 1:17927630-17927652 AACCCCAGAAGCTGGAAGAATGG - Intergenic
903290199 1:22307183-22307205 AACCAAAGGAAGCAGAAGAAAGG + Intergenic
903511989 1:23882885-23882907 AACTCATGAAATTAGAAGAAGGG + Intronic
905242682 1:36591012-36591034 CACCCAAGAATGAATGAGAAAGG - Intergenic
905561839 1:38933517-38933539 ATCCCATGAATGGAGAAGGAAGG + Intronic
906060556 1:42945764-42945786 AAAACAAGAATGTACAAGAAAGG + Intronic
907466274 1:54639805-54639827 AACCAAAGAAGTCAGAAGAAAGG + Intergenic
907775826 1:57513496-57513518 AACCCAAGAAAGAAAAAGATAGG + Intronic
908075939 1:60517989-60518011 GACCCAGAAATGTAGTAGAAGGG + Intergenic
908584484 1:65553619-65553641 AAGCTAAGAATGTTGAAAAAAGG - Intronic
908666881 1:66502921-66502943 ACCCAAGGAAAGTAGAAGAAAGG + Intergenic
909178825 1:72394347-72394369 AAACCAAGAATTTAGAAGCATGG - Intergenic
909317590 1:74243448-74243470 AAGCCAAGAATGTAGAAAGAAGG - Intronic
909477842 1:76101594-76101616 AACAAAAGAAAGTAGAAGAAAGG - Intronic
910188993 1:84575452-84575474 AATCCAATAATGTAGAAAGAAGG + Intergenic
910189212 1:84577640-84577662 AATCCAATAATGTAGAAGGAAGG - Intergenic
910380114 1:86617437-86617459 AACACAAGACTGTATAAGACTGG + Intergenic
911083870 1:93960043-93960065 GTCCCAAGCATTTAGAAGAAGGG + Intergenic
912066778 1:105754903-105754925 AACTCTTGAATGTAGAGGAAGGG + Intergenic
913380292 1:118203004-118203026 AACCCAGGAATGGGGAAGTAAGG - Intergenic
914991877 1:152505784-152505806 AACCCAATTTTGTAGAAGAGAGG - Intergenic
915252592 1:154601182-154601204 AAGCCATGACTGTAGAAGGAGGG + Exonic
915707958 1:157864441-157864463 AACCCAAAATAATAGAAGAACGG + Intronic
915947911 1:160167419-160167441 AACCCACAAAGGTAGGAGAATGG + Intronic
916233121 1:162560551-162560573 CACCCAAGAAAGTAGAAGAAAGG + Intergenic
916325413 1:163553170-163553192 ACCCAAAGTATGTAAAAGAAAGG - Intergenic
916845410 1:168645138-168645160 AAAACAAAAAAGTAGAAGAAGGG - Intergenic
917101751 1:171453589-171453611 TTCCCAAAAATGTAAAAGAAGGG + Intergenic
918317040 1:183331046-183331068 AACCCCAGAAAGTAGGAGGAAGG - Intronic
918471063 1:184874231-184874253 AAGTCAAGAAAGTAGAAGAAAGG + Intronic
918701067 1:187608594-187608616 AACCCAAAATTGTTGAAGAAAGG + Intergenic
918987249 1:191648137-191648159 TTCCCAAGAATGTAGATCAAAGG + Intergenic
919000368 1:191824207-191824229 CACCAGAGAATGTACAAGAAGGG + Intergenic
919042542 1:192410029-192410051 CACCCAAGCATGTTGATGAAGGG - Intergenic
919396040 1:197049230-197049252 AATCCAAGAACATAGAAGAAAGG + Intronic
919566653 1:199197676-199197698 AAACAAAGAAAGTATAAGAAAGG + Intergenic
919881035 1:201900701-201900723 ATGCCAAGAATGGAGAGGAAAGG - Exonic
920535716 1:206735337-206735359 AACCCAAGAAGGAGGAATAAGGG + Intergenic
922030163 1:221790031-221790053 AATATAAGAATGTATAAGAAAGG - Intergenic
922073587 1:222220532-222220554 GACCTGAGAAGGTAGAAGAAAGG - Intergenic
923508437 1:234627318-234627340 AACACAAGAATAGAGAAGAGAGG - Intergenic
923902690 1:238345331-238345353 ACCCAAAGCAAGTAGAAGAAAGG - Intergenic
924615579 1:245609172-245609194 ATGCCAAGGATATAGAAGAAAGG - Intronic
1063249082 10:4254131-4254153 AACCCAAGAAGGGACAAAAATGG - Intergenic
1063752772 10:8970021-8970043 TATCCAAGAATGTAGAAGCCAGG - Intergenic
1063757715 10:9033529-9033551 AAAGCAACAATGTACAAGAATGG + Intergenic
1063875344 10:10470848-10470870 TACCACAGAAGGTAGAAGAATGG - Intergenic
1064122181 10:12629465-12629487 CACACAAGAATCTGGAAGAAAGG - Intronic
1065032128 10:21598118-21598140 AACTGATGAATGTAAAAGAAAGG - Intronic
1066452242 10:35541038-35541060 AACCAAAGTAAGTAGAAGGAAGG - Intronic
1066482438 10:35809961-35809983 TACCCAAGAAAGCAGCAGAATGG - Intergenic
1067664286 10:48261110-48261132 AAACAAAGAATGAAGAAAAATGG + Intronic
1068546307 10:58349788-58349810 AAGCTAAGAAGGGAGAAGAAAGG - Intronic
1068824731 10:61422995-61423017 AACTCAAGAATGAAAAAGGAGGG + Intronic
1069075151 10:64031359-64031381 AAACAAAGGATCTAGAAGAAAGG - Intergenic
1070763536 10:79042677-79042699 AAACCAAGAATGAAAAACAAGGG + Intergenic
1073546884 10:104356945-104356967 AACATAATAATGAAGAAGAATGG - Intronic
1074380826 10:112978987-112979009 AAACCAACAATGTAGGAGTAGGG - Intronic
1074972812 10:118554030-118554052 ACCCAAAGAAAGTAGAAGAAAGG - Intergenic
1076121808 10:127942275-127942297 AACGGAAGAATGTTGAGGAAAGG + Intronic
1076128101 10:127992082-127992104 AACCCAAGAACCTAGAGGATGGG + Intronic
1076446974 10:130522310-130522332 ACCCTAAGAAAGTAGAAGGATGG + Intergenic
1077104362 11:835643-835665 ACCCAAAGAAAGTAGAGGAAAGG - Intronic
1077132939 11:983326-983348 ACCCAAAGAAAGTAGAGGAAAGG - Intronic
1077886685 11:6392175-6392197 AACCCAGGAAGGGAAAAGAAAGG + Intronic
1078696378 11:13636414-13636436 AACCTAAGAGGGTAGAAGAAAGG + Intergenic
1078841846 11:15084279-15084301 AACCAAAGAAAAAAGAAGAAAGG - Intergenic
1079701158 11:23550413-23550435 AACCCCATAATGGAGATGAAAGG - Intergenic
1079705956 11:23618752-23618774 ACTCCATGAATGTAGAAGAATGG + Intergenic
1080345979 11:31325835-31325857 ACCACAAGATGGTAGAAGAAAGG + Intronic
1080441711 11:32300351-32300373 AAAACAAGATTGAAGAAGAAAGG - Intergenic
1081015460 11:37872838-37872860 AACCAAAGTAAGCAGAAGAAAGG - Intergenic
1082162858 11:48902314-48902336 AACTTAATAATGTAAAAGAAGGG - Intergenic
1082175256 11:49050285-49050307 AACTTAATAATGTAAAAGAAGGG - Intergenic
1082658083 11:55874717-55874739 AACAAAATAATGTAAAAGAAGGG - Intergenic
1085603321 11:77875087-77875109 AACACAATCATGGAGAAGAAAGG - Intronic
1085713290 11:78849901-78849923 GACCCCAGAATGTTGAATAAAGG - Intronic
1086361091 11:86060362-86060384 AACCCCACAATTTAGAAGAGTGG + Intronic
1086430308 11:86731013-86731035 AACCCAAGCAGGTAGAAAAAAGG + Intergenic
1086690510 11:89785798-89785820 AACTTAATAATGTAAAAGAAGGG + Intergenic
1086698021 11:89865730-89865752 AACTTAATAATGTAAAAGAAGGG - Intergenic
1086708141 11:89978758-89978780 AACTTAATAATGTAAAAGAAGGG + Intergenic
1086715287 11:90053861-90053883 AACTTAATAATGTAAAAGAAGGG - Intergenic
1087427360 11:98007156-98007178 AACAGAAGACTGAAGAAGAATGG - Intergenic
1087720199 11:101655625-101655647 AAAACAAAAATGTAGGAGAAAGG + Intronic
1087852224 11:103045324-103045346 AACACATGAATCTATAAGAAAGG + Intergenic
1088605773 11:111529763-111529785 AACACTAGACTTTAGAAGAAAGG - Intronic
1088714593 11:112537749-112537771 CACCCTAGAATTTGGAAGAAGGG - Intergenic
1088802766 11:113321247-113321269 ATGATAAGAATGTAGAAGAATGG + Intronic
1088937195 11:114414491-114414513 AACAGAAGAATGGAGAAAAAAGG - Intronic
1089616152 11:119696007-119696029 GCACCAAGAGTGTAGAAGAAGGG - Intronic
1090148315 11:124352585-124352607 AACTCAAGAAAGTAGAAGCCTGG - Intergenic
1091054364 11:132404497-132404519 AAGCCAAGAATGAAGCAGACTGG - Intergenic
1091830499 12:3546302-3546324 AACTCAAGTAAGTTGAAGAAAGG + Intronic
1093357753 12:18189699-18189721 AGCCAAAGAAAATAGAAGAATGG - Intronic
1093641468 12:21531607-21531629 TCCCCAAGAATGTGGAAGGAAGG + Exonic
1094138938 12:27160646-27160668 ACTCCAAGAATGGGGAAGAAGGG + Intergenic
1095289358 12:40459561-40459583 GACCACAGAATGTAGAAGGATGG - Intronic
1095568295 12:43651868-43651890 AACCCATCACTGGAGAAGAAAGG - Intergenic
1095840599 12:46687558-46687580 AATGCAAGAATGGAGAAAAAAGG + Intergenic
1096257076 12:50069840-50069862 AATGCAAGAATGAAGAAGCAAGG + Intronic
1096414928 12:51404781-51404803 AAGCAAAGAAAGTGGAAGAAAGG - Intronic
1097259618 12:57710512-57710534 AACCCAGAAAAGTAGAAGGAAGG - Intronic
1097480250 12:60115278-60115300 ATCACAAAAATGTAGAACAATGG - Intergenic
1098151724 12:67554611-67554633 AAGCCAAGAACCTTGAAGAAAGG - Intergenic
1098939298 12:76516564-76516586 ACCCCAAAAAAGTAAAAGAAAGG + Intronic
1099358790 12:81671319-81671341 ACAACAAGAATGGAGAAGAATGG - Intronic
1099388267 12:82046131-82046153 AACCTCAGTTTGTAGAAGAATGG - Intergenic
1099561423 12:84180475-84180497 AACGCAAGAATAAATAAGAAAGG - Intergenic
1100064992 12:90632943-90632965 AACTCAATTAAGTAGAAGAAAGG + Intergenic
1100645756 12:96528803-96528825 AACCCAAGAAAGTATAATAAAGG - Intronic
1101290065 12:103359146-103359168 AACCCAAGATTGAAGAGGATTGG - Intronic
1101313332 12:103604861-103604883 AACCCAAGCAAGCAGAAGATAGG - Intronic
1101526610 12:105537032-105537054 AAGCCAAGAAGGAGGAAGAAAGG - Intergenic
1101763257 12:107676439-107676461 AACCCAAGAATGCAGAAGTGTGG - Intergenic
1103005797 12:117419134-117419156 AATTCAGGAATGTATAAGAATGG - Intronic
1104527475 12:129537776-129537798 AAGCCAAGAATGCGGAAGCATGG + Intronic
1105815039 13:24027569-24027591 AACCCAAGAATGTAGAAGAAAGG - Intronic
1106104298 13:26720906-26720928 AATCAAAGAAAGTAGAAGTAAGG + Intergenic
1106260147 13:28059329-28059351 GCCACAAGAATGTAAAAGAAAGG + Intronic
1107142114 13:37010976-37010998 AAACCAACAAAGTAGGAGAAGGG + Intronic
1107705097 13:43094829-43094851 AACGCAAGAAATTAGAAGTATGG - Intronic
1108010838 13:46007399-46007421 AACCCAAGAAAGTGGAATCATGG + Intronic
1108427301 13:50316138-50316160 AACCAGACAATGTACAAGAAAGG + Intronic
1108988897 13:56630068-56630090 AACCCAATCAAGTGGAAGAAAGG + Intergenic
1109681682 13:65759096-65759118 AATCCAAAAAAGTGGAAGAAAGG + Intergenic
1110392352 13:74989263-74989285 TACACAAGAAAATAGAAGAATGG + Intergenic
1111752839 13:92356637-92356659 AGCCCAAGAAATTAGAAGGAGGG + Intronic
1112412340 13:99175353-99175375 AACCCAAGAAGGTAGTAGTAAGG + Intergenic
1113349568 13:109515059-109515081 AAGCCTAGAAAGTAGAAAAAAGG - Intergenic
1114247928 14:20932405-20932427 AGCCAAAGAATCAAGAAGAAGGG + Intergenic
1115631079 14:35245836-35245858 AACCCAAGAAAGAGGAAGACAGG - Intronic
1116677184 14:47920567-47920589 AACCCTAGAATGTTGTATAAAGG + Intergenic
1118083566 14:62389687-62389709 ACCCAAAGCAAGTAGAAGAAAGG - Intergenic
1118390521 14:65291729-65291751 AACCTAAGAAGGTGGAAGAATGG + Intergenic
1119449157 14:74693421-74693443 GAACCAAAAATGTAGCAGAAAGG + Intronic
1119503699 14:75153356-75153378 AAGCTAAGGATCTAGAAGAAAGG - Intronic
1119982203 14:79094259-79094281 AACCCAAGAATTCAGAAGCAAGG - Intronic
1120090018 14:80320906-80320928 ATCCCCAGAATGTAGGAAAAGGG + Intronic
1120223077 14:81757632-81757654 AACCCTAGAATGTAAAATAGTGG - Intergenic
1120343337 14:83250149-83250171 AACCCTATTATGTAGAATAAGGG - Intergenic
1121585487 14:95060356-95060378 AACCCAGGAGTGTTGGAGAAGGG + Intergenic
1121934113 14:98000975-98000997 AACAAAAGAAAGAAGAAGAAAGG - Intergenic
1124110730 15:26783292-26783314 GCCCAAAGAAAGTAGAAGAAAGG - Intronic
1124546690 15:30634937-30634959 AAGCCAATCATGTAGATGAAGGG + Intronic
1124780295 15:32624937-32624959 AAGCCAATCATGTAGATGAAGGG + Intronic
1124825193 15:33087235-33087257 AAAACAAGAATGAATAAGAAAGG + Intronic
1126479870 15:49106189-49106211 AACACCAGAAGGTAGGAGAAAGG - Intronic
1127174885 15:56343355-56343377 ACCTAAAGAAAGTAGAAGAAAGG + Intronic
1129645895 15:77432372-77432394 ACCCAAAGTAAGTAGAAGAAAGG + Intronic
1129891812 15:79076598-79076620 AAGCCAAGAAGGAAGCAGAAGGG + Intronic
1130176574 15:81577654-81577676 ACCCAAAGAAAGTAGAAGGAAGG - Intergenic
1130673371 15:85931887-85931909 AACACCAAAATGTAGAAGGAAGG - Intergenic
1130787141 15:87112259-87112281 AACCAAATACTGAAGAAGAAAGG + Intergenic
1130825548 15:87541540-87541562 AACCTATGAAAGTAGAAGGATGG + Intergenic
1133748286 16:8704052-8704074 ATCCCAAGATAGTGGAAGAAAGG - Intronic
1134781402 16:16900133-16900155 AACCCAAAATGGTAGAAGGAAGG - Intergenic
1135357373 16:21780740-21780762 CACTCAAGAATGTAGTACAAAGG + Intergenic
1135455877 16:22596856-22596878 CACTCAAGAATGTAGTACAAAGG + Intergenic
1135791511 16:25400921-25400943 ATCCCAAGAAAGTATCAGAAGGG + Intergenic
1135921727 16:26655938-26655960 AACCAATGCAAGTAGAAGAAAGG - Intergenic
1138143989 16:54592348-54592370 AACCCCACAATGGGGAAGAATGG + Intergenic
1140781585 16:78301832-78301854 ACCCCAAGAAGGTGGAAGAAAGG - Intronic
1141049345 16:80746549-80746571 ACCCCAAGAATGTAGGGCAAAGG + Intronic
1141435592 16:83998057-83998079 TACCCATGAATGGATAAGAATGG - Intronic
1141895724 16:86957570-86957592 AAGCCAAGAAAGAAGAGGAAGGG - Intergenic
1142817936 17:2442473-2442495 AACCCAAGTAAGAAGAAGAAAGG + Intronic
1144400361 17:14892607-14892629 ACACCAAGAAGGTAGAAGGAAGG + Intergenic
1146158298 17:30542868-30542890 AACTGATGAATGTAGCAGAACGG - Intergenic
1146410668 17:32581427-32581449 AACCAAAGAAAGCAGAAGAAAGG - Intronic
1146892814 17:36517637-36517659 ACCCAAAGTATGCAGAAGAAGGG - Intronic
1147657604 17:42099447-42099469 GAACCAAGAATGTAGCAGGAGGG + Intergenic
1150069066 17:62137310-62137332 AACACACGAAAGCAGAAGAACGG - Intergenic
1150667463 17:67155490-67155512 AATCCAAAAATGTATATGAAAGG + Intronic
1153495547 18:5694779-5694801 AAGCCAATAATGTAAAAAAAAGG + Intergenic
1153878173 18:9395463-9395485 AACTGATAAATGTAGAAGAAAGG - Intronic
1154973143 18:21430487-21430509 ACCCAAAGAAAGAAGAAGAAAGG - Intronic
1155586048 18:27366713-27366735 AAGATAAAAATGTAGAAGAATGG + Intergenic
1155894402 18:31305774-31305796 AAATCAAGTATGTAGAATAATGG - Intergenic
1156151416 18:34248456-34248478 AACTAAAGAAGGTAGAAAAAAGG - Intergenic
1156695855 18:39766139-39766161 AGCCTAAGCAAGTAGAAGAAAGG + Intergenic
1158604454 18:58882983-58883005 CACCCAAGAAAGGGGAAGAAGGG - Intronic
1158923458 18:62223094-62223116 ACCCAAAGTAAGTAGAAGAAAGG + Intronic
1159343041 18:67161902-67161924 AACCCAAGAATGTCTCAGCACGG - Intergenic
1159520941 18:69522656-69522678 AAATCCAGAATGTAGAAGGATGG - Intronic
1160038924 18:75326714-75326736 ACCTCAAGAATCTAGAAAAAAGG + Intergenic
1160395597 18:78569509-78569531 AACTAAAGCAAGTAGAAGAAGGG + Intergenic
1160495303 18:79370352-79370374 AGCCCAAGAACGCAGAAGAAAGG + Intronic
1166274273 19:41741184-41741206 AACCCAATAAGGGAGAAGGAAGG - Intronic
925999845 2:9321822-9321844 AACCCTAGAATTTAGGAGGAGGG + Intronic
926684881 2:15690908-15690930 AAGCCAAGGTTGTGGAAGAAAGG - Intronic
927728532 2:25448503-25448525 GAACCAAGAATGTTGAATAAGGG - Intronic
928026294 2:27741984-27742006 AAGCCAAGAAAGAAAAAGAACGG - Intergenic
928388868 2:30893416-30893438 AACAAAAGATTGTACAAGAAAGG + Intergenic
928942438 2:36740179-36740201 AACCAAAGAAAGAGGAAGAAAGG + Intronic
929927380 2:46225889-46225911 ATCCCCAGAATGATGAAGAAAGG + Intergenic
930360330 2:50369914-50369936 AATTAGAGAATGTAGAAGAAAGG + Intronic
931067328 2:58601107-58601129 AAGCAAAGTATGTAGACGAAAGG + Intergenic
931618012 2:64181137-64181159 ATACCAAGAAGGGAGAAGAAAGG - Intergenic
931654763 2:64500862-64500884 AACCCAGGAACGGAGAAGGAAGG + Intergenic
931883043 2:66587157-66587179 AAACCAAGAAAATGGAAGAAGGG + Intergenic
931983465 2:67719131-67719153 ATCCTAAGAATGCAGAAAAATGG - Intergenic
933899219 2:86837164-86837186 AACAAAATTATGTAGAAGAATGG + Intronic
934625097 2:95840707-95840729 AACTTAAAAATGTAGCAGAATGG - Intronic
934808468 2:97260570-97260592 AACTTAAAAATGTAGCAGAATGG + Intronic
934829041 2:97496624-97496646 AACTTAAAAATGTAGCAGAATGG - Intronic
935783095 2:106525010-106525032 GACCCATGTATGTAGAAGGAAGG - Intergenic
937212750 2:120286979-120287001 AACTCAATTATGTAGGAGAAAGG - Intronic
937534243 2:122866513-122866535 ATCTCAAGTATCTAGAAGAATGG + Intergenic
938632498 2:133182726-133182748 AATCCAAAGATGTAGAAGAAAGG + Intronic
939296936 2:140278618-140278640 AATCCAAGACTGTAAAAGAAAGG + Intronic
939779285 2:146424464-146424486 AACCAAAGTAAGCAGAAGAAAGG + Intergenic
939883146 2:147652423-147652445 AACCCAAGAATGGAGCAGCTAGG - Intergenic
940474622 2:154147046-154147068 AACCTAAGAATGTAGAGGAAAGG + Intronic
941101246 2:161297971-161297993 AGCCAAAGAAAGTAGAAGAGGGG - Intergenic
942784905 2:179689534-179689556 AAAACAAGAGTGTAGGAGAAAGG + Intronic
943927019 2:193798095-193798117 AACACAATATTGTAGAATAAGGG + Intergenic
945914964 2:215693940-215693962 AGCCCAAGTATGGAGAAGTAAGG + Intergenic
946260038 2:218481132-218481154 AATGCAAGTATGTAGAAAAAAGG + Intronic
946969530 2:225076347-225076369 AGCCCAAGAATGCAGAGGCAGGG + Intergenic
947285073 2:228505428-228505450 GAGCCTAGAATGTAGAAGATAGG + Intergenic
948216041 2:236233060-236233082 AACCCAATAATATATAAAAAAGG + Intronic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1169240189 20:3970721-3970743 AACAGCAGAATGGAGAAGAAAGG + Intronic
1169967648 20:11235587-11235609 ATCCCCAGAATTTAGATGAAGGG + Intergenic
1170633615 20:18085885-18085907 ACCCAAAGAAAGTTGAAGAAAGG - Intergenic
1170700965 20:18703011-18703033 AACCCAAGAAAGATGAAGACGGG - Intronic
1171039747 20:21750002-21750024 AACCCAATGAGCTAGAAGAAAGG - Intergenic
1173591117 20:44225636-44225658 AACACAAGAATGGAGAGGGATGG - Intergenic
1174227646 20:49015411-49015433 AAAACAACATTGTAGAAGAAAGG - Intronic
1174689185 20:52486326-52486348 AAGCAAAGAAGGAAGAAGAAAGG + Intergenic
1176525621 21:7865620-7865642 AACTAGAAAATGTAGAAGAATGG - Intergenic
1176783779 21:13231024-13231046 ACCCAAAGCAAGTAGAAGAAAGG - Intergenic
1177717535 21:24858706-24858728 AAGAAAAGAATGAAGAAGAAAGG + Intergenic
1177811486 21:25929317-25929339 ATGCCAAAAATGTAGAAAAAAGG + Intronic
1177825075 21:26073796-26073818 CACCTAAGAATTTAGAACAAAGG + Intronic
1178659641 21:34495633-34495655 AACTAGAAAATGTAGAAGAATGG - Intergenic
1180019822 21:45115590-45115612 AACCCAAGGATGCAGAAAAAGGG - Intronic
1181995230 22:26873757-26873779 AATGCAAGAAAGCAGAAGAAAGG - Intergenic
1182553217 22:31113248-31113270 AACTCAAAAATCTAGAAAAATGG + Intronic
1182730225 22:32483473-32483495 AAGACAAGAAAGTTGAAGAAGGG + Intronic
1182855995 22:33518115-33518137 AAGCCAAGAAGCTAGAATAATGG + Intronic
1182971022 22:34576873-34576895 AACCAGAGAAGGTAGAAAAAGGG - Intergenic
1183096895 22:35557705-35557727 CTCCCAAGAATGGAGAAGAGAGG - Intergenic
1184196647 22:42934370-42934392 AAGCCAAGAAGGGAAAAGAAGGG - Intronic
1184888562 22:47365016-47365038 AACCAGAGAATGTAGAAAAAAGG - Intergenic
1184906714 22:47492631-47492653 GACACAAGAGGGTAGAAGAAAGG - Intergenic
949891996 3:8740233-8740255 ACCACAAGAATGTGGCAGAAAGG - Intronic
950209378 3:11109393-11109415 ACCCAAAGAAGGTAGAAGAAAGG - Intergenic
951191175 3:19773245-19773267 ATCCCAAGAATGTTGGAAAAGGG + Intergenic
951549685 3:23864471-23864493 CTCCCAAGAAAGTAGAAGAAAGG - Intronic
952185842 3:30967867-30967889 AAACCAAGAAAGAAGAAGATGGG + Intergenic
953331430 3:42056653-42056675 TACCCAGAAATCTAGAAGAAAGG + Intronic
956100219 3:65760498-65760520 AACACAGGAATATAGAAGATAGG + Intronic
956282711 3:67574909-67574931 TACCAAAGAATTTAGATGAATGG + Intronic
956722490 3:72130680-72130702 AACACAAGAATGAAGAAGGCTGG - Intergenic
957566573 3:81891723-81891745 AACACAAGAATGTAGCAGAGAGG - Intergenic
958001534 3:87756353-87756375 ATCCAAAGAAAGTAGAAGGAAGG - Intergenic
958014740 3:87925808-87925830 AAGCCAAGATTGTAGAGAAATGG - Intergenic
958894193 3:99812107-99812129 AACCCAATAATTTAGGACAATGG - Intergenic
960395016 3:117126388-117126410 ATTGCAAGAATGGAGAAGAACGG + Intronic
960680264 3:120240295-120240317 ACCCAAAGTAAGTAGAAGAAAGG - Intronic
961320696 3:126072298-126072320 AACCCAAAAAAGTAGAAGGCAGG + Intronic
961630216 3:128292823-128292845 ACCCAAAGAAAGTAGAAAAAAGG - Intronic
962078056 3:132105474-132105496 AACCAAAGATAGTACAAGAAAGG - Intronic
962084912 3:132180582-132180604 ATCCCAAGACTGTACAAGCATGG + Intronic
963131113 3:141858814-141858836 AACCAGAGAAGGTAGAAGGAAGG + Intergenic
963316603 3:143765345-143765367 AACCCAAGAAGTTAGAAAATAGG - Intronic
963369785 3:144384158-144384180 AAGCAATGAATGTAGAAAAAGGG - Intergenic
963658019 3:148084163-148084185 AACCCAAAGATTTAGAAAAATGG - Intergenic
964158756 3:153619961-153619983 AACCTAAGAGGGTAGAAGAATGG + Intergenic
964176869 3:153834299-153834321 AACCCAAGTATGCAAAATAATGG - Intergenic
964937057 3:162102698-162102720 AACCCAAGAAGGTGGGAGACTGG + Intergenic
964955166 3:162345832-162345854 AACCTAAGCATATAAAAGAAGGG + Intergenic
964994441 3:162858134-162858156 AATTGAAGAATGTAGAAGAATGG + Intergenic
965435237 3:168642203-168642225 AACCCAAGGAAGTAGAATAAAGG + Intergenic
965442868 3:168737776-168737798 AACCCAAGGATATAGAAAACTGG + Intergenic
965537761 3:169841726-169841748 AAAACAAAAAAGTAGAAGAAAGG - Intronic
966265006 3:178029368-178029390 AACCCAAATATGTATAAGATGGG - Intergenic
966291325 3:178362349-178362371 AAGCCAAGAATATTGAAAAAAGG + Intergenic
966364632 3:179171410-179171432 TACCAAAGTAAGTAGAAGAAAGG + Intronic
968205697 3:196798069-196798091 ATCCAAAGTAAGTAGAAGAAAGG + Intronic
968214738 3:196879340-196879362 AACAGAAAAATGTACAAGAAAGG - Intronic
968941620 4:3641984-3642006 AACCCAAGAAAGAAAAAGATTGG - Intergenic
969247056 4:5941921-5941943 AACCCAAGAAAGACAAAGAAAGG - Intronic
969893288 4:10279530-10279552 CAGCCATGAATGTAGACGAAAGG - Intergenic
970110715 4:12635069-12635091 CAACCAGGAATATAGAAGAAAGG + Intergenic
970547313 4:17142903-17142925 AACCAAATAATGTAAAATAAAGG + Intergenic
971563911 4:28115443-28115465 AAACAAAGCATGCAGAAGAAGGG + Intergenic
971851070 4:31986949-31986971 AACCCAAGAATGGCCAGGAAGGG + Intergenic
974436344 4:61862080-61862102 CAGACAAGATTGTAGAAGAAAGG + Intronic
974696117 4:65374549-65374571 GAGCCAAGAATCTAGATGAACGG + Intronic
975042790 4:69764563-69764585 AAACCAAGTATGTAGACAAATGG - Intronic
975489490 4:74973151-74973173 AACCAAAAAATGTTAAAGAAGGG - Intronic
975550634 4:75609069-75609091 AACCTGAGAATTTAAAAGAATGG + Intronic
975568766 4:75790228-75790250 AACCCACCAAGGTAGAAAAAGGG + Exonic
976065694 4:81184728-81184750 AAACTAAGAATGTTGAAAAAGGG + Intronic
976177827 4:82373061-82373083 TGCCCAAGACTGTAGAAAAAGGG + Intronic
976317694 4:83676527-83676549 AAGTTAAGAAAGTAGAAGAATGG - Intergenic
976973614 4:91138889-91138911 AACCCCAGAATCTAAAATAAAGG - Intronic
977273577 4:94948334-94948356 AAATGAGGAATGTAGAAGAAAGG + Intronic
977288009 4:95133181-95133203 CACCCCAGAATCTAGAAAAATGG - Intronic
978773411 4:112481493-112481515 AATTCAAGATGGTAGAAGAAAGG - Intergenic
980191918 4:129535776-129535798 AACCCTAGATTATAGAATAAAGG - Intergenic
980248087 4:130273897-130273919 AATCCAAGAATGAAGAAGCAGGG + Intergenic
980667917 4:135962899-135962921 GACACTAGAATGTGGAAGAAAGG + Intergenic
980756858 4:137176004-137176026 AACCAAACAAAGGAGAAGAAAGG + Intergenic
981162861 4:141520027-141520049 CATCCAAGAATGGAGAAGTAAGG - Intergenic
981216078 4:142169755-142169777 AACCTAAGAATTTAAAAGAATGG - Intronic
981256573 4:142668061-142668083 AACCAAAGAAAGTACAAAAAAGG + Intronic
981797890 4:148618771-148618793 AACACTAGAATGCAGAAGACTGG + Intergenic
982793916 4:159623367-159623389 ACTCAAAGAATTTAGAAGAATGG + Intergenic
982881387 4:160722164-160722186 AACCAAAGTATGTAGAATAAAGG - Intergenic
983288862 4:165775089-165775111 AACCAAAGAATGTAGAAGTTAGG - Intergenic
983833878 4:172365656-172365678 AACTCACGAATTTATAAGAAGGG - Intronic
984355173 4:178649139-178649161 AACCCAATTTAGTAGAAGAAAGG - Intergenic
984972648 4:185204330-185204352 AAACCAAGAATAAAAAAGAACGG + Exonic
985266384 4:188155327-188155349 AATCCAAGAATATAGAAGGCTGG - Intergenic
986187496 5:5458608-5458630 CTCACAAGAATGTAGAAGCAAGG + Intronic
987137974 5:14917551-14917573 ACCCCAGGAGTGGAGAAGAAGGG - Intergenic
987740997 5:21908471-21908493 AACCCCAGAATGAAGACAAATGG - Intronic
988114125 5:26861801-26861823 AACCCAAAAAGCTAGAAAAAGGG - Intergenic
988399022 5:30736902-30736924 ATCCCAGGAAAGCAGAAGAAAGG - Intergenic
989129162 5:38087543-38087565 AAACCAAAAAAGTAGAAGGAAGG + Intergenic
990305672 5:54492376-54492398 AGCCTAAGAATGTTGAAGAGAGG + Intergenic
990535303 5:56715845-56715867 AAACAAAAAATGTATAAGAAAGG + Intergenic
990745712 5:58957987-58958009 AAGCCAAGAACGTTGAAAAAAGG - Intergenic
994064827 5:95526954-95526976 AACCCAACTATGAAGAATAAAGG - Intronic
994718024 5:103347267-103347289 AACCCAGAAATGTAGGGGAAGGG - Intergenic
994990051 5:106984171-106984193 AACCCAAGAAGGGAGAAGGAAGG + Intergenic
995197564 5:109389635-109389657 AACCCAAGGAAGTAGAAAGAAGG - Intronic
998992047 5:147828158-147828180 AACTCAAGAATGGAGAATAATGG - Intronic
1000773113 5:165382334-165382356 ACCCAAAGTAAGTAGAAGAAAGG + Intergenic
1001646082 5:173283347-173283369 AAACCAAGAACGTGTAAGAAAGG + Intergenic
1002132953 5:177092543-177092565 AACCCAAGGTGGGAGAAGAATGG - Intronic
1003830679 6:10007170-10007192 AACTTAACAATGTAGAAAAATGG + Intronic
1003993544 6:11513555-11513577 AAACAAAGAAAGTAGAAGGAAGG + Intergenic
1005123629 6:22420117-22420139 AACCCACTAATTCAGAAGAAGGG + Intergenic
1005340079 6:24835523-24835545 AACCCAAGGTTGTAGAGGGATGG + Intronic
1005351958 6:24945164-24945186 AACCATAGAAGGCAGAAGAAAGG + Intronic
1006264259 6:32904656-32904678 TTCCCAAGCAGGTAGAAGAAGGG + Intergenic
1006590728 6:35154121-35154143 AACCCAAGTAAGCAGAGGAAAGG - Intergenic
1009247485 6:61257188-61257210 AACTGGAAAATGTAGAAGAAAGG - Intergenic
1009798013 6:68496510-68496532 AAACCAAGTAAGTAGAAGAAAGG + Intergenic
1010335002 6:74670529-74670551 AACCCAAGACTATTGGAGAAAGG + Intergenic
1010489313 6:76454229-76454251 AAACCAAGAAAATAGAAAAATGG - Intergenic
1011050572 6:83144184-83144206 AAACCAAGAATGAAGAAGACAGG + Intronic
1011083283 6:83512170-83512192 ACCCCAGGCATCTAGAAGAACGG - Intergenic
1011223508 6:85082769-85082791 AAAACAAAAATGTGGAAGAAAGG + Intergenic
1012416149 6:99016273-99016295 AACCACAAAATCTAGAAGAAAGG - Intergenic
1013575575 6:111481879-111481901 AACACAACTATGTTGAAGAAGGG - Intronic
1013647641 6:112161341-112161363 AATCCCAGAATGTAGCACAAAGG + Intronic
1013973456 6:116047930-116047952 ACCCCAAGAATGCAGATGCAAGG + Intronic
1014127571 6:117794574-117794596 AAACCAAGGATGTAGAAGCTAGG + Intergenic
1014739586 6:125132412-125132434 GAATAAAGAATGTAGAAGAAAGG + Intronic
1016073818 6:139772692-139772714 AAAAAAAGAAGGTAGAAGAAAGG - Intergenic
1017636820 6:156452096-156452118 AACCCAAGAAAGTGGGGGAAAGG - Intergenic
1017991846 6:159495934-159495956 AACCCAGGAATATAGAGGACTGG - Intergenic
1018523872 6:164685530-164685552 ATCACAAGAAAGTGGAAGAAAGG - Intergenic
1018883445 6:167908828-167908850 AAACAAAGAATGGAGCAGAAAGG - Intronic
1018944538 6:168337870-168337892 AAAACAAGAATGTAGAAGAAAGG + Intergenic
1018959065 6:168433747-168433769 AAGCCAAGAAGGCAGGAGAATGG - Intergenic
1020614776 7:10444546-10444568 AAACCAAGAATCTAGAAAATAGG + Intergenic
1021304719 7:19018673-19018695 AACCCAAGCTAGTAGAAGAAAGG + Intergenic
1021548472 7:21843231-21843253 AGCCTTAAAATGTAGAAGAAAGG + Intronic
1022113460 7:27244868-27244890 AACCCAAGAAGGGAAAATAAGGG - Intronic
1022181857 7:27928595-27928617 AACTCAAAAATGTTTAAGAAGGG - Intronic
1022319571 7:29276246-29276268 AACCTGAGAATGTAGAAAAGAGG + Intronic
1022625983 7:32036441-32036463 ACCCAAAGTAAGTAGAAGAAAGG + Intronic
1023500175 7:40840674-40840696 AACCCAAGCAAGTAAAAGGAAGG + Intronic
1024565382 7:50676019-50676041 AATCTAAAAATGCAGAAGAAAGG - Intronic
1024839677 7:53571116-53571138 AATACAAGAATTTATAAGAAAGG - Intergenic
1026615278 7:71896956-71896978 AACACAAAAATGTAGAATATAGG - Intronic
1028945343 7:96573597-96573619 AACCCTAAAAGGTAGAAGAGAGG - Intronic
1029543917 7:101200491-101200513 AAGACAAGAAGGGAGAAGAAAGG + Exonic
1030849916 7:114471041-114471063 AACGTAGGAATGCAGAAGAATGG - Intronic
1030891110 7:115000770-115000792 AACGCCAGGATGCAGAAGAATGG + Intronic
1033723680 7:144088310-144088332 AACTCAAAAATCCAGAAGAACGG - Intergenic
1034347302 7:150395311-150395333 ACCCAAAGGAAGTAGAAGAACGG - Intronic
1037226874 8:16603019-16603041 AACCCACGAATATATTAGAACGG + Intergenic
1038218102 8:25581533-25581555 ATGCCAAGACTCTAGAAGAATGG - Intergenic
1038823054 8:30970722-30970744 CACCGAAGCAAGTAGAAGAATGG + Intergenic
1038877965 8:31572952-31572974 AAACCAAGAGGGTAGAAGAGAGG + Intergenic
1041864751 8:62558711-62558733 AACCCAAGTGTGCAGGAGAAAGG - Intronic
1042395692 8:68289783-68289805 AACCCACCAATGTAAAACAAAGG + Intergenic
1043352717 8:79379489-79379511 AACCAAAGTAAGTAGAAGAAAGG + Intergenic
1044219620 8:89654198-89654220 AATCCAACAATGTATAAAAATGG + Intergenic
1044603655 8:94030712-94030734 AACCTAAGCATGAAGAATAAAGG - Intergenic
1044695710 8:94920564-94920586 AACCCCAGTATGCAGTAGAAGGG + Intronic
1045564742 8:103302122-103302144 AACCTAAGTCTATAGAAGAAAGG + Intronic
1045973481 8:108105048-108105070 AAGCTAAGAATCTTGAAGAAAGG + Intergenic
1046119232 8:109824239-109824261 AACTGAATAATCTAGAAGAATGG - Intergenic
1046232527 8:111375814-111375836 AAAAGAAGAATGTAGATGAATGG + Intergenic
1046238586 8:111461031-111461053 GACCCAAAAATGAAGAAGATTGG - Intergenic
1046369325 8:113280682-113280704 AACCAAAGCCGGTAGAAGAAAGG - Intronic
1047568289 8:126070578-126070600 AAACCGAGAATGTGGAAGAGGGG + Intergenic
1048470890 8:134703283-134703305 AACAGAAGAATGTATAAAAATGG - Intronic
1048698018 8:137050236-137050258 AACCCAAGAATGAAGAGGAAGGG - Intergenic
1048721042 8:137325458-137325480 AACCCTGGAACTTAGAAGAAGGG + Intergenic
1049559426 8:143301543-143301565 AAACCAAGAAAGAGGAAGAAGGG + Intergenic
1051495171 9:17713430-17713452 AACCAAAGCAAGCAGAAGAAAGG - Intronic
1052528373 9:29650688-29650710 AAAGCAAGAATGTAGAGGGATGG + Intergenic
1052763941 9:32621194-32621216 AACACAAGAATAAAGAAGTATGG + Intergenic
1055537735 9:77267066-77267088 AACCTAAGAGTGTTGAAAAAAGG - Intronic
1056252812 9:84768008-84768030 AACCTAAGAATGGAAAATAAGGG + Intronic
1056785242 9:89587875-89587897 ACCCCAAATATGCAGAAGAAAGG + Intergenic
1058185367 9:101848368-101848390 AACCCCAGAAAGGTGAAGAATGG - Intergenic
1058488712 9:105470857-105470879 AACAAAACACTGTAGAAGAAAGG + Intronic
1059189955 9:112315883-112315905 ATTCCAAGAAAGTAGAAGGAAGG - Intronic
1062604346 9:137338480-137338502 AACCCAAGAAAGCAAAAGGAAGG + Intronic
1186607117 X:11103747-11103769 AACCTCATAGTGTAGAAGAAAGG + Intergenic
1186957150 X:14696154-14696176 AAACCAAGAAAGGAGAAGAAGGG + Intronic
1187204000 X:17164766-17164788 ACCCAAAGAAAGCAGAAGAAAGG + Intergenic
1188209244 X:27399723-27399745 ATCACAAGAATGTGGAAAAATGG + Intergenic
1188559167 X:31448230-31448252 AACGCATGAAGGTGGAAGAAAGG + Intronic
1189426137 X:40902408-40902430 ACCTCAAGAATTTAGAAAAATGG + Intergenic
1189498845 X:41534978-41535000 AACGCAAAGATTTAGAAGAAAGG + Intronic
1189763289 X:44343940-44343962 AAAGCAAGAAAGTACAAGAAAGG - Intergenic
1190139049 X:47825425-47825447 AACCAAAGAAGGCAGAAAAAAGG + Intergenic
1190256069 X:48763170-48763192 AACCTAAGAAAGTAGAAGGAAGG + Intronic
1191708870 X:64126264-64126286 AACCCAAAGCTGTAGAAGAAAGG - Intergenic
1192549748 X:72044450-72044472 CATCCAGGAATGTAGAGGAATGG - Intergenic
1192596694 X:72416564-72416586 AACCAAAGCAAGTAGAAGGAAGG - Intronic
1192805791 X:74507379-74507401 AAACCAAGAATGTGGAGAAAAGG + Intronic
1193276934 X:79600598-79600620 AAACCATGAATCTAGAAAAAGGG - Intergenic
1193696348 X:84710825-84710847 AACCCAGGAAGGTTGTAGAATGG + Intergenic
1194467227 X:94247749-94247771 AACCAAAGAATGAACAAGAATGG - Intergenic
1194671150 X:96734210-96734232 AAAGCAAGAATGTAAATGAAGGG - Intronic
1195234624 X:102884286-102884308 ACTCCAAGAATGTACAATAATGG + Intergenic
1195269884 X:103219125-103219147 AAACCAAGAGTGAAGAAAAAGGG + Intergenic
1195789626 X:108568891-108568913 ATATGAAGAATGTAGAAGAAGGG + Intronic
1195810488 X:108824123-108824145 AAGCTAAGAATGTTGAAAAACGG - Intergenic
1195955050 X:110319352-110319374 ATCCCACGCATGTAGAAAAAAGG - Intronic
1196702743 X:118689203-118689225 ATGACAAGAATGGAGAAGAAAGG + Intergenic
1196835295 X:119808243-119808265 AACACAAGAAAGGAGAGGAAGGG + Intergenic
1196837155 X:119824021-119824043 AACACAAGAAAGGAGAGGAAGGG + Intergenic
1197003446 X:121468073-121468095 ATCCCAAGCATTTTGAAGAAAGG - Intergenic
1197360050 X:125490563-125490585 AACCTAAGAAAGAAGCAGAATGG - Intergenic
1197849361 X:130841286-130841308 AATGCCAGAATGTAGAAAAATGG - Intronic
1198480451 X:137035255-137035277 AACCCACCAATGAACAAGAATGG - Intergenic
1200316263 X:155136263-155136285 ACCCAAAGCAAGTAGAAGAAAGG + Intronic
1200557961 Y:4661793-4661815 AACCTAAGAAAGTAGAAGGGAGG + Intergenic
1201500947 Y:14642006-14642028 AAACCAAGAATGCAACAGAAAGG - Intronic
1201863622 Y:18626030-18626052 GAACCATGAATGTAGAAGATTGG - Intergenic
1201869700 Y:18694348-18694370 GAACCATGAATGTAGAAGATTGG + Intergenic