ID: 1105841425

View in Genome Browser
Species Human (GRCh38)
Location 13:24256868-24256890
Sequence CACCATCCCCAACAATGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 2, 2: 2, 3: 17, 4: 181}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105841425_1105841430 11 Left 1105841425 13:24256868-24256890 CCACTGCATTGTTGGGGATGGTG 0: 1
1: 2
2: 2
3: 17
4: 181
Right 1105841430 13:24256902-24256924 ACCTTCCTTGGGTTTCAGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 196
1105841425_1105841429 7 Left 1105841425 13:24256868-24256890 CCACTGCATTGTTGGGGATGGTG 0: 1
1: 2
2: 2
3: 17
4: 181
Right 1105841429 13:24256898-24256920 CTTCACCTTCCTTGGGTTTCAGG 0: 1
1: 0
2: 2
3: 21
4: 230
1105841425_1105841428 0 Left 1105841425 13:24256868-24256890 CCACTGCATTGTTGGGGATGGTG 0: 1
1: 2
2: 2
3: 17
4: 181
Right 1105841428 13:24256891-24256913 TTTGTGGCTTCACCTTCCTTGGG 0: 1
1: 0
2: 8
3: 174
4: 3267
1105841425_1105841427 -1 Left 1105841425 13:24256868-24256890 CCACTGCATTGTTGGGGATGGTG 0: 1
1: 2
2: 2
3: 17
4: 181
Right 1105841427 13:24256890-24256912 GTTTGTGGCTTCACCTTCCTTGG 0: 1
1: 0
2: 0
3: 28
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105841425 Original CRISPR CACCATCCCCAACAATGCAG TGG (reversed) Intronic
900544847 1:3222747-3222769 CCCCATTCCCAGCACTGCAGTGG + Intronic
900895275 1:5479019-5479041 CACCATACCCGACACTGAAGGGG + Intergenic
902930835 1:19730371-19730393 AAACATCCCCAATATTGCAGAGG - Intronic
908899581 1:68940909-68940931 CTTCATCCCCACCAATGCAAGGG - Intergenic
910289925 1:85589611-85589633 CCCCAACCCCAAGAATGCTGTGG - Intergenic
912825562 1:112900093-112900115 GACCAGCCCGAGCAATGCAGTGG + Intergenic
916391331 1:164334018-164334040 CATCATCCCAATCATTGCAGTGG + Intergenic
918888115 1:190224087-190224109 CACAATCCCCATCAAAACAGTGG + Intronic
918936575 1:190929507-190929529 GATCATCCTCAGCAATGCAGTGG - Intergenic
919835052 1:201567693-201567715 CACCTTCCTCCACAAAGCAGCGG - Intergenic
921276314 1:213524282-213524304 CACCATCACCCAGAAAGCAGAGG + Intergenic
921606349 1:217160101-217160123 ACCCACCCCCGACAATGCAGAGG + Intergenic
921857860 1:220007829-220007851 CACCATGCCCAGCGAAGCAGTGG - Intronic
922154943 1:223033736-223033758 CAGCCTCCCCAAAAATTCAGAGG + Intergenic
923203888 1:231739484-231739506 CACCAGCACCAAGGATGCAGGGG - Intronic
924107871 1:240667446-240667468 CACCCTACACAAGAATGCAGAGG - Intergenic
924138588 1:240998597-240998619 CACCAGCCCCTACATTGCAGAGG + Intronic
1063299975 10:4842621-4842643 CACCAACACCCACAGTGCAGAGG - Intronic
1067110079 10:43394189-43394211 CACCTTCCTCAAGAAGGCAGTGG + Intronic
1070897787 10:79999864-79999886 CACCATGCCCAGCTATGCTGTGG + Intergenic
1072396754 10:95050695-95050717 CTCCAAGCCCAATAATGCAGTGG - Intronic
1075703160 10:124482535-124482557 AACCGGCCCCAACAAGGCAGCGG - Intronic
1075727062 10:124616113-124616135 CTCCCGCCCCAACAAAGCAGGGG - Intronic
1075934977 10:126332606-126332628 CACCATCCCCAACAAAAAAGGGG - Intronic
1077016148 11:399900-399922 CACCATCCCCAGAAACGCGGAGG + Intronic
1077473581 11:2776189-2776211 CACCACCCCCAGCCCTGCAGAGG + Intronic
1081609956 11:44555812-44555834 CCCCATGCTCAACAATTCAGGGG + Intergenic
1088594476 11:111429885-111429907 CACCATCCTTAACACTCCAGAGG + Intronic
1088704883 11:112453254-112453276 CCCCAGCCCCAACCAGGCAGTGG + Intergenic
1089430175 11:118417122-118417144 CTCCATCCCCAACCCTGCAAAGG - Intronic
1091026101 11:132142522-132142544 CAGTCTCCTCAACAATGCAGAGG - Intronic
1091306069 11:134536861-134536883 CACCATCCCCAACTCCGCTGGGG + Intergenic
1095222153 12:39628489-39628511 AAACATCCCTAACAATGGAGGGG - Intronic
1095688708 12:45064252-45064274 CACAATGCACAACAATGCGGGGG + Intergenic
1096230695 12:49895326-49895348 CCCCATCCCCCCCAATGGAGTGG + Intronic
1096246776 12:49994446-49994468 CACAATGCACAACAATGGAGGGG + Exonic
1098244379 12:68501161-68501183 CACCATCCCCAGAAAGTCAGTGG - Intergenic
1102040828 12:109799672-109799694 CACCTTCCCCAGCTGTGCAGTGG - Intronic
1102980860 12:117239956-117239978 CCCCACCCCCACCAATCCAGAGG - Intronic
1103255967 12:119541527-119541549 CACATTCCCCAACAAGGCAATGG + Intergenic
1103772071 12:123335149-123335171 CACCATGCCCAGCCAGGCAGTGG - Intronic
1105745496 13:23373902-23373924 CTCCAGCCCCTACATTGCAGAGG - Intronic
1105841425 13:24256868-24256890 CACCATCCCCAACAATGCAGTGG - Intronic
1106755142 13:32814989-32815011 CACCATCTCCAACACTGCAGTGG + Intergenic
1111113837 13:83750139-83750161 CAACATCACCTCCAATGCAGTGG + Intergenic
1117021073 14:51571085-51571107 CACCATGCCCAGCCATGCTGTGG - Intronic
1120827358 14:88967984-88968006 CCTCATACCCAGCAATGCAGAGG + Intergenic
1123872728 15:24593186-24593208 CAGCCTCCCCAAAAATTCAGAGG + Intergenic
1124496476 15:30190782-30190804 CCCCATCCCCAACCTTTCAGTGG + Intergenic
1124747099 15:32347866-32347888 CCCCATCCCCAACCTTTCAGTGG - Intergenic
1126707002 15:51415074-51415096 CTCCATGCCCAACAATACTGTGG - Intergenic
1128804801 15:70522740-70522762 CACCATACCCAACAGGGGAGGGG + Intergenic
1129190262 15:73933461-73933483 CACCATCCCCAGCAACTCTGTGG - Intronic
1129550457 15:76443151-76443173 CATCCTCCCAAACAGTGCAGGGG + Intronic
1130288023 15:82571673-82571695 CAGCGTCCCCAAAAGTGCAGAGG - Exonic
1130309654 15:82742109-82742131 CACTATCCCCAAAATTGGAGAGG + Intergenic
1131032203 15:89195629-89195651 CACCATGCCTAACAATGCAATGG - Exonic
1132035177 15:98477320-98477342 CTCCATCTCCAACAATGGGGGGG + Intronic
1132556704 16:575767-575789 CACCGTCCCCCACTGTGCAGGGG - Intronic
1132677061 16:1125198-1125220 CAGCTTCCCCAAAAGTGCAGTGG - Intergenic
1139353797 16:66354649-66354671 TACCCTCCCCAACATTGCTGAGG - Intergenic
1141602892 16:85137123-85137145 CACCATCCCCAGAAACTCAGGGG + Intergenic
1145811182 17:27765309-27765331 TAACATCCCCCTCAATGCAGTGG - Intronic
1146320369 17:31841962-31841984 CACCATCCATAACCATGGAGAGG - Intergenic
1146744927 17:35320014-35320036 CCCCAAGCCCAACAATGCTGTGG + Intergenic
1147370974 17:39992797-39992819 CTCCCTCCCCAACAGTGCACTGG + Intronic
1148341504 17:46876154-46876176 CACCAACCCCAGCAGGGCAGAGG - Intronic
1148872154 17:50664747-50664769 CTCCATCCCCACCAATGCCTAGG - Intronic
1149549673 17:57531048-57531070 CTCACTCCCCAGCAATGCAGTGG - Intronic
1149561306 17:57609679-57609701 CACCATCCCCAAAGATGCCAGGG + Intronic
1151535801 17:74738174-74738196 CTCCATCCCCAACCCTGCAGAGG - Intronic
1153343515 18:4002062-4002084 CAACATCTCCAATAAAGCAGCGG - Intronic
1155280955 18:24239179-24239201 CTAAATCACCAACAATGCAGAGG + Intronic
1156707024 18:39895367-39895389 CACCCACCCCAAAAATGGAGAGG - Intergenic
1160397693 18:78584134-78584156 CACCATGCTCCACAGTGCAGAGG - Intergenic
1161668195 19:5589725-5589747 CACCTTCACCAGCACTGCAGTGG - Intronic
1163156199 19:15440951-15440973 TACATTCCCCCACAATGCAGCGG - Intronic
1165060769 19:33204270-33204292 CACCCTCCCCAAAAGGGCAGTGG - Intronic
1165384174 19:35500791-35500813 CACCTTCCCCACCCATGCCGTGG + Intronic
925008883 2:467420-467442 CACCACCCCCACCCATGCAGGGG - Intergenic
925705190 2:6677810-6677832 CTCCACCCCCAATAGTGCAGAGG - Intergenic
927214838 2:20662453-20662475 CAGCATCCCCAACAGAGGAGAGG + Intergenic
929797151 2:45068918-45068940 CGCAATCGCCAACATTGCAGTGG - Intergenic
930327126 2:49933958-49933980 CAACATGCCCTACAATGCAAAGG - Intronic
931005909 2:57850015-57850037 CCACATCCCCAAAAGTGCAGAGG + Intergenic
934125205 2:88881777-88881799 CACCATCCCCAAAAATGCAGTGG - Intergenic
937925694 2:127165903-127165925 GACCAGCCCCCACATTGCAGAGG + Intergenic
938551869 2:132390208-132390230 CACCAGCCCCAACATTTCACAGG - Intergenic
942025045 2:171902363-171902385 CCTCCTCTCCAACAATGCAGAGG - Intronic
943702376 2:191000517-191000539 CACCAGCCCTAACAGTGGAGAGG + Intronic
943747655 2:191479213-191479235 TACAATGCCCTACAATGCAGAGG + Intergenic
944059592 2:195558466-195558488 CACCACCTCCAACAAAGCAGTGG + Intergenic
945477225 2:210298453-210298475 CACAAATCCCACCAATGCAGAGG - Exonic
946010039 2:216557293-216557315 CACTTTCCCCTACACTGCAGTGG - Intronic
946904704 2:224405341-224405363 CACCATCCCCCACTTTGGAGGGG + Intergenic
947007470 2:225528759-225528781 CACCAATCCCTACAATCCAGGGG - Intronic
947514694 2:230792224-230792246 CTACATCCCCAACTTTGCAGAGG - Intronic
948918665 2:241051439-241051461 AACCGGCCCCAACACTGCAGCGG - Intronic
949027388 2:241772959-241772981 CACCCACCCAAACGATGCAGAGG + Intergenic
1171372595 20:24671144-24671166 CCCCTGCCCCAGCAATGCAGGGG + Intergenic
1172049887 20:32109468-32109490 CCCCATTACCCACAATGCAGCGG + Intergenic
1172270273 20:33651347-33651369 CACAATCCCCTAGAATGCAAGGG + Intergenic
1173995867 20:47338279-47338301 CAGCCTTCCCACCAATGCAGTGG + Intronic
1178226601 21:30726392-30726414 AACCATCTCCAACAATGGCGTGG + Intergenic
1179788098 21:43741130-43741152 AACCATCCCTGACAGTGCAGGGG + Intronic
1180758972 22:18184331-18184353 CACGATCCACTGCAATGCAGAGG - Intergenic
1180769259 22:18368122-18368144 CACGATCCACTGCAATGCAGAGG - Intergenic
1180777053 22:18494273-18494295 CACGATCCACTGCAATGCAGAGG + Intergenic
1180809775 22:18751611-18751633 CACGATCCACTGCAATGCAGAGG + Intergenic
1180827131 22:18871351-18871373 CACGATCCACTGCAATGCAGAGG - Intergenic
1181195913 22:21185834-21185856 CACGATCCACTGCAATGCAGAGG + Intergenic
1181213615 22:21307290-21307312 CACGATCCACTGCAATGCAGAGG - Intergenic
1181261245 22:21599409-21599431 CAACAGCCCCATCAATGTAGGGG - Intronic
1181273109 22:21672360-21672382 GACCAACCCCAGCAATGGAGAGG + Exonic
1182228066 22:28815465-28815487 CAGATTCCCCAACAATCCAGAGG + Intergenic
1184670417 22:46009494-46009516 AACCATAACCAAGAATGCAGCGG + Intergenic
1203230888 22_KI270731v1_random:109007-109029 CACGATCCACTGCAATGCAGAGG - Intergenic
1203277276 22_KI270734v1_random:97256-97278 CACGATCCACTGCAATGCAGAGG - Intergenic
953392256 3:42540509-42540531 CACCATCCCCTCCATGGCAGAGG + Intergenic
953392655 3:42542795-42542817 TTCCAACCCCAACAAAGCAGGGG + Intergenic
955360489 3:58269778-58269800 CACCCTCCCCAGCTAGGCAGAGG - Intronic
956169843 3:66424297-66424319 CACCAACCCCACCATTCCAGAGG + Intronic
959717858 3:109453090-109453112 CACCATCCCCAAAAATGCAGTGG - Intergenic
961079364 3:124012696-124012718 CAGCATCTTCAACAATGCAGAGG + Intergenic
961589241 3:127963319-127963341 CACCAATTCCACCAATGCAGGGG + Exonic
962511159 3:136102022-136102044 CTCCATCCACATCCATGCAGCGG - Exonic
967845431 3:194039028-194039050 CTCCAGCCCCTACAATGCAGAGG - Intergenic
968300300 3:197607920-197607942 CACCTTCAACAACAATGCAATGG - Intergenic
968460053 4:720300-720322 CACCCTCCCCAGCGATGCATGGG - Intronic
969347728 4:6579789-6579811 CACCATCACCCACAGTGCCGTGG + Intronic
969702895 4:8777449-8777471 AACCAGCCCCCACAATGCAGAGG + Intergenic
972225733 4:37009455-37009477 CACCAACACCAATAAGGCAGGGG + Intergenic
974314794 4:60265284-60265306 CACAAACCCCAACATTTCAGTGG - Intergenic
974756138 4:66210542-66210564 AGCCAGCCCCTACAATGCAGAGG - Intergenic
975463420 4:74682543-74682565 CCCCAAACCCAATAATGCAGTGG + Intergenic
984711067 4:182885642-182885664 CACCATGCCCACCCCTGCAGAGG + Intergenic
984821787 4:183888802-183888824 CACCATCCAAAAGAATGAAGTGG - Intronic
986237310 5:5923948-5923970 CAGCATCCCCACCAATGTACTGG + Intergenic
987129851 5:14850229-14850251 CACCTTCCCCACCCAGGCAGTGG - Intronic
987710901 5:21499712-21499734 CACCACACCCAGCACTGCAGAGG - Intergenic
987912196 5:24162197-24162219 CAACAGCCACAACAATTCAGTGG - Intronic
988034776 5:25813083-25813105 CACCACCACCAACAAGGCAAAGG - Intergenic
988749238 5:34177909-34177931 CACCACACCCAGCACTGCAGAGG + Intergenic
989111079 5:37907063-37907085 CTCCCTCCCCAACAAAGCAGGGG - Intergenic
995202303 5:109439832-109439854 CACCATCCACCACTATACAGAGG - Intergenic
998144236 5:139717158-139717180 CACCATCCCCCTGAATGCTGTGG - Intergenic
998809191 5:145949102-145949124 CACCCTCATCAACAAGGCAGGGG - Intronic
999110379 5:149115368-149115390 CACCACCCACAACAATGCAATGG + Intergenic
999641461 5:153677281-153677303 CACCAACACCAACAATGCAGTGG - Intronic
1001556533 5:172641156-172641178 CACCGCCTCCAACAGTGCAGGGG - Intergenic
1003503311 6:6719979-6720001 CTCCATCCAAAACCATGCAGTGG - Intergenic
1004113041 6:12739101-12739123 CAGCATTCCCCAAAATGCAGAGG - Intronic
1004997790 6:21210918-21210940 CACCTCCCCCAGCAAGGCAGAGG + Intronic
1005546789 6:26880785-26880807 CACCACACCCAGCACTGCAGAGG + Intergenic
1005930132 6:30477080-30477102 CACCATGCCCAACCCTGCTGAGG - Intergenic
1008827768 6:55718890-55718912 GACCATCCACAACAACGCACAGG + Intergenic
1009017544 6:57921869-57921891 CACCACACCCAGCACTGCAGAGG + Intergenic
1012020758 6:93915963-93915985 CAACTTCCCCAAAAATCCAGAGG + Intergenic
1012496439 6:99838606-99838628 GATCATCCTCATCAATGCAGAGG + Intergenic
1013159254 6:107525527-107525549 CACCTTCCCCAAGAATGCTGTGG + Intronic
1015534629 6:134255281-134255303 CACCATTTCCAACATTGCAATGG + Intronic
1016002712 6:139058389-139058411 CAGGAGCCCCAACAATGCAGGGG + Intergenic
1018889877 6:167976189-167976211 CTCCTCCCCCAACACTGCAGGGG - Intergenic
1018890005 6:167976610-167976632 CTCCTCCCCCAACACTGCAGGGG - Intergenic
1018964823 6:168476132-168476154 AACCATCTCCAACTGTGCAGAGG + Intronic
1019145807 6:169974968-169974990 CACCATCCTCTACAGTGCTGTGG + Intergenic
1022441485 7:30436739-30436761 CACCACCCCCATCAAGACAGAGG - Intronic
1022762081 7:33365749-33365771 TACCATCACCAACACAGCAGTGG - Intronic
1023141994 7:37110867-37110889 CACCATACCCAGCCATGCAAGGG - Intronic
1023199051 7:37673852-37673874 AAACATCCCCACCAGTGCAGAGG - Intergenic
1023654896 7:42409485-42409507 TACCCTCCCCTACACTGCAGAGG - Intergenic
1025189032 7:56882663-56882685 CACCATCCCCAAAAGCACAGAGG - Intergenic
1025682907 7:63694256-63694278 CACCATCCCCAAAAGCACAGAGG + Intergenic
1025926634 7:65965811-65965833 CACCATGCCCAGCACTGCAGAGG + Intronic
1028248405 7:88511031-88511053 CAGCCTCCCCAAAAATTCAGAGG + Intergenic
1028950449 7:96629848-96629870 CCCCATGCCCAATAATGCAGTGG + Intronic
1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG + Exonic
1035188097 7:157141311-157141333 GACCATCCCCAGCATTCCAGAGG + Intronic
1035281432 7:157780918-157780940 CACCACCCCCACCGAGGCAGTGG + Intronic
1037205255 8:16309714-16309736 CATGATCCCCTACAATGCATTGG - Intronic
1037587471 8:20287997-20288019 CCCCATCCCCAGCAAAGGAGTGG - Intronic
1037932386 8:22889341-22889363 CAAAATCCAGAACAATGCAGGGG + Intronic
1039255353 8:35712606-35712628 CACCTTTCCCCAAAATGCAGAGG + Intronic
1042898504 8:73696200-73696222 CCCCAAGCCCAACAATGCTGTGG - Intronic
1044565129 8:93654463-93654485 CACCATCTCCAGCAACACAGGGG - Intergenic
1044824804 8:96185677-96185699 CACCATGCCCAACCCTGAAGTGG - Intergenic
1049316990 8:141974620-141974642 CATCATCCACAACAATGATGCGG - Intergenic
1049462569 8:142736960-142736982 CACCACCACCATCCATGCAGGGG + Intergenic
1052352928 9:27475394-27475416 CAGAATCCCCTCCAATGCAGTGG - Intronic
1055900029 9:81223628-81223650 CAACAACAACAACAATGCAGAGG - Intergenic
1056459656 9:86797455-86797477 CCCCATCCTCAGCAATGCTGTGG + Intergenic
1058141638 9:101362703-101362725 CACCTTCTCCTACAATGAAGAGG + Exonic
1061622876 9:131823318-131823340 CATCACCTCCAACAGTGCAGCGG + Intergenic
1061679977 9:132238192-132238214 CACCATCCCTAAGAATGGGGGGG - Intronic
1061959475 9:133980634-133980656 CACCATCCCCTGCAAGGCAGAGG + Intronic
1190011408 X:46788378-46788400 CACCATGCCCCGCCATGCAGAGG - Intergenic
1192218821 X:69182912-69182934 CCCCACCCCCAGCAATGCACAGG - Intergenic
1192478412 X:71464004-71464026 CACTGTCCCCAGCAATGGAGTGG - Exonic
1192539652 X:71957304-71957326 CACGTGCCCCAACAGTGCAGTGG + Intergenic
1196002196 X:110797414-110797436 AAACATCACCAGCAATGCAGGGG - Intergenic
1196191226 X:112796779-112796801 TACCATGCCCAACTATCCAGGGG + Intronic
1200097532 X:153671223-153671245 CACCCTCCCCAACCCAGCAGGGG + Intronic
1200902961 Y:8451639-8451661 CACTATCCCCCACAATGCACAGG - Intergenic