ID: 1105827316

View in Genome Browser
Species Human (GRCh38)
Location 13:24134028-24134050
Sequence GTGGTTGCTGGCGGGAGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 565
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 526}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105827309_1105827316 -5 Left 1105827309 13:24134010-24134032 CCAGAGGTTGTGCTAAGTGTGGT 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1105827316 13:24134028-24134050 GTGGTTGCTGGCGGGAGGTGGGG 0: 1
1: 0
2: 3
3: 35
4: 526
1105827304_1105827316 25 Left 1105827304 13:24133980-24134002 CCCTGGGGGAAGGCTCTTTCTGC 0: 1
1: 0
2: 2
3: 23
4: 199
Right 1105827316 13:24134028-24134050 GTGGTTGCTGGCGGGAGGTGGGG 0: 1
1: 0
2: 3
3: 35
4: 526
1105827305_1105827316 24 Left 1105827305 13:24133981-24134003 CCTGGGGGAAGGCTCTTTCTGCA 0: 1
1: 0
2: 0
3: 18
4: 179
Right 1105827316 13:24134028-24134050 GTGGTTGCTGGCGGGAGGTGGGG 0: 1
1: 0
2: 3
3: 35
4: 526
1105827307_1105827316 -1 Left 1105827307 13:24134006-24134028 CCTTCCAGAGGTTGTGCTAAGTG 0: 1
1: 1
2: 1
3: 14
4: 197
Right 1105827316 13:24134028-24134050 GTGGTTGCTGGCGGGAGGTGGGG 0: 1
1: 0
2: 3
3: 35
4: 526
1105827303_1105827316 26 Left 1105827303 13:24133979-24134001 CCCCTGGGGGAAGGCTCTTTCTG 0: 1
1: 0
2: 0
3: 14
4: 175
Right 1105827316 13:24134028-24134050 GTGGTTGCTGGCGGGAGGTGGGG 0: 1
1: 0
2: 3
3: 35
4: 526

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105827316 Original CRISPR GTGGTTGCTGGCGGGAGGTG GGG Intronic
900394862 1:2449134-2449156 GTGGTGGGGGGCGGGGGGTGGGG - Intronic
900504894 1:3024992-3025014 GTGGGGGGTGGAGGGAGGTGGGG + Intergenic
900763473 1:4488306-4488328 GTCGTAGCTGGCGGGACATGAGG - Intergenic
900767760 1:4516684-4516706 GTGCTTGCTGGCTGGAAGTTAGG + Intergenic
900986051 1:6073298-6073320 GTGGGTGCTGGTGGGGGGCGGGG - Intronic
901159346 1:7163258-7163280 GTTATTGGTGGCTGGAGGTGTGG + Intronic
901608148 1:10475240-10475262 GTGCTGGCAGGCGGGAAGTGGGG - Intronic
901790058 1:11649245-11649267 GAGGTGGGGGGCGGGAGGTGGGG + Intronic
902033466 1:13439514-13439536 GGGGTGGCGGGCGGGGGGTGGGG - Intergenic
902153217 1:14461695-14461717 GTGGTGACTGGCAGGTGGTGTGG + Intergenic
902384544 1:16068843-16068865 CAGGTTGCTTGTGGGAGGTGAGG - Intronic
902995813 1:20223803-20223825 GGGGTTGGTGGGGGGAGGCGGGG - Intergenic
903318522 1:22527375-22527397 GTGGCGGCCTGCGGGAGGTGAGG - Exonic
903320412 1:22539714-22539736 GTGGTTGCTGTGGTGGGGTGGGG - Intergenic
903472045 1:23593918-23593940 CTCTTTGCTGGCTGGAGGTGGGG + Intronic
903738585 1:25545035-25545057 GTGCCTGCTGGTGGGGGGTGGGG + Intronic
905410410 1:37764647-37764669 GTGATTGGAGGTGGGAGGTGCGG - Intronic
905648929 1:39643708-39643730 GTGGAGCCTGGTGGGAGGTGAGG + Intergenic
905923998 1:41737005-41737027 GTGGCTGGTGCCTGGAGGTGGGG - Intronic
906143245 1:43545942-43545964 TTGGTTACTGGTGGGAGGCGGGG + Intronic
906539757 1:46576296-46576318 GTGGTTGTTGGGGGGAAATGGGG - Intronic
907085256 1:51666318-51666340 GTGGTAGCTAGAGGGAGATGTGG + Intronic
907418642 1:54331800-54331822 GTGGGTGCTGGCGGGCAGTTGGG - Intronic
907756000 1:57311503-57311525 GTGGTGGTTGGCAGGAGGTGGGG - Intronic
908560173 1:65298307-65298329 GTGGGTGAAGGTGGGAGGTGAGG + Intronic
908574489 1:65444574-65444596 GTGGAGGCGGGCGGGGGGTGGGG + Intronic
909058494 1:70851003-70851025 GTGGTAGCAGGGGTGAGGTGTGG + Intergenic
909297400 1:73968252-73968274 CTGGTTCCTGGCAGGGGGTGGGG + Intergenic
909744873 1:79082292-79082314 GTGGCTGCTGGTAGGAGGAGCGG + Intergenic
910420200 1:87052624-87052646 GTGGTTGGTGGCGAGCAGTGAGG + Intronic
910608311 1:89111634-89111656 GTGGTGGGGGGAGGGAGGTGGGG + Intronic
912954258 1:114142716-114142738 GTGGTTGCTGGTGGCTGGAGTGG - Intronic
913615883 1:120558934-120558956 GAGGCTGCTGGCGGGAAGCGGGG - Intergenic
914193506 1:145431295-145431317 GCCGTTGCAGGCGGGAGTTGGGG + Intergenic
914216653 1:145636859-145636881 GTGGGTGCTGGCAGGGGGGGTGG - Intronic
914474835 1:148014185-148014207 GCCGTTGCAGGCGGGAGTTGGGG + Intergenic
914574396 1:148951968-148951990 GAGGCTGCTGGCGGGAAGCGGGG + Intronic
914845981 1:151283558-151283580 GAGGTGGCTGGCGGGGTGTGGGG + Intronic
915723548 1:158001705-158001727 GATGTTGCTGGTGGGATGTGTGG + Intronic
915940976 1:160117934-160117956 GTGGTTGGGGGAGGGAGGAGTGG + Intronic
918592363 1:186254213-186254235 GTGGATGCAGCCAGGAGGTGAGG + Intergenic
919199971 1:194343407-194343429 TTGGTTGCTGAAGGGTGGTGTGG + Intergenic
919512145 1:198478417-198478439 GTGGTTGGGGGTGGGAAGTGGGG + Intergenic
920066714 1:203274280-203274302 GTGGTAGGTGGCTGGGGGTGGGG + Intergenic
920385795 1:205569421-205569443 GTGGTCGCGGCCGGGAGGCGGGG - Intronic
920643669 1:207779733-207779755 GTGGTTGCTGGGGTGGGGCGAGG - Intronic
920795313 1:209131116-209131138 GTGGTGGCGGGCGGGGGGGGGGG + Intergenic
921901498 1:220456102-220456124 GTGGTGGTTGGGGGTAGGTGGGG + Intergenic
921977353 1:221217513-221217535 GTGGTTACTGGGGGGAGTTTTGG + Intergenic
922342510 1:224669106-224669128 ATGGCTGCTGGCTGGAGTTGAGG + Intronic
922460518 1:225811435-225811457 GTGGCTGGAGGTGGGAGGTGAGG + Intronic
922861171 1:228818154-228818176 GTGGCTGCAGCAGGGAGGTGTGG + Intergenic
923017950 1:230141454-230141476 GTGGTTGCCAGGGGGAGGGGAGG - Intronic
923219848 1:231883321-231883343 GGGGTTGCTGGGGGGAGGGTTGG - Intronic
923827367 1:237515622-237515644 GTGGGTGATGGAGGGAGGGGAGG - Intronic
1063415515 10:5869760-5869782 GGGGTTGCTGGGGGGAGGGGTGG + Intronic
1063575589 10:7259381-7259403 GTGGTTGATGGAGGGAGCCGAGG - Intronic
1063598195 10:7456557-7456579 GTGGGTGCTGGCAGCAGCTGTGG - Intergenic
1065108402 10:22414319-22414341 GTGGTTGCTGGCCAGAGGGAAGG + Intronic
1065431568 10:25662109-25662131 GTGGCTGCTGCCAGGAGATGAGG + Intergenic
1066692424 10:38043592-38043614 GGAGTTGTTGGGGGGAGGTGGGG - Intronic
1068253187 10:54470384-54470406 GTGGTGCCTGGCTGCAGGTGGGG + Intronic
1069555697 10:69396506-69396528 GTGGTTGCTGGGGTGGGGGGAGG - Intronic
1069996421 10:72344717-72344739 GTGGGTCGTGGCGGGAGGGGTGG + Intronic
1070637903 10:78143863-78143885 GTGGTAGCTGGGAAGAGGTGGGG + Intergenic
1070832563 10:79428343-79428365 GTGGTTGCTGGGGGGCAGGGAGG + Intronic
1071664869 10:87544322-87544344 GAGGTTCCTGGAGGGCGGTGTGG - Intronic
1071935647 10:90527117-90527139 GTGGCTGCTGCTGGGAGCTGAGG + Intergenic
1072117989 10:92382033-92382055 GTGGGTGTTGGGGGGAGGAGGGG + Intergenic
1072355321 10:94604450-94604472 GTGGGGGGTGGCGGGGGGTGGGG - Intronic
1072574999 10:96691234-96691256 GTTGCTGTTTGCGGGAGGTGGGG - Intronic
1073424677 10:103449328-103449350 GTGGTGGCTGGTGAGAGGTCCGG - Intronic
1074554145 10:114472719-114472741 ATGGAAGCTGTCGGGAGGTGGGG - Intronic
1075166437 10:120072058-120072080 GTGGGGCCTGGTGGGAGGTGGGG - Intergenic
1075431668 10:122388796-122388818 GTGGTTGCTGAAGGTAGGGGTGG + Intronic
1075668027 10:124244646-124244668 GTGGGGGCTGGCGGGCAGTGAGG - Intergenic
1076588443 10:131567128-131567150 GTGGTAGTTGCAGGGAGGTGGGG + Intergenic
1076634461 10:131873322-131873344 GTGGTTGCAGGGTGCAGGTGCGG - Intergenic
1076699495 10:132264057-132264079 GTGGTGGCTGCCAGGAGCTGGGG + Intronic
1076800399 10:132820326-132820348 GTGGTGGCTGACGGGGGCTGGGG + Intronic
1076818200 10:132924915-132924937 GAGGTTGCTGGCTCGAGCTGCGG + Intronic
1076856140 10:133116417-133116439 GTGGGTGGTGGCGGGGGGTGGGG - Intronic
1076912912 10:133401132-133401154 GTGGGTCCAGGAGGGAGGTGGGG + Intronic
1077177029 11:1195683-1195705 GTGCTTGGGGGCGGGGGGTGGGG - Intronic
1078106891 11:8363458-8363480 GTGGTTACCTGGGGGAGGTGGGG - Intergenic
1078922767 11:15845643-15845665 GTGAGGGCTGGGGGGAGGTGAGG + Intergenic
1080278290 11:30527459-30527481 GTGGTTTCTGGAAGGAGGGGTGG + Intronic
1080310998 11:30891993-30892015 GTTGTTGGTGGTGGGGGGTGTGG - Intronic
1080979163 11:37379349-37379371 TTGGTGGCTGGAGGGTGGTGGGG + Intergenic
1081636700 11:44726796-44726818 GCGGAGGCTGGCGGGAGGCGAGG + Intronic
1082784126 11:57307525-57307547 GGGGTTGGTGGTGGGAGGAGAGG - Intronic
1083281936 11:61632327-61632349 GTGGCATCTGGCGGGAGTTGGGG + Intergenic
1083742512 11:64718353-64718375 GAGGATGCTGGCGTGAGGAGAGG - Intronic
1083790405 11:64981268-64981290 GGGGTGGGTGGGGGGAGGTGGGG - Intergenic
1084190082 11:67494759-67494781 GGGGGTGCTGGGGGGAGGGGCGG + Intronic
1084338433 11:68475784-68475806 GGGGTGGCTGCCGGGAGGAGGGG + Intronic
1084899315 11:72297996-72298018 CTGGTTGTTAGAGGGAGGTGAGG - Intronic
1085280166 11:75324938-75324960 CTGGTGGCTGGCGTGAGGTGAGG + Intronic
1085977241 11:81672777-81672799 GGGGTTGCAGTGGGGAGGTGGGG + Intergenic
1086322718 11:85667193-85667215 GGGGTTGGCGGCGGGGGGTGGGG - Intronic
1086575977 11:88339108-88339130 GGGGTTGGTGGCGGGGGGTTGGG + Intergenic
1087868859 11:103266554-103266576 GTGGTGGGTGGTGGGAGGTTGGG + Intronic
1088750694 11:112839879-112839901 GGGGCTGCTGGGGGGAGCTGGGG + Intergenic
1088921127 11:114260498-114260520 GTGAGTGCTGGAGGGAAGTGGGG - Intronic
1089356299 11:117856100-117856122 TTGGTTGCTGGCTGCATGTGCGG + Intronic
1090327551 11:125902369-125902391 GTGGTGGCGGGGGGGAGGGGGGG + Intronic
1090406132 11:126476656-126476678 GTGGGGGCTGGGGGGGGGTGGGG + Intronic
1090570023 11:128035776-128035798 GTGGTGGCAGGCGGGTGGGGGGG - Intergenic
1090965045 11:131591158-131591180 GTGGGGGCTGGGAGGAGGTGAGG - Intronic
1091401208 12:181879-181901 GGGGCAGCAGGCGGGAGGTGTGG + Intergenic
1091428539 12:412818-412840 GGGGTTGCAGGCTAGAGGTGAGG - Intronic
1091468936 12:709832-709854 GAGGTTGGAGGTGGGAGGTGAGG + Intergenic
1093420144 12:18965416-18965438 GTGGCTGCTGTCAGGAGATGGGG + Intergenic
1093691878 12:22118318-22118340 GTGGCTGTTGGTGCGAGGTGGGG - Intronic
1094250306 12:28352252-28352274 GTGGTTGCTGAAGGTTGGTGTGG + Intronic
1095702281 12:45202636-45202658 GGGGTTGGGGGTGGGAGGTGAGG - Intergenic
1095705002 12:45227506-45227528 GTGGTTGCTGGGAGGATGCGAGG + Intronic
1096531247 12:52244141-52244163 GTGGGTGGTGGGGGGATGTGAGG + Intronic
1096532118 12:52248777-52248799 GTGGGTGGTGGCTGGAGGAGTGG - Exonic
1097107302 12:56633346-56633368 GGGGGTGCTGGGGGGAGGAGAGG - Intronic
1098601402 12:72335523-72335545 GAGGTAGTTGGCAGGAGGTGGGG - Intronic
1099216350 12:79858611-79858633 TTTCTTGCTGGGGGGAGGTGAGG + Intronic
1100686561 12:96992729-96992751 GTGGTGGGTGGCGGGGGGTGGGG - Intergenic
1101149445 12:101871097-101871119 GTGGTTGCTGAAGGGTGGGGTGG - Intergenic
1101858764 12:108465470-108465492 AGGATTGCTGCCGGGAGGTGGGG + Intergenic
1102368334 12:112359366-112359388 GTGGTTGCTGGGGAGGGGGGTGG - Intronic
1102394160 12:112573943-112573965 GGGGGTGCTGGGGAGAGGTGTGG + Intronic
1102443894 12:112986612-112986634 GTGGATGCTGGTGGCAGGTGGGG + Intronic
1102532156 12:113554350-113554372 GTGGGTGATGGTGGGGGGTGGGG + Intergenic
1103168218 12:118789278-118789300 GTGGGTGATGGAGGGAAGTGAGG - Intergenic
1104320212 12:127743654-127743676 GTGGGTGGAGGTGGGAGGTGTGG - Intergenic
1104461456 12:128959479-128959501 GTGGGGGCTGGCAGGGGGTGGGG + Intronic
1105601048 13:21887183-21887205 GTGCTAGCTGGCAGGACGTGTGG + Intergenic
1105827316 13:24134028-24134050 GTGGTTGCTGGCGGGAGGTGGGG + Intronic
1105936387 13:25104007-25104029 GTGGTTGCTGGAGGGTGGGAAGG + Intergenic
1106032061 13:26012719-26012741 GTGAGTGCTGACGGGGGGTGGGG + Intronic
1106250887 13:27980661-27980683 GTGGTCACTGGTGGGAGGTCCGG + Intronic
1107146830 13:37069546-37069568 GAGGTTGCTTCCGGGACGTGGGG - Intergenic
1107684969 13:42887543-42887565 GTGGTGGCTGGGGGACGGTGAGG + Exonic
1108258086 13:48629762-48629784 GTGGGGGCTGGTGGGAGGTGGGG + Intergenic
1108750876 13:53447237-53447259 CTGGTTACTGGTGGGAGGGGAGG - Intergenic
1108940058 13:55941518-55941540 CTGGATGCTGGGGTGAGGTGAGG - Intergenic
1112288228 13:98122864-98122886 GTGGGGCCTGGTGGGAGGTGGGG + Intergenic
1112310119 13:98310684-98310706 GTGGGTGGTGGTGGGTGGTGTGG + Intronic
1113679629 13:112234367-112234389 GTGCTTGCTGGCCAGAAGTGTGG - Intergenic
1113697333 13:112355503-112355525 GGTGATGGTGGCGGGAGGTGGGG - Intergenic
1113742955 13:112724047-112724069 GTGGGCGCTGGTGAGAGGTGTGG - Intronic
1114247951 14:20932647-20932669 GTGGTGGCTGTTGGGAGATGGGG - Intergenic
1114560801 14:23589143-23589165 CTGGTGGCTGCCGGGAGATGAGG - Intergenic
1119608140 14:76038825-76038847 CTGGTAGCTGGCGGGTGGGGAGG + Intronic
1121018424 14:90562940-90562962 GGGGTTGGGGGAGGGAGGTGCGG - Intronic
1123450665 15:20357450-20357472 GTGGGTGTTGGGGGGAGGAGTGG - Intergenic
1124368829 15:29091822-29091844 GAGGTTGCTGGCGCGAGGGCTGG + Intronic
1124884482 15:33672144-33672166 GTCATGGCTGGCGGGGGGTGGGG + Intronic
1125180369 15:36876179-36876201 CTGGTGGCTGGGGCGAGGTGAGG + Intergenic
1125199998 15:37095155-37095177 GTGGGGGCTGGGGGGCGGTGAGG - Intronic
1125312893 15:38399891-38399913 ATGGTTGCTGGGGCGGGGTGGGG - Intergenic
1125760132 15:42090651-42090673 GTGAATGCCGGCTGGAGGTGAGG + Intronic
1125954032 15:43777036-43777058 GGTGGCGCTGGCGGGAGGTGGGG - Exonic
1128270543 15:66305433-66305455 ATGGTGGCAGGCTGGAGGTGTGG + Intronic
1129732903 15:77942022-77942044 GTGTGTGTTGGCGGGGGGTGGGG + Intergenic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1131107729 15:89746118-89746140 GTGGATGCTGTGTGGAGGTGTGG - Intergenic
1131107770 15:89746432-89746454 GTGGATGCTGTGTGGAGGTGTGG - Intergenic
1131629915 15:94165638-94165660 GTGGTGGCTGGGGGGCGGGGGGG + Intergenic
1131855375 15:96587994-96588016 GAGGTTGGTGGGGGGAGGGGAGG - Intergenic
1131871530 15:96769422-96769444 GTGGTTGCTGGGAGGGGTTGGGG - Intergenic
1132390953 15:101437766-101437788 GAGGTGGGTGGCGGGCGGTGGGG - Intronic
1132693192 16:1190759-1190781 GTGGGTGCTGGGGGAAGGGGAGG + Intronic
1132695693 16:1200847-1200869 GTGTTAGCTGGCTGGGGGTGGGG + Intronic
1133211063 16:4263771-4263793 GTGGCTGCTGGCTGGGGGCGTGG + Intronic
1133575966 16:7090356-7090378 CTTTTTGCTGGGGGGAGGTGTGG + Intronic
1133782793 16:8952810-8952832 GTGGTCACAGGCGGGAGGGGTGG - Intronic
1134361396 16:13534117-13534139 GTGGTGGTTGGAGGGAGATGTGG - Intergenic
1134529810 16:14974749-14974771 AGGGATGCCGGCGGGAGGTGAGG + Intronic
1135390543 16:22089619-22089641 GTGGGTGGTGGCGGGGGGTGGGG - Intergenic
1135705429 16:24670894-24670916 GTGGGGGCTGGCGGGAGTGGGGG - Intergenic
1136316623 16:29458232-29458254 GTGGATGCTGAGGGGAGGGGCGG + Intergenic
1136431199 16:30197574-30197596 GTGGATGCTGAGGGGAGGGGCGG + Intronic
1136926542 16:34380593-34380615 TTGGTTGCAGGGGGGAGGTGGGG + Intergenic
1136978032 16:35031214-35031236 TTGGTTGCAGGGGGGAGGTGGGG - Intergenic
1139866540 16:70066213-70066235 AGGGATGCCGGCGGGAGGTGAGG - Intergenic
1140061143 16:71570722-71570744 CTGGTTCCTGGCTGGAGGTTGGG - Exonic
1140264677 16:73409994-73410016 GTGGGTGCAGGTGGGAAGTGGGG + Intergenic
1140737550 16:77911661-77911683 GTGGCTGTTTGTGGGAGGTGGGG + Intronic
1141592107 16:85076286-85076308 TTGGTTGTTGGAGGGTGGTGGGG + Intronic
1141622130 16:85241913-85241935 ATGGTGGCTGCCGGGAGGGGAGG + Intergenic
1141637707 16:85323543-85323565 CTGGTAGCTCGCGGGAGGTGAGG + Intergenic
1141786434 16:86203803-86203825 GAGGTTGCTGGCGGAAGGGAGGG - Intergenic
1141926109 16:87170686-87170708 GCGGTGGAGGGCGGGAGGTGAGG - Intronic
1141950365 16:87335631-87335653 GTGCGTGCTGGTGGGTGGTGGGG - Intronic
1142061503 16:88033124-88033146 GAGCTCGCTGGCAGGAGGTGGGG - Exonic
1142848185 17:2692091-2692113 GTGGTGGCTGCCGGGAGGCGCGG + Exonic
1143175287 17:4951552-4951574 GTGGAGGCTTGGGGGAGGTGGGG + Intronic
1143371124 17:6440125-6440147 GTGGTGGCTGGAGGGAGGGAAGG - Intergenic
1143779262 17:9220916-9220938 GTGGTTGCAGGCGGTGGCTGAGG + Intronic
1144571737 17:16404409-16404431 GTGGTGGGTGGTGGGGGGTGGGG + Intergenic
1145005964 17:19337902-19337924 GTGGTGGAGGGTGGGAGGTGGGG + Intronic
1145201029 17:20944809-20944831 GTGGCTGCTGCCGGGAGATGAGG + Intergenic
1146755235 17:35425429-35425451 GTGGTTACTGGGGGAAGATGGGG - Intronic
1146981278 17:37164088-37164110 GTGTTTGGTGGCGAGTGGTGGGG - Intronic
1147381121 17:40056867-40056889 AGGGCTGCTGGTGGGAGGTGGGG - Intronic
1148023277 17:44567890-44567912 GTGGTTGCTAGGGGTTGGTGGGG - Intergenic
1150509146 17:65730762-65730784 TTGGTTGGGGGCGGGGGGTGGGG - Intronic
1150833711 17:68545577-68545599 GTGGTTGCTGAAGGTTGGTGAGG + Intronic
1151310855 17:73291694-73291716 GTGGTTTCTGGGGTGGGGTGGGG - Intronic
1151443702 17:74149937-74149959 GTGGGTGCTGGGATGAGGTGGGG - Intergenic
1151451466 17:74200675-74200697 GGGGCTGCTGGAGGGAGGAGGGG + Intergenic
1151705633 17:75765501-75765523 GTGGGTGGTGGTGGGTGGTGAGG - Exonic
1151756544 17:76078468-76078490 GTTGTTGTTGGGGGGAAGTGGGG + Intronic
1151975019 17:77479767-77479789 AGGGATGCTGGGGGGAGGTGGGG + Intronic
1152165960 17:78706294-78706316 GTGGTTGCTGGGGCGGGGTGGGG - Intronic
1152754953 17:82083334-82083356 GTGCTGACTGGCGGGAGGTGTGG - Exonic
1152866010 17:82723430-82723452 CTGCCTGCTGGCGGGGGGTGGGG + Intronic
1153301130 18:3593121-3593143 GTGTTTACTGGCGGGGGGCGGGG - Intronic
1153352787 18:4099653-4099675 GTGGTTGCTGAAGGTTGGTGTGG + Intronic
1153961375 18:10142916-10142938 GAGGTTGCTGGTGGCAGGAGAGG - Intergenic
1155686428 18:28557517-28557539 GTGGTTGCTGAAGGCTGGTGTGG - Intergenic
1157796330 18:50578910-50578932 GTGTTTGCTAGGGGAAGGTGGGG + Intronic
1160251880 18:77210245-77210267 GTTGTTGCTGCCGGGTGGGGTGG + Intergenic
1160608060 18:80066987-80067009 GAGGGTGCTGGAGGGAGGAGAGG + Intronic
1160703451 19:518588-518610 GGGGATGCTGGGGGGAGGAGAGG + Intronic
1160922817 19:1528742-1528764 GTGTGGGCAGGCGGGAGGTGTGG - Intronic
1160966037 19:1747388-1747410 GTGGGGGGTGGCGGGCGGTGGGG - Intergenic
1161168696 19:2802329-2802351 GGTGTTGGTGTCGGGAGGTGGGG - Intronic
1161168738 19:2802457-2802479 GGTGTTGGTGTCGGGAGGTGGGG - Intronic
1161168755 19:2802521-2802543 GGTGTTGGTGTCGGGAGGTGTGG - Intronic
1161194150 19:2977073-2977095 GTGGCTTATGGCTGGAGGTGAGG - Intergenic
1161587890 19:5115269-5115291 GGGGGTGCTGGGGGGATGTGGGG + Intronic
1161946608 19:7441162-7441184 GTGGTGGGGGGCGGGGGGTGGGG - Intronic
1163259952 19:16183017-16183039 TTAATTGCTGGCGGGGGGTGGGG - Intergenic
1163363453 19:16862603-16862625 GTGTTTGCTGGGGAGGGGTGGGG - Intronic
1163408978 19:17141589-17141611 GTGGTGGCTGGCGGAAGGTGGGG - Intronic
1163490496 19:17614791-17614813 GTGACTGGTGGCGGGGGGTGGGG - Intronic
1163598709 19:18235132-18235154 GTGGATGCTAGCAGGAGCTGGGG - Intronic
1163634952 19:18433452-18433474 GGGGTTCCTGGCGGGCTGTGCGG + Intronic
1163836807 19:19579935-19579957 GTGGATGGTGGGGGGAGATGGGG - Intronic
1165095559 19:33407934-33407956 GGGGTGGCTGGCTGGGGGTGAGG + Intronic
1165335558 19:35167337-35167359 GGGGCTGCTGGCAGGAGCTGTGG + Intronic
1165350119 19:35270581-35270603 GAGCTTGCAGGCTGGAGGTGAGG + Exonic
1165757861 19:38304608-38304630 GTCCTTGCTGGATGGAGGTGCGG - Exonic
1167148063 19:47694460-47694482 GTGGAGGATGGAGGGAGGTGGGG - Exonic
1168292355 19:55362762-55362784 GTGGCTGCTGGAGGAAGGAGTGG - Intronic
1168323679 19:55526003-55526025 TTGATTGCTGGCGGCAGCTGAGG - Intergenic
1168707671 19:58479193-58479215 GATGGTGCTGGCTGGAGGTGAGG - Intronic
925132562 2:1503880-1503902 GGGGTCGCTCGCGGGAGATGGGG + Intronic
925929269 2:8694120-8694142 GTGGGGGCTGGCGGGGAGTGGGG + Intergenic
927148064 2:20179905-20179927 GTGGGTGCGGGCGGCGGGTGCGG - Intergenic
927496338 2:23554125-23554147 GTGGATGTTAGCGGGAGGTGGGG - Intronic
927809210 2:26172753-26172775 GGGGAAGCTGGCGGGAGGGGAGG + Intergenic
927872168 2:26630548-26630570 ATGGTGGATGGCGGGTGGTGGGG + Intronic
927900102 2:26812875-26812897 GTGGGTGCTGGAGGAAGGGGAGG - Intergenic
929011421 2:37448970-37448992 GTGGTAGAAGGTGGGAGGTGGGG + Intergenic
929769159 2:44877635-44877657 GTGGGTGCTGGCTGGTGTTGGGG - Intergenic
929943868 2:46355836-46355858 GTGGTTGCTGGGGGCAGCTTGGG + Intronic
930236613 2:48894915-48894937 GTGGTGGTTGGTGGGAAGTGGGG + Intergenic
931007455 2:57868167-57868189 TTGGTTGCTGGCTGGACGTCAGG + Intergenic
932171875 2:69564934-69564956 GTGGTTTTTGCAGGGAGGTGGGG - Intronic
932413945 2:71562704-71562726 GCGGTTGCTGGAGGAAGCTGTGG + Intronic
932415690 2:71572699-71572721 GGGGTTGCTGGGGTGAGCTGGGG + Intronic
932654751 2:73600977-73600999 GTTGTGGCTGGGGGTAGGTGGGG - Intronic
932662907 2:73672591-73672613 GTGGTGACTGGGGGTAGGTGGGG - Intergenic
932965114 2:76464954-76464976 GTGGTTGATGGAAGAAGGTGGGG - Intergenic
933277453 2:80299363-80299385 GAGATTGGTGGGGGGAGGTGGGG - Intronic
933781760 2:85807548-85807570 GTGGAAGCTGGCAGGGGGTGGGG - Intergenic
934558239 2:95298771-95298793 GTGGTTGCTGGGGAGACTTGAGG - Intronic
935707098 2:105866476-105866498 ATGGATGGTGGCAGGAGGTGGGG + Intronic
935997223 2:108787058-108787080 GTGGAAGCAGGCGGGAGGGGCGG + Intronic
936278846 2:111121315-111121337 CTTGTCGCCGGCGGGAGGTGGGG + Intronic
936726408 2:115322980-115323002 GTGGTTGCTGAAGGTGGGTGTGG + Intronic
936920367 2:117682713-117682735 GTGGTTGCTGAAGGGTGGAGTGG - Intergenic
937311531 2:120906069-120906091 GTGGCTGCTGGCAGGAGGCTGGG - Intronic
937612970 2:123885659-123885681 GGGGGTGCAGGAGGGAGGTGGGG - Intergenic
937956252 2:127423185-127423207 GTGGATGCTGGCGGGCGGCGGGG + Intronic
940175651 2:150874849-150874871 GTGGTGGCAGGGGAGAGGTGTGG + Intergenic
940453923 2:153872608-153872630 GTTGTTGGTGGCGGGGGGGGGGG + Intronic
940756417 2:157688134-157688156 GTGGTTGCTGAAGGTTGGTGTGG + Intergenic
942532724 2:176929354-176929376 GTGGAGGCTGGGAGGAGGTGAGG - Intergenic
942663736 2:178293767-178293789 GTGGAGGGTGGGGGGAGGTGAGG - Intronic
942750586 2:179282374-179282396 GGGGTGGTTGGGGGGAGGTGGGG + Intergenic
943060552 2:183038184-183038206 GAGGTCGCGGGCGGGAGGGGAGG - Exonic
944478436 2:200130142-200130164 CTGGCTGCTGGAGTGAGGTGTGG - Intergenic
946002762 2:216496578-216496600 ATGGTGGCTGCTGGGAGGTGGGG + Intergenic
947637705 2:231688559-231688581 GGGGTTGCTGGTGGGTGGGGAGG - Intergenic
947665189 2:231900968-231900990 GTGTGTGCTGGTGGGAGGTGGGG + Intergenic
948229092 2:236336651-236336673 GTGCTTGCTGGCAGTAGGGGTGG - Intronic
948704096 2:239778641-239778663 GGGGATGCTGGCGGGAGGCTGGG - Intronic
948755015 2:240154648-240154670 GTGGGTGCTTCCAGGAGGTGGGG + Intergenic
949027763 2:241774392-241774414 CTGGGCGCTGGCAGGAGGTGGGG - Intergenic
949050357 2:241894565-241894587 GTGGTTGGTGGGGGGGGGGGGGG + Intronic
1171012211 20:21514964-21514986 GGGGTTGGGGGTGGGAGGTGGGG - Intergenic
1171194933 20:23189534-23189556 GTGGGTGCTGGTGGGAGGGGAGG + Intergenic
1171453521 20:25252864-25252886 GTTGGGGCTGGCGGGAGGGGTGG + Intronic
1171999087 20:31758085-31758107 GGGGTGGCAGGAGGGAGGTGAGG - Intronic
1172486847 20:35303645-35303667 GTAGTTGCTGGAGGGGGTTGGGG + Exonic
1172793921 20:37524291-37524313 GAGGTTTCTGGGGTGAGGTGGGG - Intronic
1172838476 20:37887909-37887931 GGGGGAGCTGGTGGGAGGTGAGG + Intergenic
1172973856 20:38892412-38892434 GTGGTGGTTGGGGTGAGGTGCGG - Intronic
1173273617 20:41558841-41558863 GTGGTGGTGGGTGGGAGGTGGGG - Intronic
1173455231 20:43196367-43196389 AAGGTTGCTGCGGGGAGGTGGGG - Intergenic
1174480877 20:50830492-50830514 GGGGTTGGTGGTGGGAGTTGGGG + Intronic
1174728620 20:52891491-52891513 GGGGTTGTTGGGGGGAGGTGGGG + Intergenic
1174747353 20:53076647-53076669 TAGGTTGATGGTGGGAGGTGAGG + Intronic
1175125938 20:56751513-56751535 GAGGTTGCTGGAGTGAGTTGGGG + Intergenic
1175270786 20:57732476-57732498 GTGGTTGCTTGGGGGAGAGGGGG - Intergenic
1175944469 20:62552306-62552328 GTGGGTGGGGGCGGGGGGTGGGG - Intronic
1176274510 20:64256024-64256046 GAGGCCGCTGGGGGGAGGTGAGG - Intronic
1176413610 21:6462061-6462083 GTGGCTGCTGGAGGGTGGAGTGG - Intergenic
1177046003 21:16171157-16171179 GTGGTTGCTGGAGGATGGGGTGG + Intergenic
1179499808 21:41801083-41801105 ATGGTTGCTGGCGGGGGATCTGG + Exonic
1179689108 21:43070384-43070406 GTGGCTGCTGGAGGGTGGAGTGG - Intronic
1179804602 21:43829273-43829295 GTAGGTGCTGGCGGGGGGTGGGG - Intergenic
1179998106 21:44983162-44983184 GTGGCTGCCGGCGGGCGGGGAGG + Intergenic
1180130818 21:45825795-45825817 GGGGTTGGTGGTGGGACGTGGGG + Intronic
1180619785 22:17153426-17153448 CTGGGAGCTGGCAGGAGGTGGGG - Intronic
1180643558 22:17319022-17319044 GTGGATTCTGGAGGGAGGAGGGG + Intergenic
1180980913 22:19877588-19877610 GAGGTGGCTGGCTGGATGTGGGG - Intronic
1181029688 22:20143754-20143776 GAGGTGGGTGCCGGGAGGTGCGG + Exonic
1181084390 22:20432565-20432587 GGGGCTTCTGGAGGGAGGTGGGG + Intronic
1182250284 22:28994560-28994582 GTGGTTGCTGGGGTGGGGTATGG + Intronic
1182465315 22:30512229-30512251 CTGCTGGCTGGCGGGTGGTGTGG - Intergenic
1182481308 22:30610746-30610768 GTGTGTGCTGGGTGGAGGTGGGG + Intronic
1182811049 22:33116788-33116810 TTGGTTGTTGAGGGGAGGTGGGG + Intergenic
1183213645 22:36465922-36465944 GTGGTTCCTGGGGGTGGGTGTGG + Intergenic
1183294130 22:37019772-37019794 CAGGTTGGTGGCGGGAGGAGGGG + Intronic
1183382824 22:37498890-37498912 GTGGGTGCTGGGGGGTGGGGGGG + Intronic
1184196439 22:42932319-42932341 GTTGGTGGTGGTGGGAGGTGTGG - Intronic
1184569221 22:45311272-45311294 GTGTTGGAAGGCGGGAGGTGTGG + Intronic
1184930370 22:47676817-47676839 GTGGCTGCTGGAGGCAGCTGGGG + Intergenic
1185080301 22:48706027-48706049 GGGGCTGCAGACGGGAGGTGGGG + Intronic
1185167313 22:49269675-49269697 GTGGGGGATGGTGGGAGGTGAGG - Intergenic
1185242004 22:49751738-49751760 GTGGGCGCTGGAGGGAGCTGAGG - Intergenic
1185262626 22:49877815-49877837 GTCTGTGCTGGCGGGAGGAGGGG - Intronic
949413693 3:3794303-3794325 GTGGGGCCTGGTGGGAGGTGGGG - Intronic
949608066 3:5676080-5676102 GTGTGTGGTGGGGGGAGGTGGGG - Intergenic
950968172 3:17161032-17161054 GGGGTTGCTGGAGGAAGCTGAGG + Exonic
951016920 3:17742201-17742223 GGGGTGGATGGCGGGAGGGGTGG - Intronic
952688501 3:36176299-36176321 GTGGCTGCTGCTGGGGGGTGGGG + Intergenic
953771103 3:45779220-45779242 GTGGTTCCTGGAAGCAGGTGGGG + Intronic
954117775 3:48476682-48476704 GTGGGTGCTGGGAGGAGGGGAGG - Intronic
954396773 3:50297184-50297206 GGGAGTGCAGGCGGGAGGTGCGG + Exonic
954692078 3:52400974-52400996 GTGGTTGCTGGCCTGAGATATGG - Intergenic
954705656 3:52479262-52479284 GTGGTGGCTGGCAGGCAGTGGGG - Intronic
954924570 3:54220996-54221018 TAGGTGGCTGGCTGGAGGTGAGG + Intronic
955045453 3:55355171-55355193 GTGGTTGCTGGGGGTAGGGGAGG - Intergenic
955358361 3:58250596-58250618 GTGGTGGCTGAGGGGAGCTGCGG + Intronic
955690880 3:61589613-61589635 GTGGTTGATGGGGTGGGGTGGGG + Intronic
957338142 3:78858762-78858784 ATGTTTTCTGGCGGGGGGTGGGG - Intronic
958813432 3:98889955-98889977 GTGGTAGATGGGGGGTGGTGAGG - Intronic
959371048 3:105526462-105526484 GGGGGTGTTGGCGGTAGGTGGGG - Intronic
960469631 3:118046594-118046616 GTGGTTGCCGGGAGGAGGGGTGG + Intergenic
961156601 3:124684938-124684960 GTGGTAGTTGGCGGGGAGTGGGG - Intronic
961322094 3:126083573-126083595 GTAGAGGCTGGCGGGAGGTCTGG + Intronic
961364061 3:126388349-126388371 GTGGTTGGTGGCGGGGGGTGGGG + Intergenic
961384422 3:126516067-126516089 GTGGGTGCTGGGGTGAGGAGGGG - Intronic
961384457 3:126516161-126516183 GTGGGTGCTGGGGTGAGGAGGGG - Intronic
961563507 3:127747218-127747240 GTGGTTGCTGCCTGGAGGCCTGG - Intronic
961736531 3:129005220-129005242 GTGGCAGCAGGCAGGAGGTGGGG + Intronic
962164447 3:133034420-133034442 GTGGATGATGTTGGGAGGTGGGG - Intergenic
962281080 3:134052429-134052451 GTGGGTGCTGGGGGGAGCTCAGG - Intergenic
963084844 3:141427376-141427398 GTGGGTGGTGGATGGAGGTGAGG + Intronic
963430555 3:145196900-145196922 GTGGCTGCTGTGGGGAGTTGGGG - Intergenic
963787456 3:149549206-149549228 GTGGTGGCTGATGGGAGTTGGGG + Intronic
964607152 3:158571716-158571738 GAGGTTGAGGGCGTGAGGTGAGG + Intronic
965322393 3:167265949-167265971 AGGGTTGCTGCCAGGAGGTGGGG + Intronic
967298440 3:187988166-187988188 GTGGGTGATGCTGGGAGGTGCGG - Intergenic
968062469 3:195736289-195736311 GGGGGTGGTGGCGGGAGGAGAGG - Intronic
968129593 3:196185067-196185089 GTGCTGGCGGGCGGGAGGTGAGG - Intergenic
968425693 4:521836-521858 CTCGTGGCTGGCGGCAGGTGGGG + Exonic
968746091 4:2361370-2361392 GTGGCTGCAGGTGGGAGGTGCGG + Intronic
968927344 4:3556467-3556489 CTGGAGGCTGGCGGGAGGTTGGG + Intergenic
969099020 4:4755107-4755129 GTGGGGGTTGGCCGGAGGTGGGG + Intergenic
969218805 4:5746050-5746072 GTGGGTGCTGGCCAGTGGTGGGG + Intronic
969255167 4:5996437-5996459 GTGGTAGCGGGGTGGAGGTGGGG - Intergenic
969375231 4:6759047-6759069 GAGGTTGCCGGGGGGAGGTAGGG + Intergenic
970961070 4:21871760-21871782 GGGGTGGGTGGGGGGAGGTGGGG - Intronic
971065036 4:23021885-23021907 GGGATTGGTGGCGTGAGGTGGGG - Intergenic
971349451 4:25843265-25843287 CTGGCTGCTGGTGGGGGGTGAGG + Intronic
972228512 4:37042997-37043019 GTAGATGGTGGCGGGAGGGGGGG + Intergenic
972253667 4:37331823-37331845 GTGGCTGCTGCTGGGAGTTGGGG - Intronic
973703421 4:53558521-53558543 ATGGGTGCTGGAGGAAGGTGGGG - Intronic
974535915 4:63174788-63174810 GTAATTGCTGGTGAGAGGTGAGG + Intergenic
975064755 4:70047265-70047287 GTGGGGGCTGGGGGGCGGTGCGG - Intergenic
976934736 4:90615949-90615971 GTGGTTGCTGAAGGGTGGAGTGG - Intronic
977314598 4:95429985-95430007 GTGGTTGCTGGGGGTTAGTGGGG + Intronic
978062843 4:104359333-104359355 GTGGGTGTTGGAGGGAAGTGGGG + Intergenic
979744414 4:124193177-124193199 GTGGTTGCTGAAGGCTGGTGAGG + Intergenic
979979490 4:127237025-127237047 GTGGCTGCAGGAGGGGGGTGAGG + Intergenic
980876122 4:138664060-138664082 GTGGAGGATGGCTGGAGGTGTGG - Intergenic
981154924 4:141423701-141423723 CTGGCTCCTGTCGGGAGGTGGGG - Intergenic
985079794 4:186252715-186252737 GTGGTTGGTGGCGGGATCGGTGG - Intronic
986153087 5:5145807-5145829 GTAGGAGCTGGTGGGAGGTGAGG + Intronic
986647567 5:9932930-9932952 GTTGTGCCTGGCAGGAGGTGGGG - Intergenic
987872804 5:23642428-23642450 CTGGTTCCTGTTGGGAGGTGGGG - Intergenic
987976436 5:25020688-25020710 ATGGTTTGTGGCTGGAGGTGGGG + Intergenic
989677254 5:43986239-43986261 GTGGGGCCTGGCGGGAGGTTGGG - Intergenic
990594429 5:57298861-57298883 GTGGGTGGTGGCTGGAGGAGAGG + Intergenic
991109800 5:62886772-62886794 GTAGTTGGTGGAGGGAGGAGTGG - Intergenic
992017651 5:72592250-72592272 GTGGATGCTAGTGGAAGGTGTGG + Intergenic
992396270 5:76372174-76372196 GAGGCTGCTGGGGTGAGGTGGGG - Intergenic
992550504 5:77855369-77855391 GGGGTTGAGGGTGGGAGGTGGGG - Intronic
993047687 5:82887058-82887080 GTGGTTGCTGGCAAGAAGAGAGG - Intergenic
993426013 5:87765004-87765026 GTGTGTGCGGGGGGGAGGTGGGG + Intergenic
993900575 5:93581618-93581640 GTGATTGGTCGCGGGAGGAGGGG - Intergenic
994937453 5:106273168-106273190 GTGGTTGCTGTAATGAGGTGAGG + Intergenic
994967316 5:106690777-106690799 GTGGTTGCTGAAGGCTGGTGTGG - Intergenic
995505425 5:112855332-112855354 GAGGCTGCTGGCTGGAGATGGGG + Intronic
995505520 5:112856180-112856202 GAGGCTGCTGGCTGGAGGTAGGG - Intronic
996322901 5:122239397-122239419 GTGGTGGCTGGAGGTAGGGGTGG - Intergenic
996384712 5:122899089-122899111 GTGGAGGCTGTCAGGAGGTGGGG - Intronic
996765463 5:127030781-127030803 GTGGCTGCCGGCGGGCGCTGCGG + Exonic
996833187 5:127762572-127762594 GTTGTTGCAGGCGGGATGTGTGG + Intergenic
997128629 5:131254188-131254210 GGGCCTGCTGGGGGGAGGTGCGG - Intronic
997930703 5:138070245-138070267 GTGGTGGCTGCCGGGCGGAGGGG - Intergenic
997943142 5:138176605-138176627 GTGCTTGCTTGGGGGTGGTGAGG + Intronic
998351451 5:141504649-141504671 GTGTTTGAGGGCGGGGGGTGGGG + Intronic
998917796 5:147034949-147034971 GTGGTAGAAGGAGGGAGGTGTGG + Intronic
999131079 5:149283858-149283880 CTGGTTGCTGGCTGGAGGTGAGG - Intronic
999290112 5:150419275-150419297 GGGGTTGCTGGGGGGCTGTGGGG + Intergenic
999524533 5:152389656-152389678 GTGGTTGCTGAAGGGTGGGGTGG + Intergenic
999798675 5:155012012-155012034 GTGGTTGCTGGGGGAATGGGGGG - Intergenic
1001273238 5:170331582-170331604 GTGGATGGTGTGGGGAGGTGGGG + Intergenic
1001776092 5:174330140-174330162 GTGTTTGCTGGTGGGAGATTAGG + Intergenic
1001966211 5:175911477-175911499 GGGGTAGCAGGGGGGAGGTGGGG + Intergenic
1002051769 5:176575449-176575471 GTGGGTGGAGGCGGGAGGCGGGG + Intronic
1002400253 5:178987641-178987663 GCAGGTGCTGGCGGGAGGAGGGG + Intronic
1002900678 6:1407358-1407380 GTGGATGCTGGAGGAGGGTGGGG + Intergenic
1003662479 6:8075672-8075694 GTGGTTGCTGGAGGTTGGGGTGG + Intronic
1004113973 6:12749288-12749310 GGGGCTGCAGGCGGGAGGCGGGG + Intronic
1005006558 6:21293020-21293042 GTTCTTGCTGGCTGGGGGTGTGG + Intergenic
1005073971 6:21889171-21889193 GTGGTTGCAGGGGGTTGGTGGGG + Intergenic
1007159646 6:39778633-39778655 GTGTTTGGTGGTGGGAGGAGGGG + Intergenic
1007358792 6:41341122-41341144 TTGGCTGTTGGCGGGTGGTGGGG - Intronic
1007829068 6:44624508-44624530 GAGGGGGCTGGCGGGGGGTGGGG + Intergenic
1008761304 6:54854436-54854458 GTGGTTGCTGAAGGGTGGGGTGG - Intronic
1009324187 6:62329654-62329676 GTGTTTGCAGGCGGTGGGTGGGG - Intergenic
1009344957 6:62602389-62602411 ATGGTAGCTGCCGGGAGCTGAGG - Intergenic
1009878256 6:69533247-69533269 GGGGTTGCTGGCTGGAGGCTGGG - Intergenic
1009966552 6:70584407-70584429 ATGGTTGCTGGGAGGAGGTGGGG - Intronic
1010545778 6:77153844-77153866 GGGGATGCTGGGTGGAGGTGGGG - Intergenic
1011589998 6:88963083-88963105 GAGGTTGGTGGCAGGAGGTGAGG - Intronic
1013009284 6:106105346-106105368 ATGAAAGCTGGCGGGAGGTGGGG - Exonic
1013615859 6:111842464-111842486 CTGGTTGCTTAAGGGAGGTGAGG - Intronic
1014380438 6:120734157-120734179 GTGGTAGAGGGAGGGAGGTGTGG + Intergenic
1015554929 6:134451540-134451562 GTGGTGGTGGGGGGGAGGTGTGG + Intergenic
1018794121 6:167172592-167172614 GTGGTTGCTGGGATGATGTGAGG - Intronic
1019473275 7:1232527-1232549 GCGGCGGCTGGCGGGAGGCGCGG + Intergenic
1019497178 7:1346098-1346120 TTGGTTGCTGTCTGGATGTGTGG + Intergenic
1019689671 7:2403629-2403651 GCGGCTGCGGGCGCGAGGTGAGG + Exonic
1019712071 7:2522343-2522365 GTGGTGGCTGGGGGGAGGGTCGG + Intronic
1020111655 7:5451249-5451271 GAGGGGGGTGGCGGGAGGTGGGG - Intronic
1020426250 7:8069337-8069359 GTGGCAGCTTGCTGGAGGTGTGG + Intronic
1020427988 7:8091495-8091517 GTGGTTTTTGGCAGGAGGTCGGG - Intronic
1021403902 7:20241793-20241815 GTGGTTGGTGTTGGGAAGTGGGG + Intergenic
1021572849 7:22083133-22083155 GTGGTCACGGGCGGGGGGTGGGG - Intergenic
1022646201 7:32230520-32230542 GTGTTTGTTGGCGGGAGTGGGGG - Intronic
1023036325 7:36134454-36134476 CTTGATGGTGGCGGGAGGTGCGG - Intergenic
1023099601 7:36702770-36702792 GTGGTTGCTGAAGGTAGGGGTGG + Intronic
1024221438 7:47291156-47291178 GTGGTTGCTTGGGGTTGGTGGGG + Intronic
1027151185 7:75734818-75734840 GTGCTTGCTGGGTGGAGGAGGGG - Intronic
1027374517 7:77537124-77537146 GCGGCTGCTGGCGGGGGGTGGGG + Intergenic
1027486769 7:78771219-78771241 GAGGTTGCTGGTGGGGGTTGGGG - Intronic
1028393029 7:90337094-90337116 GTGGTGGGTGGTGGGTGGTGGGG - Intronic
1028622087 7:92836353-92836375 GTGGAGGGTGGCGGGGGGTGGGG - Intronic
1028862998 7:95676029-95676051 GTGGTTGTGGGTTGGAGGTGGGG - Intergenic
1030310127 7:108060399-108060421 ATGGTTGGTGGCTGCAGGTGTGG + Intronic
1031200887 7:118684016-118684038 GTGGTTGCTGAGGTGAGGTGGGG - Intergenic
1032789538 7:135232278-135232300 GAGGTTGGTGGTGGGAGGTGTGG + Intronic
1033165378 7:139035310-139035332 GTGATATTTGGCGGGAGGTGGGG - Intronic
1034311783 7:150094972-150094994 ATGGTTGCTGGTGGGGGCTGGGG - Intergenic
1034504869 7:151480484-151480506 GTGGTTGCTGGTGGGGGTGGGGG + Intronic
1034795071 7:154005682-154005704 ATGGTTGCTGGTGGGGGCTGGGG + Intronic
1034938044 7:155212332-155212354 GTGGGTGGTGTGGGGAGGTGGGG + Intergenic
1035199178 7:157249243-157249265 GTGGCTGCCTGCGGGAGGTGGGG - Intronic
1035205797 7:157293076-157293098 GTCGCTGCTGGCGGCAGGAGGGG + Intergenic
1035383434 7:158455108-158455130 GTGCTGGCTGCCTGGAGGTGTGG - Intronic
1035464087 7:159063902-159063924 GGGGTTCCTGGAGGGATGTGGGG + Intronic
1035632351 8:1117666-1117688 GTGGTTGCCGGAGTGAGGGGAGG + Intergenic
1035914296 8:3601966-3601988 ATGGTGGCTGTCGGGAGATGTGG + Intronic
1036202029 8:6778054-6778076 GTGGGGCCTGGTGGGAGGTGTGG - Intergenic
1037373550 8:18205413-18205435 GTGGTTGTTCGGGGCAGGTGAGG + Intronic
1037674680 8:21043220-21043242 GTGGTGGAAGGTGGGAGGTGGGG - Intergenic
1037674689 8:21043242-21043264 GTGGAAGGTGGGGGGAGGTGGGG - Intergenic
1037674814 8:21043526-21043548 GTGGAAGGTGGGGGGAGGTGGGG - Intergenic
1037674874 8:21043649-21043671 GTGGGAGGTGGGGGGAGGTGGGG - Intergenic
1037674976 8:21043876-21043898 GTGGAAGGTGGGGGGAGGTGGGG - Intergenic
1037763217 8:21756009-21756031 CTGGCTGCTGGCTGGAGGAGTGG + Intronic
1037813988 8:22102388-22102410 GTGGTTGGGGGCTGGAGGGGTGG + Intronic
1038434035 8:27522259-27522281 GTGGCTGGTGGAGGGAGGAGAGG + Intronic
1038842464 8:31197776-31197798 GTGGTTGCCGGCGTGAGGGATGG - Intergenic
1041946955 8:63455524-63455546 GTGGATGGTGGGAGGAGGTGAGG + Intergenic
1043383884 8:79730312-79730334 GTGGTTGTTTGGGGGAGGTTTGG - Intergenic
1043383911 8:79730396-79730418 GTGGTTCCTTGGGGGAGGTTGGG - Intergenic
1044058725 8:87605707-87605729 GTGGTGGCAGGGGGAAGGTGGGG + Intronic
1044723885 8:95176558-95176580 GGGGTTGCGGTGGGGAGGTGGGG - Intergenic
1044807904 8:96027534-96027556 GTGGTTGCTGAAGGGTGGAGTGG - Intergenic
1045328759 8:101137308-101137330 AGGGTTGCTGGGGGGAAGTGTGG + Intergenic
1045714204 8:105022503-105022525 GTGGGGCCTGGTGGGAGGTGAGG - Intronic
1047000481 8:120568165-120568187 TTGGTTTCTGGCGGGTTGTGGGG - Intronic
1048471256 8:134706401-134706423 GTGGTTGCGGCCGGGAGTGGTGG + Intronic
1049037362 8:140086962-140086984 ATGGTGGCTGGAGGGAGGTGTGG - Intronic
1049199542 8:141333298-141333320 GCGGCTGGTGGAGGGAGGTGAGG + Intergenic
1049291095 8:141802360-141802382 GAGGGTGCTGGCGGGGTGTGGGG + Intergenic
1049402067 8:142432817-142432839 GTGGTTGCTGGGAGGAGGGCTGG - Intergenic
1049442552 8:142615990-142616012 GGGGATGCTGGGGGGAGCTGAGG - Intergenic
1049543230 8:143218045-143218067 GTGGGTGGTGGTGGGTGGTGTGG - Intergenic
1049543280 8:143218177-143218199 GTGGGTGGTGGTGGGTGGTGTGG - Intergenic
1049659180 8:143812096-143812118 GAGCATGCTGGCCGGAGGTGAGG - Intronic
1049797564 8:144503660-144503682 GGGGGTGCTGGGGGGAGGGGAGG - Intronic
1050295988 9:4205677-4205699 GTGGGTGCTGGCCTTAGGTGAGG - Intronic
1051262958 9:15283106-15283128 GTGGTTGCTGTGGGTAGGCGTGG - Intronic
1052337784 9:27337474-27337496 GTGAGTGCTGGCAGGAGCTGAGG - Intronic
1052757121 9:32552390-32552412 GCGGGAGCTGGCGGGAGCTGCGG - Intronic
1053047004 9:34927943-34927965 TTGGGAGCTGGGGGGAGGTGGGG + Intergenic
1053264397 9:36700076-36700098 GTGGTGGCAGGAGGAAGGTGGGG + Intergenic
1053269977 9:36743134-36743156 GTGGTTCCTAGTGGGAGGGGTGG + Intergenic
1054190502 9:61982863-61982885 CTGGAGGCTGGCGGGAGGTTGGG + Intergenic
1057200308 9:93136187-93136209 GGGGCTGCTGGCAGGACGTGTGG + Intergenic
1057250328 9:93495733-93495755 GTGGTTGCTGGAGGTTGGGGTGG + Intronic
1057274115 9:93667246-93667268 TTGGGTGCTGCCGGGTGGTGGGG - Intronic
1057484160 9:95469057-95469079 GTGGCTGCTGTAGGGAGGTGGGG + Exonic
1057548930 9:96038028-96038050 GTGGGTGGTGGTGGGAAGTGGGG + Intergenic
1057708204 9:97412574-97412596 GTGGACGCGGGCGGGAGATGCGG + Intronic
1057800208 9:98186270-98186292 GGGGTGGCTGGCGGGGGGAGGGG + Intronic
1058148633 9:101439888-101439910 GTGGTTGCTAGGGGGTGGTGGGG - Intergenic
1060311225 9:122464307-122464329 GCTGCTGCTGGCGGGCGGTGGGG - Intergenic
1060598516 9:124862333-124862355 GGGGGTGCTGACGGGAGGAGGGG + Exonic
1060648958 9:125307826-125307848 GTGGTTGCTGGAGATAGCTGAGG - Exonic
1061099287 9:128479813-128479835 GTGGTTGCTAGGGGCAGGAGTGG + Intronic
1061252900 9:129437075-129437097 GTGCGTGCCGGCGGGAGGAGGGG + Intergenic
1061263851 9:129494461-129494483 GTGGCTGTTGGCAGGGGGTGTGG + Intergenic
1061913515 9:133737548-133737570 GTGGTGGGTGGTGGGTGGTGGGG - Intronic
1062610704 9:137372193-137372215 CTGGCTGCTGGCGGGAGAGGTGG - Intronic
1203562629 Un_KI270744v1:71566-71588 GGGGTGGCTGCCGGGAGGAGGGG - Intergenic
1186220386 X:7343741-7343763 GGGGGTGCTGGCGGTAGGCGGGG - Intronic
1186519167 X:10190056-10190078 GTGGCTGCTAGAGGGAGGGGTGG + Intronic
1187165516 X:16800872-16800894 GTGGGGCCTGGTGGGAGGTGGGG + Intronic
1188470188 X:30529468-30529490 GTGGTTGCAGGTGGGAAGAGGGG - Intergenic
1189626412 X:42902010-42902032 GTGGCTGCTGGAGAGAGGGGTGG - Intergenic
1189788386 X:44580566-44580588 GTGGTTGCTGAAGGTTGGTGTGG - Intergenic
1189834464 X:45005974-45005996 GTGGTGGGTGGTGGGGGGTGGGG - Intronic
1189834469 X:45005981-45006003 GTGGTGGGTGGTGGGTGGTGGGG - Intronic
1190171908 X:48117838-48117860 GTGGTTGCTGAAGGGTGGAGTGG + Intergenic
1190177501 X:48163192-48163214 GTGGTTGCTGAAGGGTGGAGTGG + Intergenic
1190180673 X:48189429-48189451 GTGGTTGCTGAAGGGTGGAGTGG - Intronic
1190189451 X:48264601-48264623 GTGGTTGCTGAAGGGTGGAGTGG + Intronic
1190210146 X:48439814-48439836 GTGGTTGCTGAAGGGTGGAGTGG + Intergenic
1190274563 X:48891671-48891693 GTGGTTGTAGGAAGGAGGTGGGG + Intergenic
1190660237 X:52647561-52647583 GTGGTTGCTGAAGGGTGGAGTGG - Intronic
1190666361 X:52699731-52699753 GTGGTTGCTGAAGGGTGGAGTGG - Intronic
1190673057 X:52758679-52758701 GTGGTTGCTGAAGGGTGGAGTGG + Intronic
1190709403 X:53055598-53055620 GTGGGTGCTTGTGGGTGGTGTGG + Intronic
1190730241 X:53221071-53221093 GTGAGTTCTGGGGGGAGGTGGGG - Intronic
1192046121 X:67675645-67675667 GTGGTTGCTGCTGGGGGCTGGGG + Intronic
1193127988 X:77889922-77889944 GGGGGTGGTGGTGGGAGGTGGGG - Intronic
1193593562 X:83419508-83419530 GTGGTTGCTGAGGGCAGGGGAGG - Intergenic
1195090244 X:101451426-101451448 GTGGCTGCTGCCAGGAGATGGGG + Intronic
1195939169 X:110153189-110153211 GAGGCAGCTGGCGGGAGCTGGGG - Intronic
1196399693 X:115300778-115300800 GTCATTGCTGCCGGGAGTTGGGG + Intronic
1197740324 X:129886980-129887002 GTTGTTTATGGCTGGAGGTGGGG + Intergenic
1198281012 X:135142587-135142609 GTGGTTGCCGGAGGGTGGAGTGG + Intergenic
1198289946 X:135229929-135229951 GTGGTTGCCGGAGGGTGGAGTGG - Intergenic
1199248306 X:145631755-145631777 GTCGTCGCTGGCGGGAGCTGGGG - Intergenic
1200058182 X:153472417-153472439 GTGGTGGGTGGTGGGTGGTGGGG - Intronic
1200104989 X:153707118-153707140 AGGGTTTCTGGGGGGAGGTGAGG - Intronic