ID: 1105823315

View in Genome Browser
Species Human (GRCh38)
Location 13:24099200-24099222
Sequence TTATCCTGCTTTATCTCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105823312_1105823315 25 Left 1105823312 13:24099152-24099174 CCAATCCATTCTCTTGAAAATCT 0: 1
1: 0
2: 0
3: 32
4: 308
Right 1105823315 13:24099200-24099222 TTATCCTGCTTTATCTCTACAGG 0: 1
1: 0
2: 4
3: 14
4: 171
1105823313_1105823315 20 Left 1105823313 13:24099157-24099179 CCATTCTCTTGAAAATCTGTGAA 0: 1
1: 0
2: 4
3: 42
4: 359
Right 1105823315 13:24099200-24099222 TTATCCTGCTTTATCTCTACAGG 0: 1
1: 0
2: 4
3: 14
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105823315 Original CRISPR TTATCCTGCTTTATCTCTAC AGG Intronic
901359216 1:8681778-8681800 TTAAACTTCTTTATTTCTACTGG - Intronic
905086299 1:35380965-35380987 TTAGCATTCATTATCTCTACAGG - Intronic
907553928 1:55328334-55328356 TCATTCAGCTTTCTCTCTACAGG + Intergenic
907611187 1:55873025-55873047 TTATTCTTCTCTTTCTCTACAGG + Intergenic
908571195 1:65412055-65412077 CTATACTGCTGTATCTCTAAAGG - Intronic
908958384 1:69664319-69664341 TTATCCAGCATTAACACTACTGG - Intronic
909030311 1:70531462-70531484 TTTTCCTGCTTTTTCACTGCAGG - Intergenic
909183472 1:72453927-72453949 TTATCATTCATTATCTCTTCAGG + Intergenic
1064964735 10:21003541-21003563 TTTTCCTTCTGTATCCCTACTGG + Intronic
1066403800 10:35100287-35100309 TTATCCTTTTTTATTTCTAGCGG - Intergenic
1067879163 10:50028971-50028993 CTCTCCTGCTTTATCTCAAGTGG - Intergenic
1070294688 10:75150492-75150514 TTTTCCTGTTTTCTCTCTACAGG + Exonic
1071913100 10:90258063-90258085 TTTTCCTTTTTTTTCTCTACTGG - Intergenic
1075842321 10:125515647-125515669 CCATCCTGCTTTGTCTCTAGCGG + Intergenic
1077244599 11:1530104-1530126 TTATCCTGCTGTAATTTTACAGG - Intergenic
1078646823 11:13148349-13148371 TTACCCTCCTTTCTCTCTGCTGG + Intergenic
1079922026 11:26444711-26444733 GTATCTTGGTTTTTCTCTACAGG + Intronic
1080021076 11:27560792-27560814 TTTTCCTGCTCTTGCTCTACGGG - Intergenic
1080161613 11:29183317-29183339 TCCTCCTGCTTTCACTCTACTGG - Intergenic
1082743396 11:56936274-56936296 TAATCCTTTTTTATCACTACTGG - Intergenic
1086784356 11:90948081-90948103 TTCTCCTTCTTGATCTCCACTGG + Intergenic
1087231965 11:95676231-95676253 TTATCCTTCCTAATTTCTACTGG - Intergenic
1087237593 11:95737422-95737444 TTAGCCAGCTTTTTCTCTCCAGG + Intergenic
1090446019 11:126765479-126765501 TCATAATGCTTTATCTCAACGGG + Intronic
1091497323 12:983837-983859 TTAACCTTCATTATCTCTTCAGG + Intronic
1092864708 12:12750053-12750075 TTATTATGCTTTGTCTCTACCGG - Intronic
1093339443 12:17953866-17953888 TTATCCTATTTTCTCTCTCCTGG + Intergenic
1093567946 12:20631102-20631124 TTTACCTCCTTTATCTTTACCGG + Intronic
1093866511 12:24233817-24233839 TTATCCAGCTTGTTCTCTCCTGG - Intergenic
1094092327 12:26663802-26663824 TTCTCCTGCTTTCTCTTTAAAGG + Exonic
1097560252 12:61195940-61195962 TTATCCTGAATTATCTCAAGAGG - Intergenic
1100393245 12:94162641-94162663 TTCACCTTCTCTATCTCTACAGG - Intronic
1101199587 12:102420767-102420789 TTCTCCTCCCTTATCTCTCCTGG + Intronic
1102723694 12:115039642-115039664 TTTTTCTGCTTTATGTCTTCAGG + Intergenic
1105823315 13:24099200-24099222 TTATCCTGCTTTATCTCTACAGG + Intronic
1110134929 13:72054987-72055009 TTTTCTTGTTTTATCTTTACTGG + Intergenic
1111681211 13:91444013-91444035 TTATCCTGTTTTTTTTCTTCAGG + Intronic
1112657194 13:101463556-101463578 TTTTCATGCTTTTTCTCTGCTGG + Intronic
1114234190 14:20810512-20810534 TTATCCTACTTTATCTTCATGGG - Intergenic
1114301020 14:21378046-21378068 TTATCCTGCTCCATCTGTATAGG - Intronic
1116484183 14:45427215-45427237 TTTTCCTGCAGTATCTCCACAGG + Intergenic
1117682199 14:58215641-58215663 TGTTCCTTCTTTTTCTCTACTGG + Intronic
1118154557 14:63226129-63226151 TTTTCCTCCTTTATTTCTTCTGG - Intronic
1118594465 14:67425010-67425032 TTCACCTGCTTTATCTTTCCGGG + Intergenic
1120918924 14:89736989-89737011 TTTTCCTGCTTTTTCACTGCAGG + Intergenic
1122521200 14:102345010-102345032 TTTTCTTTCTTTTTCTCTACAGG - Intronic
1126080439 15:44956389-44956411 TTACCATGCTTTATGTTTACAGG - Intergenic
1127109393 15:55651307-55651329 TTATTCTGCTTTTGTTCTACTGG - Intronic
1127632845 15:60842541-60842563 TGAAGCTGCTTCATCTCTACAGG - Intronic
1128407029 15:67352784-67352806 TTATCCTGCTTTGTATTTATTGG + Intronic
1134109219 16:11504154-11504176 TTATCCTGGTTTCCCTCCACTGG + Intronic
1135761742 16:25143520-25143542 TTCTACTGCTTTTTCTGTACAGG + Intronic
1148625695 17:49067410-49067432 TTATCCTGCATTCTCCCTTCGGG - Intergenic
1149167201 17:53766550-53766572 TTATACTGTTTTATTTCTATCGG + Intergenic
1149488579 17:57065136-57065158 TTATCCTGGATTATCTGTATGGG - Intergenic
1152937756 17:83150385-83150407 TCATCCTCCTTGATGTCTACAGG - Intergenic
1155859523 18:30879514-30879536 TCATCCTGTTTTATCTTTCCAGG - Intergenic
1158021667 18:52849416-52849438 TTCTCCTTCTCTAACTCTACAGG + Intronic
1158055559 18:53275890-53275912 AAATCCTGCTTTAACTCTAAAGG - Intronic
1159396934 18:67871507-67871529 TTATCTTGGTTTATCTCTAGTGG - Intergenic
1159860419 18:73641993-73642015 TAATCCTGCTTTATTTCAATTGG - Intergenic
1163368460 19:16889069-16889091 CCTTCCTGGTTTATCTCTACCGG + Exonic
925246191 2:2385502-2385524 TTTTTCTACTTAATCTCTACTGG - Intergenic
927502312 2:23591008-23591030 TTTTCCTGCTTTATTTCTCAGGG - Intronic
927905372 2:26851580-26851602 TGATCCTGCATTAGCTCCACGGG + Intronic
929523351 2:42675767-42675789 TTACCCTACATTTTCTCTACTGG + Intronic
929957519 2:46470010-46470032 ATAACCTGGCTTATCTCTACTGG - Intronic
930391881 2:50771841-50771863 GTCTACTGCTTTATCTCTAGTGG - Intronic
935292885 2:101624916-101624938 TTCTCCTTCTTTAGCTCCACTGG - Intergenic
938184123 2:129213005-129213027 TTATCCTACATTATAACTACTGG - Intergenic
938185373 2:129227186-129227208 TTATCTTGCTTTTTCTCTTATGG + Intergenic
944750488 2:202704383-202704405 TTATCCTGCATCTTCTCAACAGG - Intronic
946585670 2:221184791-221184813 TTATCCTGGGTTATCTCAGCGGG + Intergenic
948367281 2:237465196-237465218 TTCTCCTGCTTTATCCCTCCAGG + Intergenic
1168966148 20:1899301-1899323 TTATCCTGCAGCATCTCAACAGG - Intronic
1173510905 20:43627626-43627648 TTATCCATTTTTCTCTCTACTGG - Intronic
1174546840 20:51331908-51331930 TGTTACTGCTTTTTCTCTACAGG + Intergenic
1176017313 20:62941484-62941506 TCATTCTGATTTATTTCTACAGG - Exonic
1176786006 21:13257246-13257268 TTATTTTGCTTTATCTTTAGAGG - Intergenic
1177310799 21:19389851-19389873 TTATTCTTCTCTATCTCTAGTGG + Intergenic
1177984029 21:27950948-27950970 TTATTTTGCTTTATCTTTAGAGG - Intergenic
1181537698 22:23555204-23555226 TCATCCTGCTTCTTCTCTGCAGG - Intergenic
1182054791 22:27343184-27343206 TTATTCTGTTTTATCCCTTCTGG + Intergenic
953137360 3:40192904-40192926 TTATTCTGCATTTTCTATACAGG - Intronic
955103325 3:55873073-55873095 TTATCCAGCTCAATCTCAACAGG + Intronic
956275116 3:67491268-67491290 CTACCCTGCTTTCTCTCCACAGG - Intronic
957550684 3:81699684-81699706 TTCTCCTGCTTTATATTCACTGG + Intronic
958816418 3:98921217-98921239 TCATCTTGCTTTATCTCCAGAGG + Intergenic
959149175 3:102588077-102588099 TTATCCTGCATTATCTGGATGGG - Intergenic
960580733 3:119276417-119276439 CTATCCTCCTTTACCTCCACTGG + Intergenic
966085921 3:176067008-176067030 TTCTCCTGCCTCATCTCTTCAGG + Intergenic
966103497 3:176305911-176305933 TTATCCTGCTTTATTCATTCAGG - Intergenic
967314516 3:188138675-188138697 TTATCCTGCTTTCTTCCTAAGGG + Intergenic
967742835 3:193021994-193022016 TTATCCTGCGTTATCTCATGTGG - Intergenic
970290039 4:14562188-14562210 TTTTCCTGATTTATGTCGACAGG + Intergenic
970657711 4:18250038-18250060 TCATCCTGCTTCATCTCTACTGG - Intergenic
973782945 4:54306630-54306652 TGATCCTGCAATATCACTACTGG + Intergenic
974534941 4:63162733-63162755 GTATCCTGCTTTATTTCAACAGG + Intergenic
974823924 4:67102790-67102812 GTGTCCTGCTTCATCTCTCCTGG - Intergenic
975609139 4:76186544-76186566 GTATCCTGCTTTGTATCTACAGG - Intronic
975854593 4:78610401-78610423 TTATCTTGCTTTATATTTAATGG - Exonic
976955421 4:90892224-90892246 TTATACTGTTATATCTTTACTGG + Intronic
978401612 4:108336996-108337018 TTATACTGAATTATCTCTAAGGG - Intergenic
978524269 4:109649317-109649339 TTATACTCCTTTATCTCTATTGG + Intronic
979672791 4:123378482-123378504 TTATTCTGTTTTATTTCTTCCGG + Intergenic
980897872 4:138877018-138877040 TTATCCTGGATTATCTCTGTGGG + Intergenic
981953481 4:150441239-150441261 TTATCCTGCTTTGTCTTTAGAGG - Intronic
982636155 4:157899415-157899437 TTGTGCTGATTCATCTCTACTGG + Intergenic
983185825 4:164699514-164699536 TTATTCTTCTTTCTCTTTACTGG - Intergenic
983745023 4:171187523-171187545 TTATCCTGATTTATCCTTATAGG - Intergenic
984597040 4:181681760-181681782 TTATCTTGTTTTATCCCTACTGG - Intergenic
985483007 5:129303-129325 TTATCCCCCTTTATCTTAACTGG + Intergenic
987525096 5:19037882-19037904 TTAACCTGCTTTATATTTATTGG - Intergenic
988406664 5:30832742-30832764 TTTTTCTGCTTTATCTGCACTGG - Intergenic
992517653 5:77511391-77511413 TTATCTGTCTTTATCTCTAATGG + Intronic
993404788 5:87498244-87498266 TAAGCCTTATTTATCTCTACAGG + Intergenic
993978998 5:94519427-94519449 TTACCCTGATTTTTCTCCACTGG + Exonic
994619250 5:102143625-102143647 TTATCATACTTTATTTCTATGGG - Intergenic
998606624 5:143641954-143641976 TTCTTCTGCTTTATAGCTACTGG + Intergenic
999010968 5:148040074-148040096 TCATCCTGCTTTATTTCTCATGG - Intronic
1000635353 5:163637731-163637753 TCCTCCTACTTTACCTCTACTGG - Intergenic
1003424850 6:5991984-5992006 TTATCCTGGATTATCCCTAGAGG - Intergenic
1004325042 6:14666823-14666845 TTATCCAGCTATGTCTCTAAAGG + Intergenic
1006010603 6:31039958-31039980 TTATCCTGGATTATCTGTATGGG + Intergenic
1007326719 6:41067284-41067306 TTCTCCTGTGTCATCTCTACTGG - Exonic
1009587183 6:65622258-65622280 TTTTTCTTCTTTATTTCTACAGG + Intronic
1009948336 6:70365706-70365728 TTATTCGGCTTTATCCCTACAGG + Intergenic
1010263963 6:73846948-73846970 TTTTCCTGCTTTTTTGCTACAGG + Intergenic
1010818100 6:80384217-80384239 TTTTCCTGCTTTATATTTGCTGG - Intergenic
1010879236 6:81147677-81147699 TTATCATGTTTTATATCTAAGGG + Intergenic
1012417871 6:99029286-99029308 TTATATTGCTTTATCACTACTGG + Intergenic
1014806589 6:125837205-125837227 TTAGCCTGCTTCATCTTTCCCGG + Intronic
1015404793 6:132824909-132824931 TTATCCAGCTTCAAATCTACAGG - Intergenic
1015655537 6:135514268-135514290 TAATCTTGGTTTATCTTTACTGG + Intergenic
1017543898 6:155430563-155430585 TTATTTTGCTTTCTCTCTAGGGG - Intronic
1017626245 6:156351999-156352021 TCTTCCTGCTTTCTCTCTCCTGG + Intergenic
1017659525 6:156660130-156660152 TTATCCTGCTTTATGTTCTCTGG - Intergenic
1017823680 6:158066318-158066340 ATACCCTGGTTTATCTCTAGAGG + Intronic
1020802328 7:12747272-12747294 TTCTCCTGCTTTTTCTATGCTGG - Intergenic
1022356233 7:29617296-29617318 TTATCCTGCATTATCTTGATGGG + Intergenic
1023164594 7:37331007-37331029 TTATCCTGCTTTGTCCCTCCAGG - Intronic
1025222132 7:57120878-57120900 ATATCTTGTTTTATCTCTATTGG + Exonic
1025632915 7:63292550-63292572 ATATCTTGTTTTATCTCTATTGG + Intergenic
1025649782 7:63455633-63455655 ATATCTTGTTTTATCTCTATTGG - Intergenic
1027581198 7:79997587-79997609 TCATCCTGCTCTATCTCACCTGG - Intergenic
1027893544 7:84009829-84009851 TTTTCCTGCTCTTTCTCCACGGG - Intronic
1028115418 7:86991718-86991740 TCTTCCTGCTTTATCTCTCTTGG + Intronic
1030330577 7:108265671-108265693 TTAGCTTACTTTATCTTTACAGG + Intronic
1031983159 7:128142924-128142946 TAATGCTGCTTTTTCTCTAGGGG + Intergenic
1032370962 7:131351410-131351432 TTGTCATGCTTTATATATACTGG + Intronic
1033434237 7:141318260-141318282 TCATCATACTTTATCTTTACAGG - Intronic
1033975815 7:147099223-147099245 TTATCCAGCTTTCTCTCTTCTGG - Intronic
1034695641 7:153050929-153050951 TTTTCCTGGATTGTCTCTACGGG + Intergenic
1034827535 7:154279911-154279933 ATATCCTTCTTTATCTCAATGGG - Intronic
1036061172 8:5322877-5322899 TTATCATGCTTTTTCTCTACTGG + Intergenic
1037216623 8:16461777-16461799 TTCTCCTGCTTTTTCTCTTTTGG - Intronic
1040801543 8:51347082-51347104 TTATCCTGTTTTATTTTTTCAGG - Intronic
1041135137 8:54749944-54749966 TTCTCCTGCTTCCTCTCTCCTGG - Intergenic
1041185404 8:55295029-55295051 TTATCATGAATTATCTCAACTGG - Intronic
1041353231 8:56970974-56970996 TTACAGTGCTTTATCTCTAGAGG + Intronic
1042010380 8:64238393-64238415 TTATCCTGCTATATCTAGTCAGG - Intergenic
1042933397 8:74034956-74034978 TTATCTTCCTTTAATTCTACGGG - Intergenic
1044390242 8:91641501-91641523 TTTTCCTTCATTATCTCTTCAGG + Intergenic
1045624283 8:104024367-104024389 TTCTCCTCCTTTATCTATAAGGG - Intronic
1046252866 8:111655586-111655608 TTAACCTACTTTATGTGTACAGG + Intergenic
1047304920 8:123644900-123644922 TTTTCCAGCTTTATATCTTCAGG - Intergenic
1047936524 8:129786031-129786053 CAATCCTGCTATTTCTCTACAGG - Exonic
1048414884 8:134215488-134215510 TTATCAAGCATTATCTCTCCAGG - Intergenic
1050984370 9:12063452-12063474 TTAGCCTGCTTTTTCTGTATAGG + Intergenic
1051496091 9:17725303-17725325 TTAGCCTTCTTTGTCTCTAGGGG + Intronic
1052978951 9:34433303-34433325 TCTTCCTCCTTTATCTCTATGGG + Intronic
1054735047 9:68742612-68742634 TCTTCCTGCTTCATCTCTAAAGG + Exonic
1055090182 9:72356456-72356478 TTATCCTGCGTTGCATCTACAGG - Intronic
1056429018 9:86508179-86508201 TTCTCCTGTTATATCTATACAGG - Intergenic
1056458673 9:86788221-86788243 TTTTCCTGCTTTATTTTTCCTGG + Intergenic
1058574258 9:106383095-106383117 TTATCCTGGTTTATCTCTTCTGG + Intergenic
1061244285 9:129393356-129393378 TCATCCTGCTTCTTCTCTGCAGG + Intergenic
1188142137 X:26564593-26564615 TTATCTTGGATTATCTCTATGGG + Intergenic
1188356572 X:29198914-29198936 TTATCCTGTTTTATCACTGCAGG + Intronic
1192012780 X:67293038-67293060 TTGTCTTGCTTCATCACTACTGG - Intergenic
1193602280 X:83522091-83522113 TCATACTGCTTTATCTCTACAGG - Intergenic
1195390044 X:104352236-104352258 TTATCCTTCTTTAGCTCTTTAGG - Intergenic
1196274879 X:113755298-113755320 TTTTCCTGCCCTATCACTACAGG + Intergenic
1196370047 X:114967542-114967564 TTATCTGCCATTATCTCTACAGG - Intergenic
1196558373 X:117118604-117118626 TTATTCTTCTTTACCTCAACAGG + Intergenic
1197366429 X:125569082-125569104 TTATCTTTCTTGATCTTTACTGG - Intergenic
1200973460 Y:9181100-9181122 TTTTCCTGTTTTATGTTTACTGG + Intergenic
1201323362 Y:12726303-12726325 TATTTCTGCTTTATGTCTACAGG - Intronic
1201644282 Y:16211051-16211073 TTAACCTTCTTTATGTCTTCGGG + Intergenic
1201658533 Y:16374270-16374292 TTAACCTTCTTTATGTCTTCGGG - Intergenic