ID: 1105830586

View in Genome Browser
Species Human (GRCh38)
Location 13:24160632-24160654
Sequence CCGGGGGCGTGGCCTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105830579_1105830586 -5 Left 1105830579 13:24160614-24160636 CCTGAGGGAGTGAGCTAACCGGG 0: 1
1: 0
2: 0
3: 2
4: 75
Right 1105830586 13:24160632-24160654 CCGGGGGCGTGGCCTGATATGGG 0: 1
1: 0
2: 0
3: 4
4: 79
1105830577_1105830586 7 Left 1105830577 13:24160602-24160624 CCGAGGGTGTGGCCTGAGGGAGT 0: 1
1: 0
2: 4
3: 25
4: 241
Right 1105830586 13:24160632-24160654 CCGGGGGCGTGGCCTGATATGGG 0: 1
1: 0
2: 0
3: 4
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105830586 Original CRISPR CCGGGGGCGTGGCCTGATAT GGG Intronic
902359381 1:15933941-15933963 GCGGGGGCGGGGCCTCATGTAGG - Exonic
906117781 1:43367467-43367489 CCGGGTGTGTGGGTTGATATTGG - Exonic
922958490 1:229625636-229625658 CCGGCGGCGTGGCCTGCAGTCGG - Intronic
1076854495 10:133109213-133109235 CTGGAGGTGTGGCCTGATCTGGG - Intronic
1077042259 11:530015-530037 CCTGGGGTGTGTCCTGATCTGGG - Intergenic
1083274382 11:61588424-61588446 CCTGGGGCGTGGCCTGCCAGAGG + Intergenic
1085832571 11:79917134-79917156 GCGGTGGCGTGGCATGATCTTGG + Intergenic
1088390166 11:109305388-109305410 CTGGGGGCCTTTCCTGATATAGG + Intergenic
1105830586 13:24160632-24160654 CCGGGGGCGTGGCCTGATATGGG + Intronic
1109024461 13:57141149-57141171 CCGGAGGCGTGGACGGATCTCGG + Intronic
1109025448 13:57147719-57147741 CCGGAGGCGTGGACGGATCTCGG + Intronic
1109026438 13:57154292-57154314 CCGGAGGCGTGGACGGATCTCGG + Intronic
1109027430 13:57160863-57160885 CCGGAGGCGTGGACGGATCTCGG + Intronic
1109028416 13:57167428-57167450 CCGGAGGCGTGGACGGATCTCGG + Intronic
1113833275 13:113313533-113313555 CCTGGGGCGTGGCCTCCTAGAGG + Intronic
1113833377 13:113313917-113313939 CCTGGGGCGTGGCCTCCTAGAGG + Intronic
1113833403 13:113314013-113314035 CCTGGGGCGTGGCCTCCTAGAGG + Intronic
1113833443 13:113314157-113314179 CCTGGGGCGTGGCCTACTAGAGG + Intronic
1113833510 13:113314397-113314419 CCTGGGGCGTGGCCTCCTAGAGG + Intronic
1113833535 13:113314493-113314515 CCTGGGGCGTGGCCTCCTAGAGG + Intronic
1113833560 13:113314589-113314611 CCTGGGGCGTGGCCTCCTAGAGG + Intronic
1113833585 13:113314685-113314707 CCTGGGGCGTGGCCTCCTAGAGG + Intronic
1113833610 13:113314781-113314803 CCTGGGGCGTGGCCTCCTAGAGG + Intronic
1113833634 13:113314877-113314899 CCTGGGGCGTGGCCTCCTAGAGG + Intronic
1123065816 14:105618638-105618660 CAGGGGGCCTGGCCTGAACTGGG - Intergenic
1123069977 14:105637884-105637906 CAGGGGGCCTGGCCTGAACTGGG - Intergenic
1123089214 14:105734671-105734693 CAGGGGGCCTGGCCTGAACTGGG - Intergenic
1123095000 14:105762828-105762850 CAGGGGGCCTGGCCTGAACTGGG - Intergenic
1125933564 15:43616537-43616559 CCGTTGGCGTGGGCTGATGTGGG + Exonic
1125946662 15:43715999-43716021 CCGTTGGCGTGGGCTGATGTGGG + Intergenic
1132315029 15:100883440-100883462 CTGGGGGCCTGGCCTCACATTGG + Intronic
1140286030 16:73603827-73603849 GCAGTGGCGTGGCATGATATCGG + Intergenic
1140517549 16:75555486-75555508 CCGCGGGCCTGGCCTGATGGAGG - Intronic
1142024099 16:87803274-87803296 CCTGGGGCCTGGCCTGGAATTGG - Intergenic
1142115907 16:88355982-88356004 CAGGGGGTGTGGCCACATATGGG - Intergenic
1142173441 16:88634460-88634482 CCGGGGGCGTGGTCTGCTGGGGG + Intergenic
1142822778 17:2485001-2485023 CCTGGGCCATGGACTGATATTGG + Intronic
1143492767 17:7293967-7293989 CCGGGGGCGTGGCCGGACCCTGG + Intronic
1162139167 19:8575573-8575595 CCGGGGTCATGGACTGCTATCGG - Intronic
1162906272 19:13825909-13825931 CTGGGGGCGTGGCCTGAGTGTGG + Intronic
1163488925 19:17605795-17605817 CTGGGGGCGTGGCCTCAAGTTGG + Exonic
1163828816 19:19538198-19538220 CAGGGGGCGTGGCCTGAATGGGG + Intergenic
1163847045 19:19643670-19643692 ACGGGGGCGTGGTCTGATGCGGG - Intergenic
1166798751 19:45443596-45443618 CCGGGGGCGGGGCCTGAGTCTGG - Intronic
1168239400 19:55081662-55081684 TTTGGGGCGTGGCCTGATCTGGG + Intronic
1168255144 19:55160974-55160996 CTGGGGGCGGGGCCTGCTGTGGG + Intronic
1168523428 19:57070474-57070496 CCGGGGACGTGGCCTGGATTTGG - Intergenic
934526682 2:95056412-95056434 CCGTGGCCGTGGGCTGCTATAGG - Intergenic
1174560133 20:51425295-51425317 ACGGGGGCCTGGCCTTTTATTGG + Intronic
1175761504 20:61564837-61564859 CCGGGGACCTCGCCTGCTATGGG - Intronic
1181805080 22:25369762-25369784 CCGGGGGAGTGGGCTGTCATTGG - Intronic
1183585892 22:38752758-38752780 CCGGGGGGGTGGTCTGTTCTCGG - Intronic
949105531 3:197252-197274 CCGGGGGCGGGGCGTGAAAAGGG - Intronic
968288048 3:197519720-197519742 CCGTGGGCATGGCCTGATCTTGG - Intronic
973635946 4:52862219-52862241 CCGGGGGCGGGGCCTCGTGTAGG + Intergenic
984386037 4:179059601-179059623 CTGTGGGGCTGGCCTGATATCGG - Intergenic
985616758 5:927308-927330 TTGGGGTCGTGGCCTGATTTGGG - Intergenic
997242226 5:132315755-132315777 CCTGGGGCCAGGCCTGTTATAGG + Intronic
1001053054 5:168428046-168428068 CCAGGGGTGTGGCCTGAAAGTGG + Exonic
1001235268 5:170024015-170024037 CCAGGAGACTGGCCTGATATGGG - Intronic
1007356507 6:41321684-41321706 CTGGGGCCCTGGCCTGATCTTGG + Intergenic
1007581176 6:42960991-42961013 CCGGGGGCGTTGCATGAGATCGG + Intronic
1017012011 6:150069330-150069352 CCGGGCTCGTGGCCTGACAGCGG + Intergenic
1018584823 6:165346133-165346155 CCAGAGGAGTGGCCTGATACAGG + Intronic
1019510021 7:1413095-1413117 CAAGGGGCGTGGCCTGGAATCGG - Intergenic
1019663988 7:2242220-2242242 CCGGGGGCGTGGCCTCTGACCGG - Intronic
1023790498 7:43749849-43749871 CCGGGGGCCTGCCCTGATCTAGG - Intergenic
1033099725 7:138460191-138460213 GCGGGGGCGGGGCCTGAGGTGGG + Intergenic
1035404281 7:158587884-158587906 CCGGGGGCGTGGCCTGAGGGCGG - Intergenic
1036207778 8:6817979-6818001 CCGGGGGCTTGGCCAGAGACAGG - Intronic
1043889745 8:85642758-85642780 CCGGTGGCGTGGCTGGATCTGGG + Intergenic
1043891281 8:85654666-85654688 CCGGTGGCGTGGCTGGATCTGGG + Intergenic
1043892355 8:85661503-85661525 CCGGTGGCGTGGCTGGATCTGGG + Intergenic
1043893202 8:85715832-85715854 CCGGTGGCGTGGCTGGATCTGGG - Intergenic
1043895889 8:85737286-85737308 CCGGTGGCGTGGCTGGATCTGGG - Intergenic
1043896790 8:85744522-85744544 CCGGTGGCGTGGCTGGATCTGGG + Intergenic
1043899113 8:85762888-85762910 CCGGTGGCGTGGCTGGATCTGGG + Intergenic
1043900724 8:85775083-85775105 CCGGTGGCGTGGCTGGATCTGGG + Intergenic
1043902688 8:85790358-85790380 CCGGTGGCGTGGCTGGATCTGGG + Intergenic
1043904298 8:85802551-85802573 CCGGTGGCGTGGCTGGATCTGGG + Intergenic
1043905910 8:85814745-85814767 CCGGTGGCGTGGCTGGATCTGGG + Intergenic
1043907518 8:85826932-85826954 CCGGTGGCGTGGCTGGATCTGGG + Intergenic
1049082898 8:140457144-140457166 CCGGGGGCGTGGGCTGTGCTGGG + Intronic
1062544140 9:137054134-137054156 CCGTGGGCGTGGCCGGTGATGGG - Intergenic