ID: 1105838731

View in Genome Browser
Species Human (GRCh38)
Location 13:24234561-24234583
Sequence GCCCCCACCAACAAAACGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 61}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105838731 Original CRISPR GCCCCCACCAACAAAACGTA CGG (reversed) Intronic
903099103 1:21012673-21012695 GTCCAGACCAACAAAAAGTAGGG + Intronic
903448405 1:23436903-23436925 GCCCTCACCAACAACTCGGAGGG + Exonic
913579176 1:120209255-120209277 CCCCCCCCCAAAAAAAAGTAGGG - Intergenic
914611727 1:149309515-149309537 CCCCCCCCCAAAAAAAAGTAGGG + Intergenic
917998287 1:180464387-180464409 ACCACCACCAACAAAATGAAGGG + Intronic
918419798 1:184352704-184352726 GCCCCCACCCTCAAAATGTTTGG - Intergenic
1066066121 10:31762171-31762193 GCCCCCACCAACAAAACTGCAGG + Intergenic
1075778361 10:125002170-125002192 GCCCCCACCCCCAAAATGCAGGG + Intronic
1078000158 11:7487396-7487418 GCTCCAAACAACAATACGTAAGG - Intronic
1079087263 11:17455471-17455493 GCCCCCAACAAAATAACCTAGGG + Intronic
1082672107 11:56046825-56046847 ACTCCCACCAACAAAACACATGG + Intergenic
1082698544 11:56400879-56400901 GCCCCCACCAAAAAAAATGAGGG - Intergenic
1083037674 11:59655522-59655544 GACCCCACCTGCAAAACCTAAGG - Exonic
1084166640 11:67377898-67377920 GTCCCCAGCACCAAAACTTAGGG - Intronic
1084590465 11:70087090-70087112 TCCCCCAGCAACAAAAGCTATGG - Intronic
1085663967 11:78395805-78395827 GCCCACACCCACAAAGCATATGG + Intronic
1092904903 12:13092280-13092302 GACCCCACCAACAAACAGCAGGG + Intronic
1098486654 12:71029261-71029283 GCCCCCTCCAACAATAAATAGGG + Intergenic
1101572484 12:105966643-105966665 GTCCCCCCAAACAAAATGTAAGG + Intergenic
1105063568 12:133176788-133176810 TCCCCCACCAAAAAAGCCTAGGG + Intronic
1105838731 13:24234561-24234583 GCCCCCACCAACAAAACGTACGG - Intronic
1109948850 13:69475179-69475201 CCCCCCACCCACAAAACCCATGG + Intergenic
1115530985 14:34326984-34327006 GCCCCCATCAGCAAAACAGAAGG + Intronic
1120716016 14:87841346-87841368 GCCCCCATCAACAATATGTGGGG + Intronic
1121260779 14:92564644-92564666 GCCCCCACCAAAAAAACAGCGGG - Intronic
1123198009 14:106635582-106635604 GCCCCCACCACCAAACCCTGAGG + Intergenic
1131465856 15:92654639-92654661 TCCCCCACCAACAGAAAATAAGG + Intronic
1133370676 16:5243489-5243511 GCCCCCACCAGCACCACGAATGG - Intergenic
1145360903 17:22211475-22211497 TCCCCCACCAAAAAAAGGTGAGG - Intergenic
1163915215 19:20235493-20235515 GCCCCCGCCAAGAAAATCTAGGG + Intergenic
927850771 2:26497973-26497995 GCCCCCACCAACAATAAAAAAGG + Intronic
929605946 2:43234251-43234273 GACCCCACCATCAAAACCTCTGG - Intronic
930006108 2:46898482-46898504 GCCCCCACCATCAACAAGTGGGG - Intergenic
930081482 2:47452584-47452606 GCCCCCAACTACTTAACGTAAGG - Intronic
935693735 2:105752971-105752993 GTCCTCACCAACAGAACGTGTGG + Intronic
939234020 2:139468098-139468120 GGCCCCACCTACAAACCATAAGG + Intergenic
939729586 2:145765537-145765559 GCCCCAAACACCAAAACGTATGG - Intergenic
940418606 2:153452181-153452203 GGCCCAAACAACAAAACATACGG + Intergenic
1171467064 20:25337118-25337140 GCACCCACCACCACAACGTCTGG - Intronic
1175734693 20:61377052-61377074 GCACCCACCACCAACACGTGAGG + Intronic
1184083601 22:42243947-42243969 GCCCCCACCAGCAATATGTGAGG - Intronic
950072897 3:10166348-10166370 GCACCAACAAACAAAACATATGG - Intronic
954749056 3:52803622-52803644 TTCCCCACCTATAAAACGTAAGG - Intronic
957567378 3:81902584-81902606 GCCACCACCAACAAAATGGAAGG + Intergenic
962245948 3:133793161-133793183 CCCCCCACCAAAAAAAAGGAAGG + Intronic
962611079 3:137076709-137076731 GCCCCCATCAAGAGAACTTAAGG - Intergenic
971256054 4:25014476-25014498 GCCCCCGCCAAAAAAAAGGAAGG + Intronic
974107248 4:57484266-57484288 GCCCCCAACCAGAAAAAGTAAGG - Intergenic
976689939 4:87858073-87858095 GACCTAACCAACAAAAGGTATGG + Intergenic
982235147 4:153245135-153245157 GCCTCCACCTACAAAACACAGGG + Intronic
986300902 5:6477475-6477497 ACCCCCACCACCAAAACCCAAGG + Intronic
997973151 5:138420837-138420859 GCCTCCAACAACAAAACCGAAGG + Exonic
999759098 5:154686607-154686629 GCCCACACCTTCAAAACGAACGG - Intergenic
1004016410 6:11735946-11735968 ACCCCCGCCAAAAAAAAGTAGGG - Intronic
1012588525 6:100950935-100950957 GTCCCCACAAGGAAAACGTACGG - Intergenic
1015914196 6:138198870-138198892 GCTCCCACCAACTATGCGTAGGG - Intronic
1016685668 6:146879759-146879781 GCCCCCACCAAAAAAACGCTGGG - Intergenic
1023492994 7:40764083-40764105 ACCCCCACCAAAAAAAAGTGTGG + Intronic
1036283983 8:7427546-7427568 GCCCCCACCACCAACACTTCGGG + Intergenic
1036337492 8:7883984-7884006 GCCCCCACCACCAACACTTCGGG - Intergenic
1037503794 8:19510663-19510685 GTTCCCACCGACCAAACGTATGG + Intronic
1041415649 8:57605385-57605407 GACCCCACCAGCAAAAAATACGG - Intergenic
1041678754 8:60564771-60564793 TCCCCCACCAATAAAAAGTAAGG + Intronic
1051487538 9:17625067-17625089 GCCCCCTCCCAAAAAAAGTATGG - Intronic
1052066333 9:24025536-24025558 GCCCTCACGAACAATACCTATGG - Intergenic
1061017862 9:127992944-127992966 CCCCCCACCAACAAAACCTCAGG - Intergenic
1062681997 9:137787255-137787277 GCCCCTACCAAGACCACGTAGGG + Intronic
1194563229 X:95448424-95448446 GGCCCCACCACCAACACATAGGG + Intergenic