ID: 1105829789

View in Genome Browser
Species Human (GRCh38)
Location 13:24153832-24153854
Sequence TGGAATTCATCCCTTGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 315}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105829789 Original CRISPR TGGAATTCATCCCTTGGGGT TGG Intronic
901772592 1:11537903-11537925 TGGAATGAATCCCTGAGGGTGGG + Intergenic
902905093 1:19550630-19550652 AGGAATGCATTCCTGGGGGTAGG - Intergenic
906577138 1:46901232-46901254 AGGAATGCATTCCTGGGGGTAGG + Intergenic
906577911 1:46907544-46907566 AGGAATGCATTCCTGGGGGTAGG + Intergenic
907793774 1:57693872-57693894 TGGAATTTATTCCTTCTGGTGGG - Intronic
907877196 1:58502837-58502859 TGAATTTAATCACTTGGGGTGGG + Intronic
909684329 1:78329442-78329464 CCTAATTCTTCCCTTGGGGTGGG + Intronic
910024092 1:82628210-82628232 CTCAATTCTTCCCTTGGGGTGGG + Intergenic
910115108 1:83723547-83723569 TGGAATTCCTCCCCTGGGGTAGG + Intergenic
910159455 1:84257902-84257924 TGGAATTCTTCTCTTGCAGTGGG - Intergenic
911718716 1:101166496-101166518 TCTGATTCTTCCCTTGGGGTGGG - Intergenic
912112370 1:106358739-106358761 AGGAATGCATTCCTGGGGGTAGG - Intergenic
913025512 1:114833931-114833953 CCTGATTCATCCCTTGGGGTGGG + Intergenic
914385010 1:147160252-147160274 TGGAATTGATCCATTGGATTGGG - Intronic
914419620 1:147517449-147517471 CGGAATTCATTCCTTCTGGTGGG + Intergenic
915338980 1:155166163-155166185 TGGCTTTCAGCCCTGGGGGTGGG + Intergenic
916122043 1:161537244-161537266 AGGAATGCATTCCTGGGGGTAGG + Intergenic
916131932 1:161618669-161618691 AGGAATGCATTCCTGGGGGTAGG + Intronic
917170025 1:172161925-172161947 TGAGATTTATCCGTTGGGGTTGG + Intronic
917293134 1:173492228-173492250 TGGAATCAATCCCTGAGGGTAGG - Intergenic
917765187 1:178208351-178208373 AGGAATGCATTCCTTGGGGGAGG + Intronic
917766967 1:178230849-178230871 TTTGATTCTTCCCTTGGGGTAGG + Intronic
917840835 1:178976185-178976207 TGGAGTTTATTCCTTGCGGTGGG - Intergenic
917840849 1:178976318-178976340 TGGAATTTATCCCTTCTTGTGGG - Intergenic
918199446 1:182253575-182253597 TCTGATTCTTCCCTTGGGGTGGG - Intergenic
918939892 1:190979929-190979951 TGGAATTTATTCCTTCCGGTGGG + Intergenic
920909013 1:210196602-210196624 AGGAATGCATTCCTGGGGGTAGG - Intergenic
921354718 1:214275260-214275282 TGGAATTTATTCCTTCCGGTGGG + Intergenic
921365561 1:214370401-214370423 TGGATTTCATCCCATGGGCACGG + Intronic
921707924 1:218345598-218345620 TGGAATTGCTCGCTTAGGGTAGG - Intergenic
922129874 1:222767014-222767036 AGAAATTCATTCCTTGTGGTAGG - Intergenic
922630065 1:227097841-227097863 TCTGATTCTTCCCTTGGGGTGGG - Intronic
922873966 1:228925470-228925492 TTGGATTCTTCCCTTGGGGTGGG - Intergenic
922875373 1:228936241-228936263 TCTGATTCTTCCCTTGGGGTGGG - Intergenic
923896318 1:238274275-238274297 TGGTTTTCATCCCATCGGGTAGG + Intergenic
1064602878 10:17011194-17011216 TGGAATTTATTCCTTCTGGTGGG + Intronic
1064757628 10:18586255-18586277 TGGAATTTATTCCTTCTGGTGGG + Intronic
1065534873 10:26707080-26707102 CCGGATTCTTCCCTTGGGGTGGG + Intronic
1066658578 10:37718234-37718256 AGGAATGCATTCCTGGGGGTAGG + Intergenic
1067965162 10:50904135-50904157 TGGAATATATACCTAGGGGTGGG - Intergenic
1068372304 10:56132441-56132463 TGGAATTCAATCTGTGGGGTGGG + Intergenic
1068497069 10:57796176-57796198 CCTAATTCTTCCCTTGGGGTGGG - Intergenic
1069024665 10:63525933-63525955 TGTATTTAATCCCATGGGGTAGG - Intronic
1069103987 10:64360300-64360322 AGGAATGCATTCCTGGGGGTAGG + Intergenic
1069698638 10:70405753-70405775 TAGATTTTATCCCTTGGTGTTGG - Intronic
1069895590 10:71678476-71678498 TGGGTCCCATCCCTTGGGGTAGG - Intronic
1072708839 10:97702234-97702256 TGGATTTCAGCCCTGGGGGAAGG + Intergenic
1073532946 10:104249477-104249499 TGGAATTTATTCCTTCCGGTGGG - Intronic
1073956570 10:108878410-108878432 TGGAACTAATCCCTTGTGGAAGG - Intergenic
1074161672 10:110841057-110841079 TGGAGTTGATCCCTGGGGATAGG - Intergenic
1074865160 10:117540606-117540628 TTGGATCCAGCCCTTGGGGTAGG - Intergenic
1075166203 10:120070474-120070496 TAGGATTAATTCCTTGGGGTTGG - Intergenic
1076067541 10:127460695-127460717 TGGCAGTCCTCCCTTGGGGAGGG - Intergenic
1078804558 11:14684709-14684731 AGGAATGCATCCCTGGGGGGAGG - Intronic
1079443546 11:20538923-20538945 AGGAATGCATTCCTGGGGGTAGG + Intergenic
1080332031 11:31149921-31149943 CGGAATTTATTCCTTCGGGTGGG - Intronic
1080708424 11:34721576-34721598 TGGAATTCATTCCTTATGGAAGG + Intergenic
1081634772 11:44713792-44713814 GGGAATGAATCCCTTGGGCTAGG - Intergenic
1082047878 11:47745364-47745386 AGGAATGCATTCCTGGGGGTAGG + Intronic
1082192765 11:49267163-49267185 TGTGATTCTTCCCTTAGGGTGGG - Intergenic
1082299422 11:50488372-50488394 AGGAATTCATTCCCAGGGGTAGG - Intergenic
1082861858 11:57864340-57864362 TTTGATTCTTCCCTTGGGGTGGG - Intergenic
1083125869 11:60565134-60565156 TGGAATTTATTCCTTCTGGTGGG - Intergenic
1083550064 11:63581362-63581384 AGGAATGCATTCCTGGGGGTAGG + Intronic
1083622686 11:64056820-64056842 TGGAGGTCATCCCAGGGGGTGGG - Intronic
1084223402 11:67699014-67699036 AGGAATGCATTCCTTGGGGGAGG + Intergenic
1084521250 11:69664391-69664413 TGGATTGCATCCCTTGCGGTTGG - Intronic
1084652980 11:70499892-70499914 TTTAATTAATCCCTTGGAGTTGG - Intronic
1085947148 11:81285401-81285423 AGGAATTCATTCCTGGGGGAAGG + Intergenic
1087459288 11:98424543-98424565 TGGAATTTATTCCTTCCGGTGGG + Intergenic
1089121277 11:116137354-116137376 GGGAACACATCCCTGGGGGTGGG + Intergenic
1091250373 11:134139400-134139422 TGGAACTCTTCCCTTCGGGACGG - Intronic
1092530109 12:9336870-9336892 AGGAATTCATTCCTGGGGGGAGG - Intergenic
1093658455 12:21724915-21724937 TCGAAGTCATCCATTAGGGTTGG - Intronic
1095413806 12:41953440-41953462 TGGAATTGCTGCCTTGGGGAGGG + Intergenic
1098594399 12:72255213-72255235 TGGAAGTCCTCTCTTGGGATTGG - Intronic
1098747234 12:74254068-74254090 AGGAATGCATTCCTGGGGGTAGG - Intergenic
1098805047 12:75012850-75012872 TGGAATTCTTTCATTGGGTTTGG + Intergenic
1103554929 12:121760426-121760448 TCTGATTCTTCCCTTGGGGTGGG + Intronic
1104262925 12:127201418-127201440 TGTAATTGTTGCCTTGGGGTTGG - Intergenic
1104264383 12:127217969-127217991 TGGAATTTATTCCTTCTGGTGGG + Intergenic
1105829789 13:24153832-24153854 TGGAATTCATCCCTTGGGGTTGG + Intronic
1106369371 13:29116780-29116802 TGGGAATCATCCCTTGGTCTGGG - Intronic
1106532610 13:30607979-30608001 TGGTATTCATACCTTTGTGTAGG + Intronic
1107853644 13:44593733-44593755 TGAAATTCATTCCTTCCGGTGGG + Intergenic
1108845849 13:54677816-54677838 TGGAATTTATTCCTTCTGGTGGG - Intergenic
1110937334 13:81307434-81307456 TGTGATTCTTCCCTTAGGGTGGG - Intergenic
1111043172 13:82778468-82778490 TCTAATTCTTCCCTTGGGCTGGG + Intergenic
1111882212 13:93971833-93971855 TGGTGATCATTCCTTGGGGTTGG - Intronic
1117216429 14:53557169-53557191 TGGAATTCTTCCATTGGTTTTGG + Intergenic
1117929476 14:60824950-60824972 TGGAATTGATCCAATGGGGTGGG - Intronic
1118597362 14:67446260-67446282 TGGAATTCTGCTCTTGGGGCAGG - Intergenic
1119545297 14:75467577-75467599 TGGAACTAAGCCCTTGGGCTGGG + Intronic
1119869260 14:78001367-78001389 AGGAATTCATTCCTGGGGGGAGG + Intergenic
1120160464 14:81139915-81139937 TGGAATTCATTTCTTGGTTTTGG + Intronic
1120484483 14:85094357-85094379 GTGAATTCATCACTTGGAGTAGG + Intergenic
1121261850 14:92572187-92572209 TGGGCTTCTTCCCCTGGGGTGGG + Intronic
1121409281 14:93738062-93738084 TTGGATTCAGCCCGTGGGGTGGG + Intronic
1122739882 14:103866163-103866185 TGGAATGAGGCCCTTGGGGTGGG + Intergenic
1124087707 15:26566883-26566905 TGCAATCCATCCCTTTGGATAGG - Intronic
1125298204 15:38225469-38225491 TTGTATACATCCCTTGGGGTTGG + Intergenic
1126255255 15:46617787-46617809 AGGAATTCATCTCTTGTGGTAGG - Intergenic
1129693198 15:77725192-77725214 GGGAATTCAGCCATGGGGGTTGG + Intronic
1130882233 15:88065263-88065285 TGGATTTCTTCCCCTGGTGTTGG - Intronic
1131287160 15:91069792-91069814 CCGCATTCTTCCCTTGGGGTGGG + Intergenic
1131483473 15:92801559-92801581 TGGCTTTCATGCCTTGGAGTTGG - Intronic
1131670607 15:94615705-94615727 TCCATTCCATCCCTTGGGGTCGG + Intergenic
1132205116 15:99981093-99981115 TGGAATTCATTCCATGAGATGGG - Intronic
1134369042 16:13606545-13606567 TGTAATTCCTCCCTTAGCGTGGG - Intergenic
1134807568 16:17138923-17138945 TGGAATTTCACCCCTGGGGTAGG + Intronic
1135093670 16:19543688-19543710 AGGAATGCATCCCTGGGGGGAGG + Intronic
1135202821 16:20453760-20453782 AGGAATGCATTCCTGGGGGTAGG + Intronic
1135216276 16:20574106-20574128 AGGAATGCATTCCTGGGGGTAGG - Intronic
1135601197 16:23785034-23785056 TGGAGTCCCTCCCTTGGGGAAGG + Intergenic
1137444564 16:48523874-48523896 TGGAATTCAGCTCCTTGGGTGGG - Intergenic
1137616533 16:49851413-49851435 TGGAATTCTTCCCCTGATGTAGG - Intronic
1139142192 16:64280039-64280061 TGGAATTTATTCCTTCTGGTGGG + Intergenic
1140060164 16:71562140-71562162 AGGAATTCATTCCTGGGGGTAGG - Intronic
1140185995 16:72772667-72772689 TGGAATTTATTCCTTTTGGTGGG - Intergenic
1141209776 16:81966904-81966926 TGAAATTGATGCCATGGGGTGGG - Intergenic
1141384841 16:83611327-83611349 TGAAATTAAACCTTTGGGGTAGG - Intronic
1147381867 17:40061092-40061114 TGGAACTAGTCCCTTGGGATTGG - Intronic
1148386782 17:47239850-47239872 GGGAACACAGCCCTTGGGGTAGG + Intergenic
1149174985 17:53858878-53858900 AGGAATGCATTCCTGGGGGTAGG + Intergenic
1149284462 17:55146995-55147017 TGGAATTCATACTTTTAGGTAGG - Intronic
1149762228 17:59242833-59242855 GGGAATTCATCCCTTGTGCAGGG - Intronic
1151422063 17:74005181-74005203 AGGAAGTCATCCCTTGGGCTGGG - Intergenic
1151675406 17:75594968-75594990 TTGAGGTCACCCCTTGGGGTGGG + Intergenic
1152227622 17:79099866-79099888 TGGAATTCATCAGTTGGGGGTGG - Intronic
1153438479 18:5091178-5091200 TGGAATTTATTCCTTCCGGTGGG - Intergenic
1153889878 18:9503008-9503030 AGGAATTCATTCCTGGGGGGAGG + Intronic
1153971291 18:10229428-10229450 TGGAATTCATAACTGGGGGAGGG + Intergenic
1154112943 18:11585962-11585984 TGTGATTCTTCCCTTGGGGTGGG - Intergenic
1154276010 18:12961073-12961095 TCTGATTCTTCCCTTGGGGTGGG + Intronic
1157558584 18:48630276-48630298 TGGAATGGATCCCTCAGGGTTGG + Intronic
1157643759 18:49245442-49245464 AGGAATGCATTCCTGGGGGTAGG + Intronic
1157758643 18:50242005-50242027 AGGAATGCATTCCTGGGGGTAGG - Intronic
1158601793 18:58862902-58862924 TGGAAGACACCCCCTGGGGTGGG - Exonic
1158812934 18:61058650-61058672 CCTGATTCATCCCTTGGGGTGGG + Intergenic
1159347707 18:67228213-67228235 AGGAATGCATTCCTGGGGGTAGG + Intergenic
1159803226 18:72925499-72925521 TGGAGTTCATCTCTGGGAGTAGG + Intergenic
1161371359 19:3913707-3913729 TGAAATGCAACCCATGGGGTGGG - Intronic
1161455122 19:4366140-4366162 TGGACTTCACCTCTTGGGCTTGG - Intronic
1162440861 19:10691292-10691314 TGGAATCCATCCCTCGTGGTGGG - Exonic
1162684135 19:12367622-12367644 AGGAATGCATTCCTGGGGGTAGG - Intergenic
1163941660 19:20500745-20500767 AGGAATTCATTCCTGGGGGGAGG - Intergenic
1163942650 19:20509242-20509264 AGGAATTCATTCCTGGGGGGAGG - Intergenic
1164332231 19:24270746-24270768 GAGAATGCATCCCTTGGGGTAGG + Intergenic
1165685400 19:37815709-37815731 AGGAATGCATTCCTGGGGGTAGG + Intronic
1166359335 19:42246306-42246328 TGTAAGTCATTCCCTGGGGTGGG - Intronic
1166663375 19:44661877-44661899 GGGTCTTCATCCATTGGGGTCGG - Exonic
1166917844 19:46207905-46207927 TGGGAGTCCTCCCTTGGGATTGG - Intergenic
1166920152 19:46223719-46223741 TGGGAGTCCTCCCTTGGGATTGG - Intergenic
1168712165 19:58507744-58507766 AGGAATTCATTCCTGGGGGGAGG + Intronic
927377739 2:22437764-22437786 TGGCATTCCTCCCTTGCTGTGGG - Intergenic
927640070 2:24840589-24840611 TGGACTCCATCCCATGGGGGAGG + Intronic
928300325 2:30118605-30118627 TGCAAGTCATCCCTGGGGGCAGG + Intergenic
929350201 2:40941706-40941728 AGGAATTCATTCCTGGGGGGAGG + Intergenic
932609968 2:73191597-73191619 TAGAATCCATCCCTTTGGTTTGG + Intergenic
933342562 2:81040783-81040805 TGGAATTTATTCCTTCTGGTGGG - Intergenic
935261466 2:101359263-101359285 TCTGATTCTTCCCTTGGGGTGGG + Intronic
935300051 2:101686154-101686176 CCTAATTCTTCCCTTGGGGTGGG + Intergenic
937591538 2:123618866-123618888 AGGAATGCATTCCTGGGGGTAGG - Intergenic
937838371 2:126497377-126497399 AGGAATTCATTCCTGGGGGGAGG - Intergenic
938634330 2:133206815-133206837 AGGAATGCATTCCTGGGGGTAGG + Intronic
940276131 2:151942683-151942705 AGGAATTCATTCCTGGGGGGAGG + Intronic
941567124 2:167123262-167123284 TTTAATTCATCCATTGGGGGTGG + Intronic
942737586 2:179133285-179133307 TGGAAGGCATAACTTGGGGTGGG - Intronic
943903043 2:193465658-193465680 TCTGATTCCTCCCTTGGGGTGGG + Intergenic
943905132 2:193489850-193489872 CCTAATTCTTCCCTTGGGGTGGG - Intergenic
946125789 2:217561539-217561561 AGGAATGCATTCCTGGGGGTAGG + Intronic
946151452 2:217775030-217775052 TGGAACTCATCCATTTTGGTGGG + Intergenic
947219824 2:227781517-227781539 CCGGATTCTTCCCTTGGGGTAGG - Intergenic
948014106 2:234673824-234673846 TGGACTTCATACCTGGGGGCTGG - Intergenic
948672332 2:239576430-239576452 TGGATTCCACCCCTTGGTGTGGG + Intergenic
1169004676 20:2196709-2196731 TGGAGTTCCTGCCTTGGGTTGGG - Intergenic
1169447927 20:5688018-5688040 TGTAATTCATCACATGGAGTGGG - Intergenic
1173498969 20:43538814-43538836 TGGGTTTCATACCCTGGGGTGGG - Intronic
1176333977 21:5578374-5578396 TGTAATTAAACCCTTAGGGTGGG + Intergenic
1176393780 21:6242578-6242600 TGTAATTAAACCCTTAGGGTGGG - Intergenic
1176458204 21:6931148-6931170 AGGAATGCATTCCTGGGGGTAGG - Intergenic
1176467639 21:7073596-7073618 TGTAATTAAACCCTTAGGGTGGG + Intronic
1176491200 21:7455374-7455396 TGTAATTAAACCCTTAGGGTGGG + Intergenic
1176509442 21:7683009-7683031 TGTAATTAAACCCTTAGGGTGGG - Intergenic
1176836378 21:13796243-13796265 AGGAATGCATTCCTGGGGGTAGG - Intergenic
1177665856 21:24158342-24158364 TGGAATGCATCCCTTTTGATAGG - Intergenic
1178115790 21:29415073-29415095 TGGAATACTTCCCATGTGGTGGG + Intronic
1178971432 21:37181320-37181342 TGGGATCCATCCCTTTGGCTGGG - Intronic
1179518452 21:41926115-41926137 TGGAGTTCTTCCCTGGGGCTGGG - Intronic
1179915514 21:44475496-44475518 TGTGATTCTTCCCTTGGGGTGGG - Intergenic
1180825505 22:18858232-18858254 TGGCCTTCCTGCCTTGGGGTTGG - Intronic
1181187227 22:21116315-21116337 TGGCCTTCCTGCCTTGGGGTTGG + Intergenic
1181211971 22:21294178-21294200 TGGCCTTCCTGCCTTGGGGTTGG - Intergenic
1181500276 22:23312083-23312105 TGGCCTTCCTGCCTTGGGGTTGG + Intronic
1182820665 22:33213100-33213122 TCAAATTCATCCCTGAGGGTTGG - Intronic
1184802912 22:46773439-46773461 TGGAGTGCTTCCCTTGGGCTAGG + Intronic
1203214983 22_KI270731v1_random:1254-1276 TGGCCTTCCTGCCTTGGGGTTGG + Intergenic
952293799 3:32043158-32043180 AGGAATGCATTCCTTGGGGGAGG - Intronic
952675840 3:36029390-36029412 TATGATTCTTCCCTTGGGGTGGG + Intergenic
952993187 3:38850619-38850641 TGGATTTCATGGCTTTGGGTTGG + Exonic
954272362 3:49519646-49519668 TGGAAGGCATCCTTGGGGGTGGG + Intronic
954712728 3:52513037-52513059 AGGCACTCACCCCTTGGGGTGGG + Intronic
954738654 3:52728802-52728824 AGGAATGCATCCCTGGGGGGAGG + Intronic
957090721 3:75727498-75727520 AGGAATGCATTCCTGGGGGTAGG + Intronic
957279900 3:78137100-78137122 TCTGATTCTTCCCTTGGGGTGGG + Intergenic
957315855 3:78575598-78575620 ACGGATTCCTCCCTTGGGGTGGG + Intergenic
958601754 3:96302995-96303017 TGGAATTTATTCCTTCTGGTGGG - Intergenic
959649504 3:108737923-108737945 CATAATTCATCCCTTAGGGTGGG - Intergenic
959729412 3:109583877-109583899 AGGAATGCATTCCTGGGGGTAGG + Intergenic
961028126 3:123578964-123578986 TGGAAGTAATCCCTTGGACTGGG - Intronic
963103855 3:141628952-141628974 TGGAATTTATTCCTTCTGGTGGG - Intergenic
963409504 3:144909299-144909321 TGGAATTTATTCCTTCTGGTGGG + Intergenic
963431114 3:145205024-145205046 TGGAATTTATTCCTTCTGGTGGG + Intergenic
963458807 3:145579439-145579461 TCTGATTCTTCCCTTGGGGTGGG + Intergenic
964613003 3:158633657-158633679 AGGAATGCATTCCTGGGGGTAGG - Intergenic
965424033 3:168499183-168499205 TTGAATTTAACCCTTGGTGTTGG - Intergenic
967143870 3:186589236-186589258 TGGAATGCCTCTCTTGGGATAGG + Intronic
967359346 3:188611837-188611859 TGGAACCCATCCATTGGTGTAGG + Intronic
967702003 3:192604003-192604025 AGGAATTCATTCCTGGGGGGAGG - Intronic
967951405 3:194843966-194843988 TTGAAGTCATCCTTAGGGGTGGG - Intergenic
968342439 3:197967812-197967834 AGGAATGCATTCCTTGGGGGAGG - Intronic
968798937 4:2729361-2729383 CCCAATTCCTCCCTTGGGGTGGG - Intronic
971519760 4:27534147-27534169 AGGAATTAATTCCTAGGGGTAGG - Intergenic
971589319 4:28446947-28446969 TGGGAGTCTTCCCTTGGGATTGG - Intergenic
972329837 4:38054847-38054869 TCTGATTCTTCCCTTGGGGTGGG + Intronic
972996600 4:44886513-44886535 TTGTATTCATCCCTAGGGGATGG - Intergenic
973315149 4:48751895-48751917 TGGGATTCATCCCATGGGTCTGG - Intronic
975752628 4:77539494-77539516 TCTAATTCTTCCCTTGGGGTGGG + Intronic
977927653 4:102719193-102719215 AGGAATGCATTCCTGGGGGTAGG - Intronic
978734771 4:112073311-112073333 AGGAATGCATTCCTTGGGGGAGG + Intergenic
980046662 4:127996749-127996771 AGGAATACATTCCTGGGGGTAGG - Intronic
980810740 4:137875905-137875927 TGTGATTCTTCCCTTGGGATGGG + Intergenic
982876982 4:160662800-160662822 TGGAATTTATTCCTTCCGGTGGG - Intergenic
983190925 4:164752695-164752717 AGGAATGCATTCCTTGGGGGAGG + Intergenic
983904938 4:173172227-173172249 CGTGATTCTTCCCTTGGGGTGGG + Intronic
984474003 4:180214693-180214715 TTATATTCATCCCTTGGGGCTGG + Intergenic
984575064 4:181438458-181438480 GGGAAGTCCTCCCTTGGGATTGG - Intergenic
985298478 4:188460567-188460589 TGGAATTTATTCCTTCTGGTGGG - Intergenic
986358194 5:6949430-6949452 TGGTATCCATCCCTGGAGGTTGG + Intergenic
987096802 5:14557466-14557488 TCTGATTCTTCCCTTGGGGTGGG - Intergenic
989432921 5:41376185-41376207 TGGATGACATCCCTTGGAGTTGG - Intronic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
991404592 5:66289557-66289579 TAGAAATCCTGCCTTGGGGTTGG + Intergenic
993533329 5:89050210-89050232 AGGAATTCATTCCTGGGGGGAGG + Intergenic
994773419 5:104012951-104012973 TGGAATTTATTCCTTCCGGTGGG + Intergenic
995804054 5:116031070-116031092 TGGAATTCATCACTTGATGAAGG - Intronic
995904718 5:117109811-117109833 TGGAATTTATGTCTTGGGGCAGG - Intergenic
996906782 5:128610098-128610120 TCTGATTCTTCCCTTGGGGTGGG + Intronic
998446568 5:142203417-142203439 TGGAATGCATCCATTTGGGAAGG - Intergenic
998969986 5:147580554-147580576 AGGAATGCATTCCTGGGGGTAGG + Intergenic
1000237950 5:159380270-159380292 AGGAATGCATTCCTGGGGGTAGG - Intergenic
1000766600 5:165299351-165299373 TCTGATTCTTCCCTTGGGGTGGG + Intergenic
1002666413 5:180828896-180828918 AGGAATGCATTCCTGGGGGTAGG + Intergenic
1003950578 6:11111792-11111814 TGGATTTTTTTCCTTGGGGTGGG + Intronic
1004291810 6:14374352-14374374 TCTGATTCTTCCCTTGGGGTGGG + Intergenic
1006221267 6:32494102-32494124 TGGAATTTATTCCTTCTGGTGGG - Intergenic
1006473637 6:34241892-34241914 TGGAATTCAGAGCCTGGGGTGGG + Intronic
1006925086 6:37649536-37649558 TGCATTTCATTGCTTGGGGTGGG - Intronic
1007127321 6:39437664-39437686 TGGAATTCATCTCTAATGGTGGG - Intronic
1008090961 6:47293373-47293395 TGGAATTCAGCCCTTCATGTAGG + Intronic
1010773261 6:79857132-79857154 TCTGATTCTTCCCTTGGGGTAGG + Intergenic
1013920964 6:115402912-115402934 AGGAATGCATTCCTTGGGGGAGG - Intergenic
1014974533 6:127862714-127862736 TAGAATTCATCTCCTGGGGCTGG - Intronic
1016634357 6:146270585-146270607 AGGAATTCAAACCTTGGGTTGGG - Intronic
1016846722 6:148575299-148575321 TGGAACTCTTTCCTTGGGGTTGG - Intergenic
1018716545 6:166537119-166537141 TGGAATACATCCCATGGCGGAGG - Intronic
1018811727 6:167303095-167303117 TGGAATGAACCCCTTTGGGTGGG + Intronic
1022803353 7:33797091-33797113 TGGAATTTATTCCTTCCGGTGGG + Intergenic
1024920767 7:54551900-54551922 TGGAATTCTTCACTTGGAATAGG - Intronic
1025108931 7:56196511-56196533 AGGAATGCATTCCTGGGGGTAGG - Intergenic
1026221793 7:68404852-68404874 AGTAATTCTTCCCTTGGGGTAGG + Intergenic
1029050479 7:97681478-97681500 TGGAATTCATCCCAAGAGGGTGG + Intergenic
1030420190 7:109299647-109299669 TGGAATTTATTCCTTCCGGTGGG - Intergenic
1031763044 7:125738023-125738045 AGGAATGCATTCCTGGGGGTAGG - Intergenic
1034102523 7:148462689-148462711 AGGAATGCATCCCTGGGGGAAGG + Intergenic
1034464143 7:151215863-151215885 TGGAATTCCTGCCAGGGGGTGGG + Intronic
1034916493 7:155044223-155044245 CGCGATTCTTCCCTTGGGGTGGG - Intergenic
1039055580 8:33533720-33533742 CCTGATTCATCCCTTGGGGTGGG - Intergenic
1039331049 8:36536926-36536948 AGGAATGCATTCCTGGGGGTAGG - Intergenic
1040489832 8:47909702-47909724 AGGAATGCATTCCTAGGGGTAGG + Intronic
1040499447 8:47993997-47994019 AGGAATGCATTCCTGGGGGTAGG - Intergenic
1041287479 8:56275286-56275308 AGGAATGCATTCCTGGGGGTAGG + Intergenic
1041391205 8:57348965-57348987 TGGAAAGCATCCATTGGGCTGGG + Intergenic
1041435940 8:57841778-57841800 TGGAATTTATTCCTTCTGGTGGG - Intergenic
1042319454 8:67459710-67459732 TGGAATTCATTCTATGGGTTTGG - Intronic
1042747739 8:72125774-72125796 TCTAATTCTTCCCTTGGGGTGGG - Intergenic
1043144965 8:76641706-76641728 AGGAATGCATTCCTGGGGGTAGG - Intergenic
1044039104 8:87343038-87343060 AGGAATGCATTCCTGGGGGTAGG - Intronic
1044070282 8:87751757-87751779 AGGAATGCATTCCTGGGGGTAGG - Intergenic
1044262713 8:90146155-90146177 TGGAATGTATACCTTGTGGTTGG + Intergenic
1044363078 8:91310778-91310800 TGTGATTCTTCCCTTGGAGTGGG - Intronic
1044731535 8:95232297-95232319 TGGCATTCAGCCCTTATGGTAGG + Intergenic
1045832637 8:106482316-106482338 TTGAATGGATCCCTTGGGGAGGG - Intronic
1045912404 8:107425803-107425825 TGGAAACCAGCTCTTGGGGTTGG - Intronic
1045913173 8:107434403-107434425 TGAAATACTTCGCTTGGGGTTGG + Intronic
1048639188 8:136333894-136333916 CATAATTCTTCCCTTGGGGTGGG - Intergenic
1048649306 8:136456436-136456458 TTGAATTCATCCCTGGGCCTTGG - Intergenic
1049874632 8:145008327-145008349 TCTGATTCCTCCCTTGGGGTGGG + Intergenic
1049933150 9:475326-475348 CCCAATTCTTCCCTTGGGGTGGG - Intronic
1051598809 9:18851672-18851694 TCTGATTCTTCCCTTGGGGTGGG + Intronic
1052290155 9:26830910-26830932 TGGAATTTATTCCTTCTGGTGGG - Intergenic
1052831227 9:33217508-33217530 TGGATCTCAGCCCTTGGGGTGGG + Intergenic
1052881602 9:33604061-33604083 TGGGATTCCTCCCTTGGTTTTGG + Intergenic
1053494716 9:38541776-38541798 TGGGATTCCTCCCTTGGTTTTGG - Intronic
1053598793 9:39589841-39589863 CGGAATTTATTCCTTGTGGTGGG + Intergenic
1053856545 9:42344362-42344384 CGGAATTTATTCCTTGTGGTGGG + Intergenic
1055891870 9:81132321-81132343 TGGGTTTCATCCTTTGTGGTAGG - Intergenic
1056082717 9:83113606-83113628 AGGAATGCATTCCTTGGGGGAGG + Intergenic
1056739689 9:89243687-89243709 CCTAATTCTTCCCTTGGGGTGGG + Intergenic
1056981816 9:91319763-91319785 TGTGATTCTTCCCTTGGGGTGGG - Intronic
1058141789 9:101364155-101364177 CAGAATTTATCCCTTGGGGCTGG - Intronic
1058225448 9:102356120-102356142 AGGAATGCATTCCTTGGGGGAGG + Intergenic
1058542858 9:106030196-106030218 AGGAATGCATCCCTGGGGGTAGG + Intergenic
1059105933 9:111511627-111511649 AGGAATGCATTCCTGGGGGTAGG + Intergenic
1059523183 9:114963082-114963104 AGGAATTCATTCCTCGGGGGAGG - Intergenic
1061230943 9:129315520-129315542 TGGAATTTATCCCAGGGGGCTGG - Intergenic
1186321933 X:8437128-8437150 TCTGATTCTTCCCTTGGGGTGGG + Intergenic
1186395403 X:9203498-9203520 TTGAATTCATCCATGAGGGTTGG - Intergenic
1186568690 X:10691878-10691900 AGGAATGCATTCCTTGGGGGAGG + Intronic
1187349034 X:18494681-18494703 TGGATTTCCTCCCTTGTGGAAGG + Intronic
1187474297 X:19596919-19596941 TGAAAGTCATCCCTGAGGGTTGG + Intronic
1188053519 X:25514632-25514654 AGGCATTCAACCCTTTGGGTAGG + Intergenic
1188610206 X:32086521-32086543 TGGCATTCATCCTTTGTTGTTGG + Intronic
1188624723 X:32269267-32269289 CCCAATTCTTCCCTTGGGGTAGG - Intronic
1188914389 X:35891520-35891542 TGGATTTCAACCCTAGGGGAGGG + Intergenic
1189260607 X:39676016-39676038 GGGAATGTTTCCCTTGGGGTGGG - Intergenic
1192059744 X:67811913-67811935 TAGAATGCATCCCTGAGGGTAGG - Intergenic
1192695564 X:73411910-73411932 TGGATTTCATCACGTGGGTTTGG + Intergenic
1192842504 X:74871615-74871637 AGGAATGCATTCCTGGGGGTAGG - Intronic
1193441386 X:81543773-81543795 AGGAATGCATTCCTTGGGGGAGG + Intergenic
1194020932 X:88691666-88691688 TGGAATTGATTCCTTCTGGTTGG + Intergenic
1195941908 X:110174090-110174112 TGGAATCTAGCCCTTGGGCTGGG - Exonic
1196872870 X:120129204-120129226 TGGAACTGATCCATTGGAGTTGG + Intergenic
1197041370 X:121939804-121939826 AGGAATGCATTCCTGGGGGTAGG + Intergenic
1201907461 Y:19100351-19100373 TGGAGTTCATTCCTTCTGGTGGG + Intergenic
1202192912 Y:22262391-22262413 TGGAATTTATTCCTTCTGGTGGG + Intergenic