ID: 1105832691

View in Genome Browser
Species Human (GRCh38)
Location 13:24178150-24178172
Sequence GGCTTGATTGTTTTTTAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 518
Summary {0: 1, 1: 0, 2: 0, 3: 41, 4: 476}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105832679_1105832691 28 Left 1105832679 13:24178099-24178121 CCACCTTGGCCTCCCAAAGTGCT 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
Right 1105832691 13:24178150-24178172 GGCTTGATTGTTTTTTAAACTGG 0: 1
1: 0
2: 0
3: 41
4: 476
1105832678_1105832691 29 Left 1105832678 13:24178098-24178120 CCCACCTTGGCCTCCCAAAGTGC 0: 28733
1: 128252
2: 230554
3: 215949
4: 130370
Right 1105832691 13:24178150-24178172 GGCTTGATTGTTTTTTAAACTGG 0: 1
1: 0
2: 0
3: 41
4: 476
1105832685_1105832691 15 Left 1105832685 13:24178112-24178134 CCAAAGTGCTGGGATTACAGATG 0: 5024
1: 81336
2: 213729
3: 253622
4: 203117
Right 1105832691 13:24178150-24178172 GGCTTGATTGTTTTTTAAACTGG 0: 1
1: 0
2: 0
3: 41
4: 476
1105832683_1105832691 19 Left 1105832683 13:24178108-24178130 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1105832691 13:24178150-24178172 GGCTTGATTGTTTTTTAAACTGG 0: 1
1: 0
2: 0
3: 41
4: 476
1105832684_1105832691 16 Left 1105832684 13:24178111-24178133 CCCAAAGTGCTGGGATTACAGAT 0: 5300
1: 89088
2: 313361
3: 241102
4: 147967
Right 1105832691 13:24178150-24178172 GGCTTGATTGTTTTTTAAACTGG 0: 1
1: 0
2: 0
3: 41
4: 476
1105832681_1105832691 25 Left 1105832681 13:24178102-24178124 CCTTGGCCTCCCAAAGTGCTGGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
Right 1105832691 13:24178150-24178172 GGCTTGATTGTTTTTTAAACTGG 0: 1
1: 0
2: 0
3: 41
4: 476

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105832691 Original CRISPR GGCTTGATTGTTTTTTAAAC TGG Intronic