ID: 1105829960

View in Genome Browser
Species Human (GRCh38)
Location 13:24155430-24155452
Sequence AGAATACTGCTTGTGAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 268}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105829960 Original CRISPR AGAATACTGCTTGTGAAGGA TGG Intronic
902225392 1:14993561-14993583 AGAACACTGCTTGTTAGGGCTGG - Intronic
902459687 1:16564581-16564603 AGAGTACAGCTTTTGAAGTATGG + Intronic
902460047 1:16567745-16567767 AGAATACAGCTTTTGAGGTATGG + Intronic
903153047 1:21426788-21426810 AGGATACAGCTTTTGAAGTATGG + Intergenic
903159900 1:21479612-21479634 AGAATACAGCTTTTGAAGTATGG - Intronic
903160081 1:21481193-21481215 AGGATACAGCTTTTGAAGTATGG - Intronic
906088287 1:43155167-43155189 AGAAGAAAGGTTGTGAAGGATGG + Intronic
906423240 1:45687929-45687951 AGAATGATGGTGGTGAAGGAAGG - Exonic
907838751 1:58136232-58136254 AGAATACTGCTGGTAGTGGAGGG + Intronic
908060516 1:60343342-60343364 TAAATACTAATTGTGAAGGAAGG + Intergenic
909561968 1:77017190-77017212 TGTTTACTGCTTGAGAAGGAAGG - Intronic
910741090 1:90517315-90517337 AGAATAATGCAAGTGAAAGAAGG + Intergenic
911905522 1:103563841-103563863 AGAATACTGTGAGGGAAGGAAGG + Intronic
913488188 1:119353273-119353295 AGAATACTACATCTGAAGGTGGG - Intergenic
913605367 1:120460836-120460858 AGAATACAGCTTTTGAGGTATGG - Intergenic
913605904 1:120465575-120465597 AGAGTACAGCTTTTGAAGTATGG - Intergenic
913642235 1:120823572-120823594 AGAATACAGCTTTTGAGGTATGG - Intronic
913642874 1:120829249-120829271 AGAGTACAGCTTTTGAAGTATGG - Intronic
913643323 1:120833186-120833208 AGAGTACAGCTTTTGAAGTATGG - Intronic
913643624 1:120835829-120835851 AGAGTACAGCTTTTGAAGTATGG - Intronic
913989627 1:143598887-143598909 AGAATACAGCTTTTGAAATATGG + Intergenic
913989799 1:143600456-143600478 AGAATACAGCTTTTGAGGTATGG + Intergenic
914082651 1:144423644-144423666 AGAGTACAGCTTTTGAAGTATGG + Intronic
914083170 1:144428372-144428394 AGAATACAGCTTTTGAGGTATGG + Intronic
914177555 1:145292155-145292177 AGAGTACAGCTTTTGAAGTATGG + Intronic
914178098 1:145296913-145296935 AGAGTACAGCTTTTGAAGTATGG + Intronic
914178643 1:145301675-145301697 AGAGTACAGCTTTTGAAGTATGG + Intronic
914179940 1:145312783-145312805 AGAGTACAGCTTTTGAAGTATGG + Intronic
914180486 1:145317555-145317577 AGAGTACAGCTTTTGAAGTATGG + Intronic
914181029 1:145322317-145322339 AGAGTACAGCTTTTGAAGTATGG + Intronic
914181572 1:145327065-145327087 AGAGTACAGCTTTTGAAGTATGG + Intronic
914182117 1:145331832-145331854 AGAGTACAGCTTTTGAAGTATGG + Intronic
914182662 1:145336588-145336610 AGAGTACAGCTTTTGAAGTATGG + Intronic
914183207 1:145341338-145341360 AGAGTACAGCTTTTGAAGTATGG + Intronic
914183752 1:145346096-145346118 AGAGTACAGCTTTTGAAGTATGG + Intronic
914184295 1:145350868-145350890 AGAGTACAGCTTTTGAAGTATGG + Intronic
914184839 1:145355630-145355652 AGAGTACAGCTTTTGAAGTATGG + Intronic
914185384 1:145360377-145360399 AGAGTACAGCTTTTGAAGTATGG + Intronic
914185929 1:145365131-145365153 AGAGTACAGCTTTTGAAGTATGG + Intronic
914186476 1:145369891-145369913 AGAGTACAGCTTTTGAAGTATGG + Intronic
914187020 1:145374639-145374661 AGAGTACAGCTTTTGAAGTATGG + Intronic
914187563 1:145379391-145379413 AGAGTACAGCTTTTGAAGTATGG + Intronic
914188108 1:145384145-145384167 AGAGTACAGCTTTTGAAGTATGG + Intronic
914188651 1:145388895-145388917 AGAGTACAGCTTTTGAAGTATGG + Intronic
914210522 1:145574595-145574617 AGAGTACAGCTTTTGAAGTATGG + Intergenic
914211047 1:145579361-145579383 AGAATACAGCTTTTGAGGTATGG + Intergenic
914269450 1:146066954-146066976 AGAGTACAGCTTTTGAAGTATGG + Intronic
914269806 1:146070098-146070120 AGAGTACAGCTTTTGAAGTATGG + Intronic
914270347 1:146074820-146074842 AGAGTACAGCTTTTGAAGTATGG + Intronic
914270883 1:146079556-146079578 AGAGTACAGCTTTTGAAGTATGG + Intronic
914271421 1:146084292-146084314 AGAGTACAGCTTTTGAAGTATGG + Intronic
914271956 1:146089013-146089035 AGAGTACAGCTTTTGAAGTATGG + Intronic
914272492 1:146093731-146093753 AGAGTACAGCTTTTGAAGTATGG + Intronic
914273030 1:146098453-146098475 AGAGTACAGCTTTTGAAGTATGG + Intronic
914273569 1:146103175-146103197 AGAGTACAGCTTTTGAAGTATGG + Intronic
914274107 1:146107893-146107915 AGAGTACAGCTTTTGAAGTATGG + Intronic
914274645 1:146112603-146112625 AGAGTACAGCTTTTGAAGTATGG + Intronic
914275178 1:146117321-146117343 AGAGTACAGCTTTTGAAGTATGG + Intronic
914275715 1:146122057-146122079 AGAGTACAGCTTTTGAAGTATGG + Intronic
914276244 1:146126794-146126816 AGAATACAGCTTTTGAGGTATGG + Intronic
914366576 1:146984397-146984419 AGAATACAGCTTTTGAGGTATGG - Intronic
914367110 1:146989153-146989175 AGAGTACAGCTTTTGAAGTATGG - Intronic
914367646 1:146993911-146993933 AGAGTACAGCTTTTGAAGTATGG - Intronic
914380581 1:147112450-147112472 AGAATACAGCTTTTGAAGTATGG + Intergenic
914380765 1:147113985-147114007 AGAATACAGCTTTTGAGGTATGG + Intergenic
914485336 1:148104311-148104333 AGAGTACAGCTTTTGAAGTATGG + Intronic
914485870 1:148109050-148109072 AGAATACAGCTTTTGAGGTATGG + Intronic
914532283 1:148533635-148533657 AGAGTACAGCTTTTGAAGTATGG + Intronic
914532644 1:148536785-148536807 AGAGTACAGCTTTTGAAGTATGG + Intronic
914533179 1:148541505-148541527 AGAGTACAGCTTTTGAAGTATGG + Intronic
914533714 1:148546219-148546241 AGAGTACAGCTTTTGAAGTATGG + Intronic
914534250 1:148550927-148550949 AGAGTACAGCTTTTGAAGTATGG + Intronic
914534786 1:148555641-148555663 AGAGTACAGCTTTTGAAGTATGG + Intronic
914535321 1:148560358-148560380 AGAGTACAGCTTTTGAAGTATGG + Intronic
914535858 1:148565094-148565116 AGAGTACAGCTTTTGAAGTATGG + Intronic
914536393 1:148569816-148569838 AGAGTACAGCTTTTGAAGTATGG + Intronic
914536752 1:148573004-148573026 AGAGTACAGCTTTTGAAGTATGG + Intronic
914537290 1:148577749-148577771 AGAATACAGCTTTTGAGGTATGG + Intronic
914585298 1:149056286-149056308 AGAGTACAGCTTTTGAAGTATGG + Intronic
914586203 1:149064197-149064219 AGAATACAGCTTTTGAGGTATGG + Intronic
914628635 1:149487595-149487617 AGAATACAGCTTTTGAGGTATGG - Intergenic
914629167 1:149492338-149492360 AGAGTACAGCTTTTGAAGTATGG - Intergenic
914629700 1:149497101-149497123 AGAGTACAGCTTTTGAAGTATGG - Intergenic
914630235 1:149501856-149501878 AGAGTACAGCTTTTGAAGTATGG - Intergenic
914630769 1:149506617-149506639 AGAGTACAGCTTTTGAAGTATGG - Intergenic
914631300 1:149511378-149511400 AGAGTACAGCTTTTGAAGTATGG - Intergenic
914631831 1:149516134-149516156 AGAGTACAGCTTTTGAAGTATGG - Intergenic
914632368 1:149520887-149520909 AGAGTACAGCTTTTGAAGTATGG - Intergenic
914632903 1:149525644-149525666 AGAGTACAGCTTTTGAAGTATGG - Intergenic
914633438 1:149530373-149530395 AGAGTACAGCTTTTGAAGTATGG - Intergenic
914633974 1:149535124-149535146 AGAGTACAGCTTTTGAAGTATGG - Intergenic
914634507 1:149539875-149539897 AGAGTACAGCTTTTGAAGTATGG - Intergenic
914635042 1:149544612-149544634 AGAGTACAGCTTTTGAAGTATGG - Intergenic
914635577 1:149549349-149549371 AGAGTACAGCTTTTGAAGTATGG - Intergenic
914636112 1:149554086-149554108 AGAGTACAGCTTTTGAAGTATGG - Intergenic
915484362 1:156210105-156210127 TGGATTCTGCTTGTGAGGGATGG - Intronic
917814096 1:178690089-178690111 AAAACAATCCTTGTGAAGGAAGG - Intergenic
918798774 1:188942559-188942581 AGGATACTGCTTGTAAAGCTGGG + Intergenic
918952836 1:191161407-191161429 AGAATAGTGATTATTAAGGATGG + Intergenic
919182553 1:194104181-194104203 ACACTACTGCTTCTGCAGGAGGG - Intergenic
921361918 1:214337978-214338000 AGCAAACTGCGTGTGAAAGAGGG - Intergenic
923804911 1:237247177-237247199 ATGAGACTGCTTGAGAAGGACGG + Intronic
1064337716 10:14458656-14458678 AAAAAAATGCATGTGAAGGAAGG - Intronic
1065228947 10:23577264-23577286 AGCATCCTGCTTGTGAACTATGG + Intergenic
1065451705 10:25865456-25865478 AGAAAAGGGCTTGTGAAGGCTGG - Intergenic
1068424958 10:56847854-56847876 AGAATATTGCCTTTGAAGGAAGG - Intergenic
1069408871 10:68131672-68131694 AGAATACCGCCTATGAAGGCTGG - Intronic
1074844538 10:117385691-117385713 AGGAGACAGCTTGGGAAGGATGG - Intergenic
1077988283 11:7377507-7377529 TGAATCCTGCTTGTGAAATAGGG - Intronic
1080275691 11:30501064-30501086 AAAATACTGCTTCTAAAGTATGG + Intronic
1080934927 11:36853144-36853166 AGAACACTGATTGCTAAGGATGG + Intergenic
1083594568 11:63912787-63912809 AGAGTACTGCTTGGGGAGCAGGG - Intronic
1084711136 11:70844397-70844419 AGAATGCTGGCTGTGAAGGCTGG - Intronic
1085004500 11:73073053-73073075 AGAATGCTGCTAGTGAAGGAAGG - Intronic
1085482518 11:76834476-76834498 AGAATGCTGCATGTGAACAATGG + Intergenic
1085566407 11:77518247-77518269 TGAATACTTTTTATGAAGGAAGG + Intronic
1085996013 11:81914934-81914956 AGAAGACTGATTGTGTAGAAGGG - Intergenic
1086100349 11:83092832-83092854 AGAAACCTGTTTGTGAGGGAGGG - Intergenic
1087022892 11:93621097-93621119 AGAAAACAGCATGGGAAGGATGG - Intergenic
1087240762 11:95775042-95775064 AGAGTACAGCTTCAGAAGGAAGG - Intronic
1087832500 11:102834680-102834702 AGAAGAAGGTTTGTGAAGGAAGG - Intergenic
1089082033 11:115784776-115784798 ATTATAATGCTTGTGAAGAATGG + Intergenic
1090132527 11:124159585-124159607 ATCATACTGCTTGAGAGGGAGGG + Intergenic
1090963552 11:131578847-131578869 ACATTACTTCTTGTGAAGAAAGG + Intronic
1092784853 12:12017667-12017689 AGCATACTGCTTGCTAAGGGAGG - Intergenic
1093722142 12:22456159-22456181 GAAATACTGCTGGTGAAGAAGGG + Intronic
1094383684 12:29870690-29870712 AGAATGCTTCTTAAGAAGGAGGG + Intergenic
1094747268 12:33359113-33359135 AGAATGCCAGTTGTGAAGGAAGG - Intergenic
1100622390 12:96291087-96291109 ATATGACTTCTTGTGAAGGAGGG - Intronic
1101227972 12:102708840-102708862 AGAATTATCCATGTGAAGGAGGG + Intergenic
1105829960 13:24155430-24155452 AGAATACTGCTTGTGAAGGATGG + Intronic
1105843253 13:24273461-24273483 AAAATACTATTTGTGAAGAATGG + Intronic
1108327574 13:49348690-49348712 AGAATACTGTTTGAGAATGATGG - Intronic
1110532178 13:76610285-76610307 AGAATACTATTTGGGATGGAAGG - Intergenic
1112757917 13:102660043-102660065 AGAATACTACTACAGAAGGAAGG + Intronic
1114229622 14:20768674-20768696 AGAAGACTGGGGGTGAAGGAAGG - Intronic
1115627957 14:35214167-35214189 AGAATACTGTCTGGGAAGCAAGG + Intronic
1116556843 14:46321930-46321952 AAAATAATGCATGTGCAGGAAGG + Intergenic
1120407588 14:84108238-84108260 AGAGTACTGTTTGAAAAGGAAGG - Intergenic
1120613932 14:86677875-86677897 AGAATACACCTTGAGAAGCAAGG + Intergenic
1121412535 14:93757851-93757873 AGAACCCTGTGTGTGAAGGAGGG + Intronic
1128396386 15:67230470-67230492 GGAAAACTTCATGTGAAGGATGG + Intronic
1128737180 15:70059812-70059834 AGCACACTGACTGTGAAGGATGG - Intronic
1128812288 15:70581292-70581314 AGAATCCTGGGTTTGAAGGATGG - Intergenic
1130004365 15:80080291-80080313 AGAAAACTGGTTGTGTAGGCCGG - Intronic
1131232025 15:90666396-90666418 AGCAAACTGCTTGGGAATGATGG - Intergenic
1131285596 15:91054256-91054278 AGAAAAGTGCTTGTGCAGTAGGG + Intergenic
1131630445 15:94170814-94170836 AGTATCCTGCTGCTGAAGGATGG + Intergenic
1132394263 15:101460333-101460355 AGCATAATACTGGTGAAGGAAGG - Intronic
1134816993 16:17213970-17213992 GAAATACTGCTTGAGAAGGGAGG - Intronic
1135746676 16:25022891-25022913 TGATTACTTCTTGTGAAGGTGGG + Intergenic
1137892105 16:52173609-52173631 AGAATACTGGTGGTGGAGGTTGG + Intergenic
1138750282 16:59411083-59411105 ACAATAATGCTTTTGAAGGTTGG + Intergenic
1139768418 16:69252403-69252425 ACAATACTGATTGCTAAGGAAGG - Intronic
1140186905 16:72782060-72782082 AAAATACTCCTTTTGACGGAGGG + Intergenic
1140798391 16:78462094-78462116 AGAATGCTGCTCTTGAAGGCAGG + Intronic
1141341565 16:83208879-83208901 TGAACACTGCTTGTGAGGCAAGG - Intronic
1141962790 16:87420755-87420777 AGAATTCTGCTGGTGTTGGATGG - Intronic
1143138691 17:4727680-4727702 AAAATAATGTTTGTGGAGGAAGG + Intergenic
1143440143 17:6965038-6965060 GGAAAACTGCTTGTGGTGGATGG - Intronic
1143626810 17:8114911-8114933 AGATTAAAGCTTGGGAAGGAGGG - Intronic
1144328114 17:14201139-14201161 AGAATACTTATCTTGAAGGAAGG + Intronic
1145900480 17:28487709-28487731 AGAATCCTGCTGGGGGAGGAGGG + Intronic
1146079824 17:29769218-29769240 AGAATACTGTTTAAGAAAGAAGG - Intronic
1146502548 17:33376698-33376720 AGAATTCTGCTTATAGAGGAAGG - Intronic
1146950289 17:36900646-36900668 AAAATACTGGTGGTGAGGGATGG - Intergenic
1149141751 17:53439671-53439693 AGAATACTGCTTATAAGAGAAGG + Intergenic
1150016261 17:61560447-61560469 AGAATTTTGCTTGGGAAGAATGG + Intergenic
1150512626 17:65773224-65773246 AGAAATGTGCCTGTGAAGGAAGG - Intronic
1151326785 17:73384594-73384616 ATGATACTGCTTATGAAGAATGG + Intronic
1152240725 17:79159532-79159554 GGAATATTGCTTGAGAATGAAGG - Intronic
1153246117 18:3074132-3074154 AGAAAACTGCTTGTGGATGTAGG + Intronic
1153309249 18:3661897-3661919 AGAAGACTGCTGGTGAAGGCTGG + Intronic
1155731920 18:29171036-29171058 AAAATACTTACTGTGAAGGATGG - Intergenic
1156001335 18:32388034-32388056 AGAATACTGATTGAAAAGAATGG + Intronic
1156822052 18:41384722-41384744 AGAATATTGCTTGGCAAGGCCGG - Intergenic
1157153024 18:45238273-45238295 AGGACACTGAGTGTGAAGGAAGG + Intronic
1164457595 19:28421509-28421531 AAAATGCTGCTTTTGGAGGAAGG - Intergenic
1167222238 19:48207596-48207618 AGAAAACTCCTTGTGAAAAATGG - Intronic
1202675931 1_KI270711v1_random:6765-6787 AGAGTACAGCTTTTGAAGTATGG + Intergenic
1202676478 1_KI270711v1_random:11473-11495 AGAATACAGCTTTTGAGGTATGG + Intergenic
927436615 2:23072018-23072040 AGAGTCCTGCTGGTGATGGAGGG - Intergenic
929864505 2:45706764-45706786 AGAATACTGCATGTGACTCATGG + Intronic
932928827 2:76009476-76009498 AGAATACTGATGCTGAAGGAAGG - Intergenic
933941738 2:87250773-87250795 AGCATACACCATGTGAAGGAAGG + Intergenic
935315193 2:101826407-101826429 AGAAGACTAGTTGTGAAGGGTGG + Intronic
936338487 2:111610796-111610818 AGCATACACCATGTGAAGGAAGG - Intergenic
938441190 2:131334725-131334747 GGAATACTGCTTGTAAAGCCAGG - Intronic
938948600 2:136236838-136236860 AGAATGCTGCTTCTAAAGGAAGG - Intergenic
939192114 2:138929261-138929283 GGAAATCTGCTTGTCAAGGAAGG - Intergenic
947207564 2:227675841-227675863 AGAATACTTCTTATTAAGAAAGG - Intergenic
1170519662 20:17171202-17171224 ACAACACAGATTGTGAAGGAGGG + Intergenic
1171372909 20:24673250-24673272 AGCACACTGCTGGTGAAGGCAGG - Intergenic
1171396238 20:24835544-24835566 GGAATACTGCTTCTGAAAAAGGG - Intergenic
1177000208 21:15603316-15603338 AGAAATCTGCTTTTGAAGGTAGG + Intergenic
1180460340 22:15557675-15557697 GGAATACTGCTTGTAAAGCCAGG - Intergenic
1181893737 22:26087907-26087929 AGAACACTGCTTGTGAAAATAGG - Intergenic
1182156327 22:28076544-28076566 TGAATACAGCTTGTGCATGATGG - Intronic
1182939654 22:34263367-34263389 AGAAAACTGCTTATGAAGAGAGG + Intergenic
1183058735 22:35322547-35322569 TAAATGCTGCTTGTGGAGGAGGG - Intronic
951376089 3:21919719-21919741 AGAATGCTGGTTCTGCAGGATGG - Intronic
952114428 3:30161957-30161979 AAAATAGTGGATGTGAAGGAGGG - Intergenic
953899375 3:46830873-46830895 AGAATTCTGCTTGAGTTGGAGGG - Intronic
954899815 3:54008991-54009013 AGAAGCCTGCCTGTGGAGGAAGG - Intergenic
955600036 3:60635430-60635452 AGAAAACGGCTTATGAAGGAGGG - Intronic
956004168 3:64761243-64761265 AGAGGACTGCTTGTGAAAGAGGG + Intergenic
956151935 3:66252928-66252950 AGTATACTACTTGTGCAGTAAGG + Intronic
956452461 3:69387874-69387896 AGAAGACTTATTGTGAAGAAAGG - Intronic
961160860 3:124723810-124723832 AGCATAAAGCTTGAGAAGGAAGG - Intronic
961513067 3:127415040-127415062 AGAATTCTGGTGGTAAAGGAAGG + Intergenic
964330552 3:155597541-155597563 AGCATACTGCTTGATAAGGTAGG - Intronic
967366614 3:188693978-188694000 AGAAAACTGAGTGTCAAGGAGGG - Intronic
967999909 3:195198203-195198225 AGAAGTATGCTTGGGAAGGAAGG + Intronic
970434109 4:16016409-16016431 AAATTAGTGCTTGTCAAGGAGGG - Intronic
971736641 4:30461574-30461596 TCCATACTGCTTTTGAAGGATGG + Intergenic
975318937 4:72987971-72987993 AGAATATTGCCTGTGAAAGTAGG - Intergenic
975856499 4:78630308-78630330 AGATGACTGTTTGTGAAGTAAGG - Intergenic
977597683 4:98901532-98901554 AGAAGAATGCCTATGAAGGATGG - Intronic
978119922 4:105066056-105066078 AAAATAAGGCTTGTGATGGAAGG + Intergenic
979010957 4:115367030-115367052 AGAATACTGGCTTTGAAGGATGG - Intergenic
979808842 4:125010529-125010551 AGAATTCTCTTTCTGAAGGAAGG + Intergenic
981826750 4:148951515-148951537 AGAATGCTGCTGGTGACGCAGGG + Intergenic
985804722 5:2034223-2034245 AGAAAAATGCTTGTGAATGAAGG - Intergenic
986652828 5:9981231-9981253 GGAAGACTGGCTGTGAAGGATGG + Intergenic
988309123 5:29534830-29534852 ATAATACTGCTTTTGTAGAATGG + Intergenic
991309331 5:65218241-65218263 AGAATCATGCTTTTGCAGGAGGG + Intronic
993254364 5:85569695-85569717 AGAATATGACTTCTGAAGGATGG + Intergenic
993957457 5:94252823-94252845 TGAGTGATGCTTGTGAAGGATGG - Intronic
994116406 5:96066062-96066084 AGAAAACTGCTAGTGCAGGCAGG + Intergenic
994740274 5:103609727-103609749 AAAATACAACTTGTAAAGGAAGG + Intergenic
994938957 5:106294698-106294720 ATAATACTGCTGGAGAAGGAGGG + Intergenic
995431753 5:112087193-112087215 AGAAACCTGCTTGGGATGGAGGG - Intergenic
995757495 5:115524665-115524687 AGAATACTACATGTGTAGGGCGG - Exonic
995767190 5:115631679-115631701 AGAAAACTGCTTGTGATTGTGGG - Intronic
997769132 5:136536982-136537004 AGAATAGAGCTTTTGAAGGTTGG - Intergenic
998907719 5:146924430-146924452 GGACTTCTGATTGTGAAGGATGG + Intronic
999505034 5:152185865-152185887 AGAACATTGCTTGTGAAGTCAGG - Intergenic
1000264278 5:159619793-159619815 AGAATAGTCCCTGTGAAGGAGGG + Intergenic
1000703806 5:164486577-164486599 AGAAAACTGGTTTAGAAGGATGG + Intergenic
1001090662 5:168737920-168737942 AGAATACTCTCTGTGAAGGTAGG - Intronic
1001791323 5:174459893-174459915 AGATTACTGCTTGTGGGGGTGGG + Intergenic
1004828594 6:19451372-19451394 AGAAAGCTGCTTGGTAAGGAGGG + Intergenic
1005444910 6:25912553-25912575 AGAAGAATGAATGTGAAGGAAGG - Intergenic
1005715539 6:28543936-28543958 AGAATGCTGCCAGTCAAGGATGG - Intergenic
1008255908 6:49299209-49299231 GGAATACTGCTTGTTGATGATGG - Intergenic
1012848109 6:104415004-104415026 ATAAATCTGCTTTTGAAGGAGGG - Intergenic
1014852902 6:126362884-126362906 GAAATACTGCTGGTGAAAGATGG + Intergenic
1014890213 6:126835263-126835285 AGAGTAGTGCTTGGGAAGGGGGG - Intergenic
1015196795 6:130532397-130532419 AGAAGGCTGCATGAGAAGGAAGG + Intergenic
1015575053 6:134662235-134662257 AGAAAGCTTCTTGTGAAGTATGG - Intergenic
1017978293 6:159376444-159376466 AGAATCTTGCTGGTGAAGGGTGG + Intergenic
1018130194 6:160722704-160722726 AGAATCTTGCTTTTGAAGAAAGG + Intronic
1018970974 6:168528936-168528958 AAAATGCTGCTTGTGGATGAAGG - Intronic
1022554985 7:31284079-31284101 AGAATGCTGCTTATTAATGAAGG - Intergenic
1027720251 7:81732062-81732084 AGAGTAGTGCTTGAGAAGAATGG - Intronic
1029182616 7:98714749-98714771 TGAATACTTCTTGTGAAGAATGG + Intergenic
1030448925 7:109684211-109684233 AGAATACTGGGTGTGAAAGGTGG + Intergenic
1030989812 7:116286768-116286790 AGAATTTTGCTTCTGCAGGATGG + Intergenic
1031897763 7:127372172-127372194 AAAATACTACTTGTTAAAGAAGG - Intronic
1032282558 7:130516312-130516334 AGAAAACTGGTTTTGAATGAGGG + Intronic
1032377614 7:131437951-131437973 AGGATACTGCTGCTGATGGAGGG + Exonic
1032650771 7:133875800-133875822 TGAAGACTGCTTGTGGAAGAAGG - Intronic
1037916057 8:22774126-22774148 AGCATGCTGCTCCTGAAGGAAGG + Intronic
1039847513 8:41336238-41336260 GGATTACTGATTGTGATGGAAGG - Intergenic
1041673335 8:60514975-60514997 AGAGTTGTGCTGGTGAAGGAAGG + Intergenic
1043618591 8:82159255-82159277 AGAATAGAGCTTGTGGAGGTAGG + Intergenic
1045259160 8:100557232-100557254 AGAAGACTGAGTGTGAAGGTAGG - Intronic
1045568308 8:103343661-103343683 AGAGAACTGCTTGGGCAGGAAGG + Intergenic
1049959301 9:723049-723071 CGAATTCAGCTGGTGAAGGATGG + Intronic
1051083945 9:13325220-13325242 ACAAAACTGCTTGTTAGGGAAGG + Intergenic
1051751609 9:20348480-20348502 CGAATACAGCTTATGAAAGATGG + Intronic
1053326072 9:37152804-37152826 AGAATACTGTTTGGGAAGAAGGG - Intronic
1054790106 9:69248522-69248544 ACAATACTGCATGGGAAGGAAGG - Intronic
1056177894 9:84053021-84053043 ATAATACTGCTTCTGAGGAAGGG + Intergenic
1056303831 9:85269932-85269954 ATAATCCTGTTTGTGAATGATGG - Intergenic
1058415487 9:104784585-104784607 AGAAAACTGTGTGTGAAGGAGGG + Intronic
1060478241 9:124000623-124000645 AGACTCCTGCTTGAGAAGAAGGG - Intergenic
1186975534 X:14899067-14899089 AAGACACTGGTTGTGAAGGATGG - Intronic
1189216274 X:39327546-39327568 ACAATATTGCTGGAGAAGGAGGG - Intergenic
1189410114 X:40762607-40762629 AGAATAGTGTGTGTGGAGGAGGG - Intergenic
1190474811 X:50815381-50815403 AGAAAGCTGGCTGTGAAGGAAGG - Intergenic
1191212401 X:57901212-57901234 ATAATACTGCATGTGGAAGAAGG - Intergenic
1195568659 X:106374819-106374841 AGAATACAGCTAATGAGGGAAGG + Intergenic
1198453283 X:136789733-136789755 GGAATAGTGTTTGTGAATGAAGG - Intergenic
1202263997 Y:22998972-22998994 AGCATACGACTTGTGCAGGATGG + Intronic
1202416988 Y:24632714-24632736 AGCATACGACTTGTGCAGGATGG + Intronic
1202453799 Y:25037372-25037394 AGCATACGACTTGTGCAGGATGG - Intronic