ID: 1105830647

View in Genome Browser
Species Human (GRCh38)
Location 13:24160854-24160876
Sequence GGCACCGGAGGTGGCTCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 172}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105830640_1105830647 -8 Left 1105830640 13:24160839-24160861 CCTCGGGGCTCCGCCGGCACCGG 0: 1
1: 0
2: 1
3: 12
4: 190
Right 1105830647 13:24160854-24160876 GGCACCGGAGGTGGCTCTGAGGG 0: 1
1: 0
2: 1
3: 20
4: 172
1105830634_1105830647 10 Left 1105830634 13:24160821-24160843 CCTCCGAGAGTGCGGCGACCTCG 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1105830647 13:24160854-24160876 GGCACCGGAGGTGGCTCTGAGGG 0: 1
1: 0
2: 1
3: 20
4: 172
1105830633_1105830647 17 Left 1105830633 13:24160814-24160836 CCAGGCTCCTCCGAGAGTGCGGC 0: 1
1: 0
2: 1
3: 4
4: 109
Right 1105830647 13:24160854-24160876 GGCACCGGAGGTGGCTCTGAGGG 0: 1
1: 0
2: 1
3: 20
4: 172
1105830637_1105830647 7 Left 1105830637 13:24160824-24160846 CCGAGAGTGCGGCGACCTCGGGG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1105830647 13:24160854-24160876 GGCACCGGAGGTGGCTCTGAGGG 0: 1
1: 0
2: 1
3: 20
4: 172
1105830631_1105830647 18 Left 1105830631 13:24160813-24160835 CCCAGGCTCCTCCGAGAGTGCGG 0: 1
1: 0
2: 1
3: 10
4: 97
Right 1105830647 13:24160854-24160876 GGCACCGGAGGTGGCTCTGAGGG 0: 1
1: 0
2: 1
3: 20
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105830647 Original CRISPR GGCACCGGAGGTGGCTCTGA GGG Intronic