ID: 1105818708

View in Genome Browser
Species Human (GRCh38)
Location 13:24060765-24060787
Sequence AAAAATGGACAAATGCGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 642
Summary {0: 1, 1: 0, 2: 9, 3: 65, 4: 567}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105818708 Original CRISPR AAAAATGGACAAATGCGGCT GGG Intronic
900253851 1:1686486-1686508 AAAAATGAAAAAAAGAGGCTGGG + Intronic
900262848 1:1741251-1741273 AAAAATGAAAAAAAGAGGCTGGG + Intronic
900432791 1:2611006-2611028 AAATGTGGACAAAAGCCGCTGGG + Intronic
900716611 1:4149028-4149050 AAAACTGGGAAAATGGGGCTGGG + Intergenic
901046196 1:6397267-6397289 AAAAAAGTTCAAATGCTGCTTGG + Intergenic
901062482 1:6478462-6478484 TAAAATGGAGAAATAAGGCTGGG - Intronic
901089444 1:6631607-6631629 AAAAATACAAAAATTCGGCTGGG + Intronic
901185512 1:7370261-7370283 AAACATGGAACAATGCAGCTTGG + Intronic
901365418 1:8743554-8743576 AAAAATGGCCAAGTGTGGCTGGG - Intronic
901471932 1:9463130-9463152 AAAAATGGACAGATTGGGCATGG - Intergenic
902031049 1:13422518-13422540 AAAAGATGAAAAATGCGGCTGGG - Intergenic
902309512 1:15570499-15570521 AAAAATGAACAAATCTGGCATGG - Exonic
902352296 1:15865719-15865741 AAAAACAGGCAAATGTGGCTGGG - Intronic
903149392 1:21395031-21395053 AAAAACTGGCAAATGAGGCTGGG + Intergenic
904016482 1:27425381-27425403 TAAAATGGAAAAAGGGGGCTTGG - Intronic
904947606 1:34210945-34210967 AAAAATCCACAAAGGGGGCTGGG - Intronic
905003363 1:34691067-34691089 TAAAATGGACACATTGGGCTGGG + Intergenic
905073340 1:35247166-35247188 AAAAATGAGCAAATGGGGCCGGG - Intergenic
905079252 1:35302678-35302700 AAAAATAGTCAAATTAGGCTGGG - Intronic
905816806 1:40957665-40957687 AAAAATGAAAAAATGGGGCCGGG + Intergenic
905930316 1:41782436-41782458 AAAAATGGCTAAATGGGGCCGGG + Intronic
906159364 1:43636389-43636411 AAGAATGGACAAATGAAGCTAGG - Intergenic
906374440 1:45283736-45283758 AAAAATGGGCAAAGGAGTCTGGG - Intronic
906716942 1:47977365-47977387 AAAAATGGACTAACCTGGCTGGG - Intronic
906941042 1:50255622-50255644 AACAAGAGACAAAGGCGGCTGGG - Intergenic
907084549 1:51657946-51657968 AAAAATGAACAAAATTGGCTGGG + Intronic
907109486 1:51913765-51913787 AGAAATGGAGAAATAGGGCTTGG - Exonic
907938372 1:59063300-59063322 ACAAATGGACATATTAGGCTAGG - Intergenic
907996680 1:59639860-59639882 AAAAATGGATAAAAGCTACTGGG - Intronic
911353582 1:96787315-96787337 AAAAATGAACAAAAGCGGCCAGG - Intronic
911424283 1:97686973-97686995 AAAAGTGGACAAAGGAGGCCAGG + Intronic
912924305 1:113900372-113900394 AAAACTGGACCAATGGGGCCAGG - Exonic
913373470 1:118126506-118126528 AAAAATGGATAAAGGAGGCCGGG - Intronic
913552585 1:119930481-119930503 AAAAAGGCACAAAAGAGGCTGGG + Intronic
914463401 1:147905750-147905772 AAAAATAGATACATGTGGCTGGG + Intergenic
914809303 1:151015030-151015052 AAAAATGCAAAAATTTGGCTGGG + Intronic
916379593 1:164195281-164195303 AAAAATGGGCAAACGAGGATGGG + Intergenic
917839606 1:178967012-178967034 GAAAATAGAGAAATGTGGCTGGG + Intergenic
917983936 1:180295581-180295603 CAAAATGAACAAATGCTGTTGGG - Intronic
919245525 1:194978113-194978135 AAAAATACACATATGCGGCTGGG - Intergenic
920341455 1:205277662-205277684 AAAAATACAAAAATGAGGCTGGG - Intergenic
920946361 1:210532918-210532940 TATAATGGAAAAATGAGGCTTGG + Intronic
921003183 1:211065900-211065922 AAAAATGGAAAAATTAGGCATGG + Intronic
921127110 1:212187776-212187798 AAATATTGGCCAATGCGGCTGGG - Intergenic
922435710 1:225604486-225604508 AAAATTGTACAAATGTGGCCAGG + Intronic
922569824 1:226627812-226627834 GAAAATGGACTAATGCAGGTGGG - Intergenic
922884762 1:229009644-229009666 AAAAAAGAAGAAATGAGGCTGGG + Intergenic
923707822 1:236359510-236359532 AAAAATGGACTAATACAGCTGGG - Intronic
923796527 1:237162415-237162437 AAAAATGGTTAAATAGGGCTGGG + Intronic
924449035 1:244161071-244161093 AAAAATGGAAAATGGCTGCTTGG - Intergenic
1063597256 10:7447186-7447208 ACAAATGGACAAAGGCAGGTAGG - Intergenic
1064653550 10:17534337-17534359 AAAAATATACAGATGAGGCTGGG + Intergenic
1065332290 10:24614786-24614808 AAAAAAAAAAAAATGCGGCTAGG + Intronic
1065785815 10:29213683-29213705 AAAAATGGATAAATATGGCCGGG + Intergenic
1066277604 10:33884405-33884427 AAAAATAGAAAAACACGGCTCGG + Intergenic
1066489731 10:35883086-35883108 AAGAAGGGAGAAATGGGGCTGGG - Intergenic
1066674434 10:37873632-37873654 AAAAATGGATAAATGCAGTATGG - Intergenic
1066757209 10:38722972-38722994 AAACATGAACAAATGGAGCTTGG + Intergenic
1067104454 10:43356844-43356866 AAAAATGCAAAAATTAGGCTGGG + Intergenic
1067962860 10:50876041-50876063 AAACAAGGACAAAGGCGCCTAGG - Intronic
1068212953 10:53945573-53945595 AAAAATGGTTACATGGGGCTGGG - Intronic
1068439789 10:57037302-57037324 AAAAATAGACAAATGGGTTTAGG - Intergenic
1068591350 10:58856056-58856078 AAAACTGGTGAAATGCTGCTGGG + Intergenic
1068640557 10:59400715-59400737 AAAAATAGACAAATAGGACTTGG - Intergenic
1068768320 10:60790540-60790562 AAAAATAGACAAATGAGGCCAGG - Intronic
1070208632 10:74291120-74291142 AAAAATAAACAAAAGAGGCTGGG + Intronic
1071705650 10:87995454-87995476 AAAAATGGAAAATTGAGCCTTGG - Intergenic
1072254657 10:93609802-93609824 AAGAATGAACAAATGAGGCCAGG + Intergenic
1072659297 10:97353379-97353401 AAAAAAGGAAAAATGGGGCCAGG - Intergenic
1072767362 10:98106395-98106417 AGGAATGAACAAGTGCGGCTTGG - Intergenic
1072882297 10:99239723-99239745 AAAAGTTGACAAACGGGGCTGGG - Intergenic
1072883810 10:99255822-99255844 GAAAATGGACTAATGCAACTGGG - Intergenic
1074310281 10:112316495-112316517 TAAAATTAACAAATGAGGCTGGG - Intergenic
1074436647 10:113440066-113440088 GTAAATGGATAAATGTGGCTTGG - Intergenic
1074972007 10:118546858-118546880 AAAAATGAACAAAATTGGCTGGG - Intergenic
1075000236 10:118791532-118791554 AAAAATTTACAAATGCAGCCGGG + Intergenic
1075036602 10:119074636-119074658 AAAAATAGAAAAATGGGGCCGGG + Intronic
1075794775 10:125112092-125112114 AAAAAAAGTCAAATGCAGCTGGG - Intronic
1075825991 10:125357392-125357414 GAAAATGGACTAATACAGCTGGG - Intergenic
1075954043 10:126507060-126507082 AAAAAAGGATACATGGGGCTGGG + Intronic
1075988784 10:126814796-126814818 AAAAATGGGCAAATGGGGCCAGG + Intergenic
1076550417 10:131274353-131274375 AAAACTGAACAAGTGCAGCTGGG - Intronic
1077276485 11:1713150-1713172 AAAAATGGGCAAAAGGGGCCGGG + Intergenic
1077379845 11:2226293-2226315 AAAAATGGGCAAAATTGGCTGGG + Intergenic
1077596921 11:3540987-3541009 TAAAATGGATAAATTAGGCTGGG + Intergenic
1077997364 11:7465671-7465693 GAAAATGGACTAATACAGCTGGG - Intronic
1078181219 11:9012813-9012835 AAAAATGGACAGAGGAGGCTGGG - Intergenic
1078231941 11:9451628-9451650 AAGAATAGACCAATGGGGCTGGG + Intergenic
1078633639 11:13029196-13029218 AAGAATGGACAAATGGGACAAGG - Intergenic
1078746232 11:14118078-14118100 AAAAATGAACTAATGGGGGTGGG + Intronic
1079162340 11:18006692-18006714 AAAGATGGGCAACTGGGGCTTGG - Exonic
1080294735 11:30713621-30713643 CAACAAGGACAAATGCTGCTGGG - Intergenic
1080534772 11:33210961-33210983 AAAAATGGATAAAGGTAGCTAGG + Intergenic
1080831743 11:35900450-35900472 AAAAATAGAAAAATGGAGCTGGG + Intergenic
1083181901 11:60992172-60992194 AAAAATAAAAAAATGAGGCTGGG - Intronic
1083189272 11:61037665-61037687 AAAAAGGAATGAATGCGGCTAGG + Intergenic
1083643591 11:64159024-64159046 AAAAATAGAAAAATGAGGCCGGG + Intronic
1084442784 11:69184972-69184994 AAAAATACACAAATTAGGCTGGG - Intergenic
1084732916 11:71084955-71084977 AAAAATGGTCAAATGTGTATAGG - Intronic
1084732924 11:71085020-71085042 AAAAATGGTCAAATGTGTATAGG - Intronic
1084733210 11:71087922-71087944 AAAAATAGTCAAATGCAGCCAGG - Intronic
1084989974 11:72913562-72913584 AGAAATGGATAAATAGGGCTGGG - Intronic
1084990308 11:72916608-72916630 AAAAGTGAACAAAGGAGGCTGGG - Intronic
1085441945 11:76572749-76572771 AAAAGTAAACAAATGGGGCTGGG - Intergenic
1085569176 11:77544380-77544402 AAAAATAGAAAAATTAGGCTGGG + Intronic
1085624007 11:78058143-78058165 AAAAATGAATAAATCAGGCTGGG + Intronic
1085996940 11:81929239-81929261 AAAAATGAACAAAGGCGTCAAGG + Intergenic
1086082982 11:82924517-82924539 AAAAATAAACAAATGAGGCTGGG + Intronic
1086838417 11:91654162-91654184 TAAAATATACAAATGAGGCTGGG - Intergenic
1087128624 11:94650433-94650455 CAAAATGCACAAATGAGGCAAGG - Intergenic
1087927416 11:103935225-103935247 AAAGACGGACAACTGCGTCTAGG + Intronic
1088234961 11:107713425-107713447 AAAAAGGGACAGGTGTGGCTTGG - Intronic
1088381902 11:109201940-109201962 AAAAAAGGAAAAATACGGATAGG - Intergenic
1090065988 11:123503840-123503862 AAAAATGGTAAAATTTGGCTGGG - Intergenic
1091493210 12:950236-950258 GGAAATGGAGAAGTGCGGCTTGG + Intronic
1092423089 12:8349746-8349768 TAAAATGGATAAATTAGGCTGGG + Intergenic
1092676266 12:10924280-10924302 ATAGATGGAGAAATGAGGCTGGG - Intronic
1092876443 12:12852678-12852700 AAAAATAGAAAAAAGCGGCTGGG + Intergenic
1093596028 12:20960721-20960743 AAAATTGGACAAAGGAGGCTGGG + Intergenic
1094211329 12:27896248-27896270 AAAAATTTTCAAATGCGGCCAGG + Intergenic
1094701109 12:32871757-32871779 AAAAATTTAAAAATGTGGCTGGG - Intronic
1096334273 12:50741382-50741404 AAAAAGAGAGAAATGTGGCTTGG - Intronic
1096355945 12:50941145-50941167 AAAAATGAAAAAATTCAGCTGGG - Intergenic
1097653268 12:62330291-62330313 AAAAAAAAACAAATGGGGCTGGG + Intronic
1098278421 12:68837245-68837267 CAAAATGTACAAATTCAGCTGGG - Intronic
1098331924 12:69361584-69361606 AAAAATGAAGAAAAGCGGCCAGG - Intronic
1099794876 12:87387356-87387378 AAAAATTGACAAATAGAGCTAGG + Intergenic
1100031916 12:90203025-90203047 AAAAATGGAGAAATGCTAATAGG + Intergenic
1101117273 12:101544007-101544029 AAAAATGGGCAAATGGGACCAGG - Intergenic
1101129453 12:101673755-101673777 AAAAATAGATAAATTAGGCTGGG + Intronic
1101465871 12:104948920-104948942 ATAAATGAACAAATACGGCTGGG + Intronic
1102120749 12:110438926-110438948 AAAAATAGGGAAATGTGGCTGGG - Intronic
1102506991 12:113389999-113390021 GAAAATGGACAAATGAGGCCAGG - Exonic
1103078867 12:118007491-118007513 AAAAATAAACAAAGGCGGCCAGG + Intergenic
1103746609 12:123129138-123129160 AAAAAAGGAGTAATGAGGCTAGG + Intronic
1104487565 12:129164485-129164507 GAAAATGGACCAATACAGCTGGG - Intronic
1104954811 12:132459080-132459102 AAAACTGGAGAAATCGGGCTGGG - Intergenic
1105001183 12:132689844-132689866 AAAAATGGAGAAATCCGAATAGG - Intronic
1105818708 13:24060765-24060787 AAAAATGGACAAATGCGGCTGGG + Intronic
1106204923 13:27583975-27583997 AAAAATGGACAAGGGCACCTTGG + Intronic
1107177182 13:37412254-37412276 AAGAATCCACAAATGAGGCTGGG + Intergenic
1107417038 13:40210378-40210400 TAACATGGACAAATGAGGCATGG + Intergenic
1108254387 13:48596393-48596415 AAAAATGAACAAAGAAGGCTAGG - Intergenic
1109420781 13:62108761-62108783 AAAAAGGGACCAATGAGGTTGGG - Intergenic
1110697219 13:78504872-78504894 AAAAATACACATATACGGCTGGG - Intergenic
1111344197 13:86926935-86926957 AAAAATGGACTAATACAGCAGGG - Intergenic
1112556660 13:100474774-100474796 CAAAATGGACATATACGGCCAGG - Intronic
1112562286 13:100525561-100525583 AAATATGAAGAAATGCGGCCTGG - Intronic
1113236987 13:108288324-108288346 AAATATGCACAAATGCTCCTTGG + Intronic
1113817681 13:113185893-113185915 AAAAATGGAAAAATAGGGCATGG + Intronic
1114503513 14:23190106-23190128 AAAAAGAGACAAATGAGGTTGGG - Intronic
1115375743 14:32673437-32673459 ATAAATGGATGAATGCAGCTGGG + Intronic
1115656877 14:35451778-35451800 AAAAATGTACAATTAAGGCTGGG + Intergenic
1116043113 14:39710038-39710060 AAAAATGGAGAAAGGGGGCCAGG - Intergenic
1116215783 14:42015654-42015676 AAAAAGGGACAGATGTGGGTTGG - Intergenic
1116511094 14:45747702-45747724 AAAATTGAACAAACTCGGCTGGG + Intergenic
1116824513 14:49659119-49659141 AAAGATGGAAAAAAGTGGCTGGG + Intronic
1117406287 14:55407422-55407444 AAAAATGCAAAAATGAGGCCGGG - Intronic
1117747932 14:58890622-58890644 AAAAGTGAACAAAAACGGCTGGG + Intergenic
1118100889 14:62601343-62601365 AAAAATAGACAAATGGGGCTGGG + Intergenic
1118218731 14:63834931-63834953 GAAATTGGACAAATGTGGCCAGG - Intergenic
1118800032 14:69181218-69181240 AAAAATGGTTAAAAGGGGCTGGG - Intergenic
1118822245 14:69353114-69353136 CAAAAATGACAAATGAGGCTGGG - Intronic
1119239327 14:73045922-73045944 AAAAATAGATAAATTGGGCTGGG + Intergenic
1119332281 14:73803790-73803812 AAAAAAGGAAAAATACGGCCGGG + Intergenic
1119369889 14:74130571-74130593 AAAAATGGCCAATTTAGGCTAGG - Intronic
1119696203 14:76715199-76715221 AAAAATGCACACATCTGGCTGGG - Intergenic
1120610729 14:86637919-86637941 AAAAATAGACAAATCTGGCCGGG + Intergenic
1121659966 14:95627486-95627508 AAAAATGGCCAAAGCCGGCTGGG + Intergenic
1122141428 14:99665204-99665226 AAAAATGGACAATTTCGGCTGGG - Intronic
1122446348 14:101772497-101772519 AAAAATAAAGTAATGCGGCTGGG + Intronic
1122513645 14:102290480-102290502 AAAAATGAACAAAAAAGGCTTGG + Intronic
1124056755 15:26247449-26247471 AAAAATTAACAAAGGAGGCTGGG - Intergenic
1124452411 15:29807970-29807992 AAAAATGGGCAAAAGTGGCCAGG + Intronic
1125688838 15:41580213-41580235 AAAAATGCAAAAAATCGGCTGGG + Exonic
1125811362 15:42544384-42544406 AAAAATAGAAAAATGAGGCATGG + Intronic
1126069336 15:44852050-44852072 ACCAAAGGACAAATGCTGCTCGG + Intergenic
1126603022 15:50447896-50447918 AAAAATGCAAAAATTAGGCTGGG - Intronic
1126995675 15:54441170-54441192 AAAAAAAGACAAATGGGACTGGG - Intronic
1127091317 15:55470345-55470367 AAAAATGGGTAAATATGGCTGGG - Intronic
1127139022 15:55954817-55954839 AAAAATGGCAAAACTCGGCTAGG - Intronic
1127168365 15:56271843-56271865 AAAAATGTACAATTTAGGCTGGG + Intronic
1127726605 15:61756723-61756745 TAAAATGGCCAAATGGGGGTAGG - Intergenic
1128039200 15:64555367-64555389 AAAAATGAATAAATTGGGCTGGG + Intronic
1128402490 15:67298011-67298033 TAAAATGGGCAAAAGAGGCTGGG + Intronic
1130039142 15:80390029-80390051 AAAAGTGGGCAAAGGAGGCTGGG + Intronic
1130638751 15:85650472-85650494 AGAAAATGACAATTGCGGCTGGG + Intronic
1130828158 15:87570915-87570937 AAAAATGTACAAATCAGCCTGGG - Intergenic
1131085364 15:89571621-89571643 AAAAATGAACAAGTGTGGCCGGG - Intergenic
1131452731 15:92559493-92559515 AAAAATGGGCAAACAGGGCTGGG + Intergenic
1131505128 15:93011057-93011079 AAAAAAGGCCAGATGCCGCTAGG - Intronic
1131942278 15:97580284-97580306 GAAAATATACAAATGGGGCTGGG - Intergenic
1133129554 16:3668215-3668237 AAAAATAGAAAAATTAGGCTGGG - Intronic
1133202202 16:4210776-4210798 AAAAATAGAGATATGAGGCTGGG - Intronic
1133854432 16:9536412-9536434 AAAAGAAGACAAGTGCGGCTGGG + Intergenic
1134166286 16:11932480-11932502 AAAAATGCAAAAATTGGGCTGGG + Intronic
1135267619 16:21041073-21041095 AAAAAATGAGAAATGTGGCTGGG + Intronic
1135314013 16:21428555-21428577 AAAAATGCAAAAATTAGGCTGGG - Intronic
1135366937 16:21860835-21860857 AAAAATGCAAAAATTAGGCTGGG - Intronic
1135423436 16:22319692-22319714 AAAAATGTTTAAATGCGGCCAGG - Intronic
1135444878 16:22510327-22510349 AAAAATGCAAAAATTAGGCTGGG + Intronic
1136054889 16:27680988-27681010 AAAAATGAACAAAATAGGCTGGG - Intronic
1136130260 16:28215892-28215914 AAAAATACAAAAATGAGGCTGGG + Intergenic
1136138537 16:28273727-28273749 AAGAATAGACAAGTGGGGCTGGG - Intergenic
1136193599 16:28634870-28634892 AAAAATGCAAAAATTAGGCTGGG + Intergenic
1136310683 16:29407262-29407284 AAAAATGCAAAAATTAGGCTGGG - Intergenic
1136324124 16:29509044-29509066 AAAAATGCAAAAATTAGGCTGGG - Intergenic
1136438809 16:30249027-30249049 AAAAATGCAAAAATTAGGCTGGG - Intronic
1136720316 16:32314753-32314775 AAACATGAACAAATGGAGCTGGG - Intergenic
1136725369 16:32353145-32353167 AAACATGAACAAATGGAGCTGGG - Intergenic
1136838693 16:33521029-33521051 AAACATGAACAAATGGAGCTGGG - Intergenic
1136843702 16:33559203-33559225 AAACATGAACAAATGGAGCTGGG - Intergenic
1137230894 16:46566179-46566201 AAAAATGGAAAAATACAGTTGGG + Intergenic
1137630750 16:49942383-49942405 AAAAATGGGCAAAGGAGGCTGGG + Intergenic
1137666820 16:50254988-50255010 AAAAATAGACACATTGGGCTAGG + Intronic
1137741649 16:50782371-50782393 AAAAATGGAAAAAGAAGGCTTGG + Exonic
1138306831 16:55984957-55984979 AAAAAATAACAGATGCGGCTGGG - Intergenic
1138571658 16:57877938-57877960 AAAAAAGGCCAGGTGCGGCTGGG - Intergenic
1138678414 16:58668140-58668162 AAAAATAGAAAAATTAGGCTGGG + Intronic
1138820398 16:60252781-60252803 AAAAATGGAGAAGTTGGGCTGGG - Intergenic
1138995048 16:62440542-62440564 AAAAATTAACAAATGCTGGTAGG + Intergenic
1139047287 16:63077047-63077069 AAAAATGAAAAAAAGGGGCTTGG + Intergenic
1139222188 16:65194884-65194906 AAAAATAGACAAATGGGACTAGG - Intergenic
1139608024 16:68033925-68033947 AAAAATGCAAAAATTGGGCTGGG - Intronic
1139823790 16:69741078-69741100 AAAAAAGCACAGATGGGGCTGGG + Intergenic
1139933155 16:70546354-70546376 AAAAATGCATATGTGCGGCTGGG + Intronic
1203001062 16_KI270728v1_random:164609-164631 AAACATGAACAAATGGAGCTGGG + Intergenic
1203006115 16_KI270728v1_random:203016-203038 AAACATGAACAAATGGAGCTGGG + Intergenic
1203132664 16_KI270728v1_random:1701013-1701035 AAACATGAACAAATGGAGCTGGG + Intergenic
1203148858 16_KI270728v1_random:1821315-1821337 AAACATGAACAAATGGAGCTGGG - Intergenic
1203153867 16_KI270728v1_random:1859501-1859523 AAACATGAACAAATGGAGCTGGG - Intergenic
1143343321 17:6231424-6231446 AAAAATTGACAAAGGAGGCTGGG + Intergenic
1143561860 17:7701262-7701284 AAAAATACAAAAATGAGGCTGGG - Intronic
1143704785 17:8689158-8689180 AAAAATGCACAAAACCAGCTGGG - Intergenic
1144227403 17:13162990-13163012 AAAAAGGGAAAAATGCACCTGGG + Intergenic
1144280067 17:13717529-13717551 AAAAATGGGCAAAAGAGGCCAGG + Intergenic
1144325342 17:14174162-14174184 AAAAATAGACAAAAGGGGCCGGG + Intronic
1144474213 17:15571048-15571070 AAAAATAGACAAAAGGGGCCGGG + Intronic
1145000039 17:19298167-19298189 AAAAATACATAAATGAGGCTGGG - Intronic
1146114524 17:30123078-30123100 AAAAAGAGATAAATGTGGCTGGG - Intronic
1146190355 17:30760251-30760273 AAAAATGGAAAAATACGGCCAGG + Intergenic
1146335526 17:31966885-31966907 AAAAATGGAAAAATACGGCCAGG + Intronic
1147057891 17:37848206-37848228 AAAAATGGAACCATGCGGCCGGG + Intergenic
1147480424 17:40756145-40756167 AAAAATTGACAAATAAGGCCAGG + Intergenic
1147874398 17:43610860-43610882 AAAAATGCAAAAATTTGGCTGGG - Intergenic
1148453215 17:47794660-47794682 AAAAATGCAGAAATGCGGAGAGG - Intergenic
1148718041 17:49729797-49729819 AAAAATGGACTAATATGGCCAGG - Intronic
1149061483 17:52427955-52427977 AAAAAAAGACACCTGCGGCTGGG + Intergenic
1149120062 17:53151954-53151976 AAAAATAGAAAAATTCGGCTGGG + Intergenic
1149202788 17:54207420-54207442 AAAAAATAACAGATGCGGCTGGG + Intergenic
1149232309 17:54549188-54549210 AAAAATAGACAAATGAGATTAGG - Intergenic
1149260879 17:54878175-54878197 AAAAATGGACTAATACAGTTTGG + Intergenic
1149308828 17:55374487-55374509 GAAAATGGACTAATACAGCTGGG + Intergenic
1149675450 17:58456961-58456983 AAAAATGAAAAAAGGCAGCTGGG + Intronic
1149746785 17:59106633-59106655 AAAAATGGCGAAATGGGGGTAGG - Exonic
1149805033 17:59608865-59608887 AAAAATGAACAAATTAGGCCAGG - Intergenic
1151797428 17:76355642-76355664 AAAAATGCAAAAATTAGGCTGGG + Intronic
1152090860 17:78246848-78246870 AAAAATGGACAAAAGAGGCCAGG - Intergenic
1152348202 17:79767792-79767814 GAAAATGGACTAATATGGCTGGG - Intergenic
1152700552 17:81816524-81816546 AAAACTAAACAAATGAGGCTGGG + Intergenic
1153792103 18:8587889-8587911 AAAAAAGGAAAAATTAGGCTGGG - Intergenic
1153853101 18:9115559-9115581 AAAAATGGACACTTGGGGCCAGG + Intronic
1154119809 18:11642917-11642939 AAAAATGCAAAAATTAGGCTGGG - Intergenic
1154511194 18:15104452-15104474 AAAAGTGGGCAAAGGAGGCTGGG + Intergenic
1155918380 18:31578150-31578172 GAAAATGAACAAATGCAGGTGGG + Intergenic
1156336000 18:36172035-36172057 AAAAATGCCTAAATGTGGCTGGG + Intronic
1157123543 18:44934442-44934464 AAAAATGGAGAAAACAGGCTGGG - Intronic
1157628299 18:49070554-49070576 ACAAATGGGCAAAGGGGGCTTGG - Intronic
1157768584 18:50324645-50324667 TAAAAGGGACAAAGGTGGCTGGG - Intergenic
1157894589 18:51453152-51453174 TAAAATGGAGAAATGAGGGTTGG + Intergenic
1158107632 18:53903934-53903956 TAAACTGGACACATGAGGCTGGG - Intergenic
1158529217 18:58243044-58243066 AATAATCGACACATGCAGCTGGG - Intronic
1160217230 18:76942825-76942847 AATAATGGGCAAATTTGGCTGGG + Intronic
1161095342 19:2387197-2387219 AAAAATAGAAAAGTGAGGCTGGG + Intergenic
1161269071 19:3379639-3379661 AAAAAATGAAAAATGAGGCTGGG - Intronic
1161825217 19:6559056-6559078 AAAAATGCAAAAATTCGGCCAGG - Intergenic
1162038435 19:7955038-7955060 AAAAATGTAAAAATGAGGCCGGG - Intergenic
1162207020 19:9063806-9063828 AAAAATAGAGAAAGGAGGCTGGG - Intergenic
1162302685 19:9852981-9853003 GAAAATGGAAAAATTCAGCTGGG + Intergenic
1162568336 19:11456658-11456680 AAAAATTAAAAAATGTGGCTGGG - Intronic
1163016936 19:14462152-14462174 AAAAATACAAAAATTCGGCTGGG + Intronic
1163314693 19:16533813-16533835 AAAAAAAGACAAATGAGGCATGG + Intronic
1163510280 19:17730609-17730631 AAAAATGGGCAAAGGGGGCTAGG - Intronic
1164229511 19:23275167-23275189 TAAAATGTCCAAATGGGGCTGGG - Intergenic
1164495128 19:28753808-28753830 AAAAATGTAATAATGCGGCTGGG - Intergenic
1164890859 19:31821921-31821943 AAAAATAAATAAATGAGGCTGGG + Intergenic
1165356685 19:35308817-35308839 AAAAATGGTCAAATGTGGCTGGG + Intronic
1166363325 19:42265507-42265529 AAAAATACAAAAATTCGGCTGGG - Intergenic
1167083403 19:47292556-47292578 AAAAATGAATAAATGAGGCCAGG - Intronic
1167285841 19:48598593-48598615 AAAAATGGAAAACTGAGGCTTGG + Intronic
1167815687 19:51878960-51878982 AAAAATGTAATAATACGGCTGGG + Intronic
1167821250 19:51929840-51929862 CAAGATGGATAAATGTGGCTGGG - Exonic
1168090319 19:54078660-54078682 AAAAATACAAAAATGAGGCTGGG - Intronic
1168371445 19:55837738-55837760 GAAAACGGCCACATGCGGCTGGG + Intronic
925517373 2:4698344-4698366 AATAATAAAGAAATGCGGCTGGG + Intergenic
926489303 2:13504208-13504230 AAAAATACACAAATTAGGCTAGG - Intergenic
926649211 2:15323455-15323477 AAGAATGGACACATGAGGCTGGG + Intronic
927027836 2:19088272-19088294 AAAAATGGACAGATGTGAATAGG - Intergenic
927127996 2:20030916-20030938 AAAAGTGGGCAAAGGAGGCTGGG + Intergenic
927976334 2:27341329-27341351 AAAAATACACAATTGAGGCTGGG - Intronic
928095391 2:28401668-28401690 AAAAATGGCCAATTGGGGCTGGG - Intronic
930118547 2:47740852-47740874 AAAAATGAAAAAATTCAGCTGGG - Intronic
930225009 2:48783392-48783414 AAAAATGGGCAAAGGGGGCCAGG - Intergenic
930431410 2:51281201-51281223 AAAAATTGACAATTGCGGCCGGG - Intergenic
930677086 2:54214053-54214075 AAAAATGGGCAAAGATGGCTAGG - Intronic
930759367 2:55016285-55016307 AAAAATACACATATGCGGCCAGG + Intronic
931635210 2:64334349-64334371 AAGAATGGACAGAAGAGGCTTGG - Intergenic
931732024 2:65161719-65161741 ATAAATAGACAAATATGGCTGGG - Intergenic
932603908 2:73150824-73150846 AAAAATGTACAAAATTGGCTGGG - Intronic
933887748 2:86735700-86735722 AAAAATACAAAAATGTGGCTGGG - Intronic
933922429 2:87061012-87061034 AAAAATACAAAAATGTGGCTGGG + Intergenic
934320513 2:91967413-91967435 AAACATGAACAAATGGAGCTGGG + Intergenic
935267030 2:101403489-101403511 TAAAATGGACACATCAGGCTGGG + Intronic
936237000 2:110751001-110751023 AAAAATTTAGACATGCGGCTGGG + Intronic
936288950 2:111203627-111203649 ACAAATGCACAAATGGGGCCGGG - Intergenic
936312376 2:111396576-111396598 AAAAATAGTCTAATGAGGCTGGG - Intergenic
936846192 2:116836650-116836672 AAAAATGATCAAATGTTGCTTGG - Intergenic
936942154 2:117895263-117895285 TTAAATGGACAAAGGAGGCTGGG - Intergenic
937375052 2:121330539-121330561 AAAAAAGGCAAGATGCGGCTGGG + Intergenic
937411097 2:121676637-121676659 ACAAATGGTCAAATGGTGCTGGG + Intergenic
937413752 2:121698119-121698141 AAAAATAGACCAACGAGGCTAGG + Intergenic
937602738 2:123758601-123758623 AAAGATTTACAAATTCGGCTAGG - Intergenic
938300235 2:130205613-130205635 AAAAATGTAAAAATGCGGCTGGG - Intergenic
938375697 2:130804715-130804737 AAAAATGGACAAAGGAGGCCAGG + Intergenic
938456487 2:131468882-131468904 AAAAATGTAAAAATGCGGCTGGG + Intronic
938506408 2:131888911-131888933 AAAAGTGGGCAAAGGAGGCTGGG + Intergenic
939531022 2:143362086-143362108 AAAAATGAGGAAATGTGGCTAGG - Intronic
940293968 2:152103308-152103330 AAAAATGGACAAAAGTAGCAGGG + Intergenic
941085218 2:161109867-161109889 TCAAAAGGACAAATGCGGCCAGG + Intergenic
941503297 2:166308625-166308647 AAAAATGGACTAATACGGCCGGG + Intronic
941705174 2:168650593-168650615 ATAAATAGACAAAGGGGGCTGGG - Intronic
941943696 2:171071580-171071602 AAAAATGGACAAATGGGGTCAGG - Intronic
942327141 2:174785610-174785632 AGACTTGGACAAATGCTGCTTGG - Intergenic
942967898 2:181919251-181919273 AAAATTGGAAAAATGCAGTTTGG - Intronic
943363683 2:186949511-186949533 AAAAAAGTACAAATGTGGCCAGG + Intergenic
944248568 2:197558200-197558222 TAAAATGGTCAAATTCGGCCAGG - Intergenic
944259974 2:197666369-197666391 ATAAATGGAGAAATAGGGCTGGG - Intronic
944280602 2:197892202-197892224 TAAAACTGAAAAATGCGGCTGGG + Intronic
944713396 2:202355933-202355955 AAAAATGGACAAATGGGGCCAGG - Intergenic
944739556 2:202598469-202598491 AAAAATGGGCAAAAGAGGCTGGG - Intergenic
944791954 2:203140003-203140025 GAAAATACACAAAAGCGGCTGGG + Intronic
945155899 2:206837157-206837179 AAATATAGACAAATGAGGATTGG + Intergenic
945773921 2:214081238-214081260 AAAATTTGGCTAATGCGGCTTGG - Intronic
945829170 2:214762488-214762510 ACAAATGGAGACATGCAGCTTGG + Intronic
945841461 2:214892386-214892408 AAAAACTGACAAAGGGGGCTTGG - Intergenic
945923860 2:215783505-215783527 AGAAATGTGCAAATTCGGCTGGG + Intergenic
946199172 2:218061393-218061415 AAAAATGGAAAATTTTGGCTGGG - Intronic
946377425 2:219320792-219320814 AAAAATAGAAAAATTAGGCTGGG - Intergenic
947180806 2:227409726-227409748 AAAAATGGAAGAATACGGCCGGG + Intergenic
947252762 2:228126183-228126205 AAAAATGGAAAAGAGCTGCTGGG - Intronic
947868340 2:233417326-233417348 AAAAATGCACAAGGGGGGCTAGG - Intronic
948410056 2:237752406-237752428 AAAAAAGAAAAAATGCTGCTGGG + Intronic
948971595 2:241432137-241432159 AAAAATGGTCAAAATAGGCTGGG - Intronic
1169743947 20:8924352-8924374 AAAAATAGGCAAATGGGACTTGG + Intronic
1170958815 20:21006773-21006795 AAAGATGGCCAAATGCTGCTAGG - Intergenic
1170989416 20:21288196-21288218 AAAAATAGAAAAATGGGGCTGGG + Intergenic
1171814717 20:29775461-29775483 AAAAATGAACAGAGGTGGCTGGG - Intergenic
1172046612 20:32084878-32084900 AAGAATGGGGAAATGCAGCTTGG + Intronic
1173299390 20:41787849-41787871 AAAAATGGGCAAAAAGGGCTGGG - Intergenic
1173313890 20:41925983-41926005 AAAAAAGTAAACATGCGGCTGGG + Intergenic
1173874385 20:46360842-46360864 AAAAATCAACAAATGCAGCCGGG - Intronic
1174250140 20:49213221-49213243 AAAAATTGAGAAATGAGCCTGGG - Intergenic
1174345342 20:49925034-49925056 AAAAATGGGCAAAGGTGGCTGGG + Intergenic
1174610346 20:51793201-51793223 TGAAATGTACAAATGTGGCTGGG + Intronic
1174626125 20:51915933-51915955 AAAATTGTACAAAATCGGCTGGG + Intergenic
1174736560 20:52971500-52971522 CAAAATGGAGAAATGGGGCAGGG + Intergenic
1176202341 20:63867247-63867269 AAAAAAAGACAAATGAGGCTGGG - Intronic
1177985832 21:27973471-27973493 AAAAGTGGGCAAAGGAGGCTGGG - Intergenic
1179832696 21:44007650-44007672 AAAAATGAACAAAAGGGGTTTGG - Intergenic
1179903771 21:44408949-44408971 AAAAATGGGCAAAGATGGCTGGG - Intronic
1180308761 22:11151472-11151494 AAACATGAACAAATGGAGCTGGG + Intergenic
1180547238 22:16513283-16513305 AAACATGAACAAATGGAGCTGGG + Intergenic
1181141559 22:20809100-20809122 AGAAATGGAGAAATGAGACTGGG + Intronic
1182211925 22:28684051-28684073 AAACATGAACAAATGGAGCTGGG - Intergenic
1182315924 22:29447191-29447213 AAAAATGCAAAAATTAGGCTGGG - Intergenic
1182330000 22:29544979-29545001 GAAAATGGACTAATGCAGATGGG - Intronic
1182656290 22:31892761-31892783 AAAAATGGACTACTCCGTCTGGG - Intronic
1183443300 22:37836149-37836171 AAAAATGGACAAAAGAGGCCAGG + Intronic
1183682755 22:39343231-39343253 AAAAATTGACCAGTGGGGCTGGG - Intergenic
1183851885 22:40596504-40596526 AAAAATGCAAAAATTAGGCTGGG + Intronic
1183982920 22:41552969-41552991 AAAAATACAAAAATGAGGCTGGG - Intergenic
949486235 3:4541917-4541939 AAAAATAGCCTAAAGCGGCTGGG - Intronic
949871432 3:8592972-8592994 AAAAATAGAGAAATATGGCTGGG - Intergenic
950512013 3:13435496-13435518 AAAAATAGGCAAATAAGGCTGGG + Intergenic
950908101 3:16557124-16557146 TAGAATGGAGAAAAGCGGCTGGG - Intergenic
951551568 3:23880085-23880107 AAAAATGTAAAAATTAGGCTGGG + Intronic
952230917 3:31430132-31430154 AAAAAGGTACAAATGAGGCCAGG + Intergenic
952449757 3:33420780-33420802 AAAAATAGAAAAATTAGGCTGGG - Intronic
953262010 3:41348813-41348835 AAAAATGAACAAACACGGTTTGG + Intronic
954094355 3:48312701-48312723 AAAAATGGATCAATGGGGCCGGG + Intronic
954253344 3:49385509-49385531 AAAAATGGGCAATGGGGGCTGGG - Intronic
954826805 3:53380688-53380710 AAAAATGGACATTTCCAGCTGGG + Intergenic
955772707 3:62402007-62402029 AAAAATGTGAAAATGAGGCTGGG + Intronic
958478959 3:94622368-94622390 AAGAATGGAAAAATTTGGCTGGG + Intergenic
959645872 3:108700007-108700029 AAAAATGTACAAAACTGGCTGGG - Intergenic
961038680 3:123661751-123661773 AAATATGGACAACTGGGGGTGGG + Intronic
961247312 3:125466629-125466651 AAAAATGGGCAAAGGAGGCCAGG + Intronic
961900516 3:130206303-130206325 TAAAATGGATAAATTAGGCTGGG + Intergenic
961967704 3:130923510-130923532 AAAAAAGGACAAAGGAGGCCAGG - Intronic
962070441 3:132028325-132028347 AAAGATGAACAAATGATGCTAGG - Intronic
963329578 3:143899224-143899246 AAAAATGGACACATTTGGCCAGG + Intergenic
964288806 3:155152543-155152565 AAAAATGGTCACATCTGGCTGGG + Intronic
964614633 3:158649626-158649648 AAAATTGTACAAATGTGGTTTGG + Intronic
965616578 3:170599972-170599994 ACAAATGGACAAATACTGATGGG - Intronic
965936173 3:174115611-174115633 TAAAAGGTACAAATGAGGCTGGG + Intronic
966747775 3:183294921-183294943 AAAAATAGAAAAATTAGGCTGGG - Intronic
966811318 3:183847402-183847424 AAAAATGAACAAAATCAGCTGGG + Intronic
967441951 3:189518264-189518286 AAAAATGGGCACATCTGGCTGGG + Intergenic
968056168 3:195693646-195693668 AAAGATGGAGACATACGGCTGGG - Intergenic
968674019 4:1867490-1867512 AAAAATGCAAAAATTGGGCTGGG - Intergenic
969165742 4:5309868-5309890 AAAAATAGAAAAATGGGGCTGGG + Intronic
969585995 4:8093142-8093164 AAAAATGGGCAAAAGAGACTGGG - Intronic
969667506 4:8569021-8569043 AAAAATGCACTAATACGGCCTGG - Intronic
969762157 4:9195186-9195208 AAAAATGGACAGGTCTGGCTGGG - Intergenic
972549072 4:40110831-40110853 AAAAATGGGCAAAGGAGGCTGGG - Intronic
973028732 4:45308795-45308817 AAAAATGGTCAAGTGCTACTTGG - Intergenic
974923183 4:68267446-68267468 AAGAATGAACAAAGGCAGCTTGG - Intergenic
975153831 4:71048897-71048919 AAAAATTGACAAATGGGGTCTGG + Intergenic
975207215 4:71659205-71659227 AAAAAAGAACAAATGGGGTTGGG - Intergenic
975338471 4:73208914-73208936 AAAAATGAACAAAATAGGCTGGG + Intronic
976387959 4:84482286-84482308 AAAAATGGTCAAGTCCGGCCGGG + Intergenic
978808829 4:112828856-112828878 AAAAATGGGCAAAGGAGGCTGGG + Intronic
979838444 4:125404820-125404842 ACAGAAGGACAAATGCTGCTTGG - Intronic
981073226 4:140567192-140567214 AAAAGTGGACGAATGCTGCAGGG - Intronic
981196391 4:141925820-141925842 AAAAAAGTACAAATGTGGCCGGG - Intergenic
981961769 4:150549624-150549646 TAAAAGTGACAAATGAGGCTGGG - Intronic
982059959 4:151594866-151594888 AAAAAATGACAAAGGTGGCTGGG - Intronic
982342207 4:154312329-154312351 AATGATGGACAAATGCCACTGGG + Intronic
982455473 4:155604230-155604252 AGAAAAGGGCAAAAGCGGCTGGG - Intergenic
982842540 4:160209477-160209499 ACAAATGGTCAAATTCAGCTTGG - Intergenic
983079152 4:163364176-163364198 AAAAATAGGCAGATGCGGCTGGG + Intergenic
983454475 4:167945530-167945552 AAAAATGGACCAATGTGGGTGGG - Intergenic
983886494 4:172986073-172986095 AGCAATGGACAAAGGCAGCTTGG + Intronic
984022427 4:174502381-174502403 AAAAAGTGACACATGCGGCCGGG + Intronic
986217126 5:5729885-5729907 AAAAATCTACTAATGTGGCTGGG - Intergenic
987500295 5:18700433-18700455 AGAAATGGATAAATGCAACTGGG - Intergenic
989437735 5:41434393-41434415 AAAAATGTACAATTGCAACTGGG + Intronic
989679572 5:44013157-44013179 AAAAATGGAAATATGCCGCTCGG - Intergenic
991112147 5:62913120-62913142 AAAAGAGGAAAAATGTGGCTTGG - Intergenic
991388174 5:66113339-66113361 AACAATAGACAAATACGGCTGGG + Intergenic
991403896 5:66283007-66283029 TAAACTGCACAAATGGGGCTAGG - Intergenic
991671606 5:69053862-69053884 AAAAATTGACAAATCAGGCTGGG - Intergenic
992702259 5:79352650-79352672 AAAAATACACTAATGCGGCTGGG - Intergenic
992999261 5:82364062-82364084 TAAAAGGGACAAATGCATCTAGG + Intronic
993103420 5:83569975-83569997 AAAAATGTAAAAAGGAGGCTTGG + Intronic
993234475 5:85286079-85286101 TAAAATGCACACATGCGGCTGGG + Intergenic
993520902 5:88898826-88898848 AAGAATGGATAAATACAGCTGGG - Intronic
993987570 5:94615755-94615777 AAAAATGTACAAATACTTCTCGG + Intronic
996200269 5:120664001-120664023 AAAACTGGACAAATCTGGCCGGG + Intronic
996333134 5:122353826-122353848 GAAAATGGACTAATACGGCAGGG + Intronic
997132892 5:131294830-131294852 AAAAATAGAAAAATTAGGCTGGG + Intronic
997143693 5:131409885-131409907 AAAAATGGACAAATGGGGCCGGG + Intergenic
997498585 5:134352594-134352616 AAAAATGGGCAAAGGTTGCTGGG - Intronic
998248714 5:140534095-140534117 AGAAATGGAAATATGAGGCTGGG + Intronic
998259062 5:140614211-140614233 AAAAAACAACAAATGCGGCCAGG + Intergenic
1000215818 5:159154998-159155020 AAAAATGTACCATTGAGGCTGGG + Intergenic
1000861322 5:166459384-166459406 AAAAATAGATTAATGGGGCTGGG + Intergenic
1000897016 5:166867442-166867464 AAAAATGGAGAAAAGGGGCTGGG - Intergenic
1001578401 5:172780613-172780635 AAAAAAAGGCAAATGGGGCTGGG + Intergenic
1002151640 5:177237826-177237848 AAAAATGGATAAAATAGGCTGGG - Intronic
1002654667 5:180735241-180735263 AAAAATGGGCAAAGGCGGCCCGG - Intergenic
1003305194 6:4920909-4920931 AAAACTGAACAAATTTGGCTGGG - Intronic
1003612725 6:7628190-7628212 AAAAATAGACAATTGAGGCCGGG + Intergenic
1004875729 6:19951268-19951290 AAAAATAGACAAAAGAGGCTGGG - Intergenic
1005296657 6:24433788-24433810 AGAAATGTAGAAATGAGGCTGGG - Intronic
1005720914 6:28601198-28601220 AAAAATGGGCACATGTGGCCGGG - Intronic
1005982830 6:30850565-30850587 GAAAACGGACTAATACGGCTGGG + Intergenic
1006421682 6:33938426-33938448 GAAAATGGACTAATCCAGCTGGG - Intergenic
1007087790 6:39162111-39162133 AAAAATAGACAAAAAGGGCTGGG + Intergenic
1007460144 6:42012017-42012039 AAAAATGAGCTAATGCAGCTGGG - Intronic
1009376771 6:62980851-62980873 AAAGCTGGAGAAATGCAGCTGGG + Intergenic
1009906656 6:69877723-69877745 AAAAATGGGCAAAGGAGGCTGGG + Intronic
1010248644 6:73685195-73685217 AGAAATGGACAAAGCAGGCTAGG - Intergenic
1010902568 6:81445152-81445174 AAAAATGGACAAGTGTTCCTGGG - Intergenic
1011477377 6:87761282-87761304 AAAAATGGAATAATGAGGCCGGG + Intergenic
1012269737 6:97194054-97194076 AAAAATAAACAAATGAGGCCAGG - Intronic
1012283755 6:97363102-97363124 AAAAATGTACAAATGTGGCCAGG + Intergenic
1012503922 6:99922400-99922422 AAAAATGGACAAATGGGTCCGGG - Intronic
1012734598 6:102922192-102922214 AAAAATGAGCAAAAGTGGCTTGG + Intergenic
1012982491 6:105844805-105844827 AAAAATGGGCAAGTTCGGTTTGG + Intergenic
1013486776 6:110604247-110604269 AAAAATGGACTAATGCAGAAAGG + Intergenic
1014414897 6:121172037-121172059 AAAATAGGACAAATGGTGCTGGG + Intronic
1015488003 6:133793586-133793608 AAAAATTAACAAATGCTGGTGGG - Intergenic
1015604567 6:134941816-134941838 AAAAAAGGAAAAATCAGGCTGGG - Intronic
1015619096 6:135111292-135111314 AAAAATGGAAAAATGCAACATGG + Intergenic
1016148524 6:140706353-140706375 GAAAATGGACTAATATGGCTGGG + Intergenic
1016358644 6:143244807-143244829 AAAAATGTATAAATTCAGCTTGG + Intronic
1016608202 6:145959128-145959150 AAAAATAAAGTAATGCGGCTAGG - Intronic
1016817743 6:148319328-148319350 AAAAAAAGATAAATGGGGCTGGG - Intronic
1016948715 6:149559711-149559733 AAAAGTGGCCAAAGTCGGCTGGG + Intergenic
1016966430 6:149722248-149722270 AAAAAAGAAAAAATGGGGCTGGG - Intergenic
1017528729 6:155266549-155266571 AAGAATGACCAAATGAGGCTGGG + Intronic
1017620112 6:156287823-156287845 TAAAATGCACATATGGGGCTGGG + Intergenic
1017660214 6:156666802-156666824 AAAAAATGATAAAGGCGGCTGGG + Intergenic
1017752993 6:157505915-157505937 AACACTGAACAAATGCAGCTCGG + Intronic
1017806201 6:157947608-157947630 AAAAATGCAGAACTGGGGCTAGG + Intergenic
1018322109 6:162622341-162622363 AAAAATGCAAAAATTCGCCTGGG - Intronic
1018473886 6:164121764-164121786 AAAAATGGACTAATACAGCTGGG - Intergenic
1018745202 6:166756550-166756572 AAAAATGGGCAATCTCGGCTGGG + Intronic
1019130761 6:169871969-169871991 AAAAATGGACAAATGTTGGGAGG - Intergenic
1020134001 7:5575897-5575919 AAAAATAGAAAAATTTGGCTGGG + Intergenic
1021463025 7:20910482-20910504 AATAATGGACAAAGGTGGTTAGG + Intergenic
1021751491 7:23805369-23805391 TAAAAAGGAGAAATGGGGCTGGG - Intronic
1021770792 7:23998865-23998887 AAACAAGGACAAATGAGGATGGG + Intergenic
1022367582 7:29739687-29739709 AGAAATGGACAAAATAGGCTGGG + Intergenic
1022928603 7:35084177-35084199 AAAAATGGACAAAACAGGCCGGG - Intergenic
1023229544 7:38011885-38011907 AAAAATGGACAAAAGAGACATGG + Intronic
1025016508 7:55443257-55443279 AAAAACAGATAAATGTGGCTGGG + Intronic
1025059954 7:55797671-55797693 AAAAATGAAAGAATGCAGCTGGG + Intronic
1025215709 7:57054293-57054315 AAGAATGAACAAAGGCAGCTTGG - Intergenic
1025633353 7:63298973-63298995 AAAAATGGACATGTCCGGCCAGG - Intergenic
1025649343 7:63449216-63449238 AAAAATGGACATGTCCGGCCAGG + Intergenic
1025813852 7:64891839-64891861 AAAAATGGAGAAATGCACATGGG - Intronic
1025818866 7:64945096-64945118 AAAAATGGAGAAATGCACATGGG + Intergenic
1025861306 7:65332261-65332283 AAAAATGAACAAACAGGGCTGGG - Intergenic
1027023523 7:74833830-74833852 AACAATAAACAAATTCGGCTGGG - Intronic
1027064408 7:75111490-75111512 AACAATAAACAAATTCGGCTGGG + Intronic
1027388708 7:77683564-77683586 AAAAATACACAAATTAGGCTGGG - Intergenic
1027392573 7:77720057-77720079 AAAAAAGGACACATACAGCTGGG - Intronic
1028264272 7:88703829-88703851 AAAAATGGACAAATACGGCCAGG - Intergenic
1028907694 7:96173498-96173520 ATAAGTGAACAAATGCAGCTGGG - Intronic
1029247375 7:99212217-99212239 AAAAAAGGACACATGTGGATCGG - Intergenic
1029358150 7:100068240-100068262 AAAAATAGAAAAATTAGGCTTGG - Intronic
1029728053 7:102421246-102421268 AAAAATTGAAAAATGAGGCTGGG + Intronic
1029824717 7:103177855-103177877 AAAAATGGACAAAACAGGCCGGG - Intergenic
1030041970 7:105459775-105459797 AAAAATGCACAACTGGGGCCAGG + Intronic
1030250157 7:107434673-107434695 AAAAATGAACAAAATTGGCTGGG + Intronic
1030532567 7:110729176-110729198 AAAAACAGACTAATACGGCTGGG - Intronic
1031211528 7:118834837-118834859 AAAAATTGTCAGATGAGGCTGGG + Intergenic
1032034765 7:128513659-128513681 AAAAATGCAAAAATTAGGCTGGG - Intergenic
1032371829 7:131363190-131363212 AAAAATTCACAAATGCGGCCTGG - Intronic
1032567378 7:132960680-132960702 AAAAATTAACAAATGGGGCCAGG + Intronic
1032898924 7:136284181-136284203 AATAAGGGACAATTTCGGCTGGG + Intergenic
1033204590 7:139407055-139407077 AAAAATACACAAAAGTGGCTGGG - Intronic
1033305450 7:140222319-140222341 AAAAAACAACAAATTCGGCTGGG + Intergenic
1034001940 7:147424011-147424033 AAGAATGGAAGAATGTGGCTGGG + Intronic
1035433913 7:158843553-158843575 AAAAATACAAAAATGAGGCTGGG - Intergenic
1035918313 8:3649981-3650003 AAAAAATGATAAATGAGGCTGGG + Intronic
1036073458 8:5468114-5468136 AAGAATGGACGAAGCCGGCTTGG - Intergenic
1036513559 8:9422562-9422584 AAAGATGGAGAAATACGGCTGGG + Intergenic
1036844372 8:12153881-12153903 AAAAATGGGCAGATCTGGCTGGG + Intergenic
1036865744 8:12396203-12396225 AAAAATGGGCAGATCTGGCTGGG + Intergenic
1037262214 8:17022157-17022179 AAGAATGGACAGAGCCGGCTGGG + Intergenic
1037536067 8:19826061-19826083 AAAAATTTAAAAATGCAGCTAGG - Intronic
1037841563 8:22248847-22248869 AAAAAGGGACATCTGAGGCTAGG - Intronic
1037857430 8:22381843-22381865 AAAAATGGGCAAAGAAGGCTGGG + Intronic
1038139691 8:24830833-24830855 GAAAACGGACTAATGCTGCTGGG - Intergenic
1038219748 8:25596017-25596039 AAAAAGGGAAAAAGGAGGCTGGG - Intergenic
1038348726 8:26756893-26756915 AAAAATGGACACATTGGGTTTGG - Intronic
1038573093 8:28679993-28680015 AAAAAAGAACTAATGCTGCTTGG - Intronic
1038580480 8:28744497-28744519 AAAAATATACAAATTAGGCTGGG + Intronic
1038766935 8:30437493-30437515 AAAAATGCAAAAATTAGGCTGGG + Intronic
1039824656 8:41162779-41162801 ATAAATGAACAAATGAGGCCGGG - Intergenic
1042145301 8:65722083-65722105 AGAAATGGACAAAAGTGGCCAGG - Intronic
1042163134 8:65918766-65918788 AAAAATGGGCAATAGAGGCTGGG + Intergenic
1042540463 8:69902689-69902711 AAAAATAAACAAATGGGGCTGGG - Intergenic
1043050596 8:75380633-75380655 GAAAATGGACTAATGCCGCATGG + Intergenic
1043580549 8:81707632-81707654 AAAAATGGAAAAATATGGATGGG + Intronic
1044461766 8:92453757-92453779 AAAAATGGGAAAATATGGCTGGG - Intergenic
1044482432 8:92707516-92707538 AGATATGGAAAAATGTGGCTGGG + Intergenic
1044522530 8:93216008-93216030 AGAAATGGAGAAAAGGGGCTAGG + Intergenic
1044591652 8:93918059-93918081 AAAAAGGGACAAACGCGTCTTGG + Intronic
1044682460 8:94795739-94795761 AAAAATGGGCAAAGAGGGCTGGG - Intergenic
1045688699 8:104738204-104738226 AAAAATAGAAAAAAGTGGCTGGG - Intronic
1046171177 8:110508659-110508681 AAAAATGAACACATGTGGATGGG - Intergenic
1046240383 8:111482862-111482884 AAAAATGGTCAAAATGGGCTGGG - Intergenic
1047519136 8:125580947-125580969 AAAAATGGACAAATACACCTTGG - Intergenic
1049520256 8:143084486-143084508 AAAAATCGACAGATTGGGCTTGG - Intergenic
1049807028 8:144545812-144545834 TGAGAAGGACAAATGCGGCTGGG + Intronic
1049866538 8:144941950-144941972 AAAAATGGACACAAGAGGCCAGG - Intronic
1050169327 9:2799054-2799076 AAAAATTTACTAATGCGGCCAGG + Intronic
1050584669 9:7098229-7098251 AAAAATGGACAGAGGTGGCCAGG - Intergenic
1051435198 9:17023502-17023524 AAAAATGGGCAAAAGAGGCTGGG + Intergenic
1052256749 9:26466017-26466039 AAAAATGGCAACATCCGGCTAGG - Intergenic
1052683211 9:31721169-31721191 AAAAATTGGTAAATGAGGCTGGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1052893245 9:33722640-33722662 AGATAAGGACAAATGAGGCTTGG - Intergenic
1052899489 9:33779571-33779593 AAAAATGAACAAAACTGGCTGGG + Intronic
1052926238 9:34019102-34019124 AAAAAAGGACAAATAAGGCTAGG + Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1055421463 9:76147851-76147873 AAAAAAGAACAGATGTGGCTGGG - Intronic
1055792705 9:79940011-79940033 AAAAATGGAGAGATGCGATTAGG - Intergenic
1056236578 9:84600626-84600648 AAAGATGGAGAATTGAGGCTGGG - Intergenic
1056421197 9:86428026-86428048 AAAAATGGGCAAAGGAGGCCAGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057360820 9:94372601-94372623 AAAAGTAGACAAATCAGGCTGGG + Intergenic
1057662522 9:97015541-97015563 AAAAGTAGACAAATCAGGCTGGG - Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058005514 9:99909935-99909957 AAAAAAGAAGAAATGCAGCTGGG + Intronic
1058396021 9:104555485-104555507 CAAAATAGACAAATGGGGCTAGG + Intergenic
1058702679 9:107613867-107613889 AAAACTGAGCAAATGTGGCTTGG - Intergenic
1058873155 9:109219647-109219669 GAAAATGGACAAAGGTGGCCAGG - Intronic
1059645125 9:116258359-116258381 AAAAATAGACCAATGAGGCTGGG + Intronic
1059913400 9:119072079-119072101 AAAAATGAATAAACACGGCTGGG + Intergenic
1060019728 9:120118629-120118651 AAAAATGGACTAATACAGCTGGG + Intergenic
1060537725 9:124404550-124404572 AAAAATGCTCCAATGAGGCTGGG + Intronic
1060620443 9:125060835-125060857 GAAAATGGACTAATACAGCTAGG + Intronic
1060647687 9:125295725-125295747 AAAAATTAACACATGAGGCTGGG - Intronic
1061099664 9:128483186-128483208 AAAAATGCACAACTGCGGCTGGG - Intronic
1061122231 9:128650696-128650718 AAAAATACAAAAATGGGGCTGGG - Intronic
1061285137 9:129618371-129618393 AGAAATGGACAAATGATGGTGGG + Intronic
1061434732 9:130554048-130554070 AAAAATATAAAAATTCGGCTGGG + Intergenic
1203366388 Un_KI270442v1:261774-261796 AAAAATGAACAGAGGTGGCTGGG - Intergenic
1185745470 X:2569274-2569296 ATAAATGGAAAAATGCAGCCAGG - Intergenic
1186417062 X:9393053-9393075 AAAAATTAAAAAATGTGGCTGGG + Intergenic
1186576514 X:10771802-10771824 AAAAATAGATAAATGTGGCCGGG - Intronic
1187164943 X:16796296-16796318 AAAAATAAACAAGTGCGGCCGGG - Intronic
1187872519 X:23776268-23776290 AAAAATGGATGAAGGAGGCTGGG + Intergenic
1188417476 X:29953938-29953960 AAAAATGGTGAAATTCTGCTGGG + Intronic
1189777016 X:44479314-44479336 AAAAATGGAAAAATGTATCTTGG - Intergenic
1190080157 X:47350460-47350482 GAAAATGAACAAATAAGGCTGGG + Intergenic
1190091128 X:47438306-47438328 AAAAATGGGCAAAAGAGGTTGGG - Intergenic
1190724910 X:53182660-53182682 AAAAATGGGCAAAGGAGGCCAGG - Intergenic
1191629331 X:63304283-63304305 AAAAATAGGCAGATGCGGCCGGG - Intergenic
1192437136 X:71149836-71149858 AAAAATGGTGAGATGTGGCTGGG + Intronic
1193329807 X:80223389-80223411 AAAAATGGACTAATACAGTTAGG + Intergenic
1194329594 X:92564754-92564776 AAAAATGGACCAATGGGATTTGG + Intronic
1194533564 X:95078993-95079015 AAAAATTGGCAAATGCGGCAGGG - Intergenic
1194864209 X:99046191-99046213 AAAAATGGACAGATCCAGCAAGG - Intergenic
1195758349 X:108221104-108221126 AAAAATGCAGAAATGCAGCCTGG + Intronic
1195787301 X:108541130-108541152 TAACATGGTCAAATGGGGCTTGG - Intronic
1195797755 X:108670744-108670766 AAAAATGGACTAATAGGGCCGGG + Intronic
1196624625 X:117864039-117864061 AAAGAAGGAAAAATGTGGCTGGG - Intergenic
1197752592 X:129975742-129975764 AAAATTGTACAGATGAGGCTGGG - Intergenic
1198339629 X:135701317-135701339 AAAAATGGAAAAATAAGGGTAGG + Intergenic
1198626292 X:138579281-138579303 AAAAATGGACTAATACAGATGGG + Intergenic
1198738072 X:139809666-139809688 AAAAATGGTTAAATGGGGCCTGG + Intronic
1198764506 X:140066880-140066902 AAAAATGAAAAAATACAGCTGGG - Intergenic
1198982622 X:142416597-142416619 AAAAATTGACAAAAGAGCCTGGG + Intergenic
1199271588 X:145889470-145889492 AAAAATGGGCAAAAGGGGCCGGG - Intergenic
1199342922 X:146703207-146703229 AAAAATGGGCAAAATCAGCTGGG - Intergenic
1199653592 X:149972510-149972532 AAAATTGGATAAATTCAGCTTGG + Intergenic
1200638297 Y:5683947-5683969 AAAAATGGACCAATGGGATTTGG + Intronic
1200765172 Y:7074929-7074951 TAAAATGGACAAAAGGGGGTAGG + Intronic
1200819039 Y:7563372-7563394 AAAAATGAATAAATAGGGCTGGG + Intergenic
1201072301 Y:10158457-10158479 AAAAATGAACAGAGGTGGCTGGG + Intergenic
1201188017 Y:11422518-11422540 AAACATGAACAAATGGAGCTGGG + Intergenic
1201375308 Y:13312466-13312488 AAAATGGGAAAAATGTGGCTGGG + Intronic
1201751367 Y:17435638-17435660 AAAAATGGACAAGTAGGGCCAGG + Intergenic
1202358756 Y:24081317-24081339 AAAAAAGGACAATTGAGGCCAGG - Intergenic
1202512022 Y:25588796-25588818 AAAAAAGGACAATTGAGGCCAGG + Intergenic