ID: 1105843272

View in Genome Browser
Species Human (GRCh38)
Location 13:24273771-24273793
Sequence GGGAACTGAAAAATAAGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 327}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105843272 Original CRISPR GGGAACTGAAAAATAAGTCA TGG Intronic
901588823 1:10321841-10321863 TGGAACTGAAAAAGAAGGTATGG + Exonic
905359016 1:37405509-37405531 TGAAACTGGAAAAGAAGTCAGGG + Intergenic
905727393 1:40265027-40265049 GGGGACTGAAAAACAAAGCATGG - Intronic
905898801 1:41567108-41567130 GGGAAGTGAAAAATAGGTCTGGG - Intronic
905992747 1:42353570-42353592 GGGAAAAGGGAAATAAGTCATGG - Intergenic
907083152 1:51643509-51643531 GGGAACTGAAAGATGAGTGTGGG + Intronic
907324800 1:53630225-53630247 GGGAATTGCTAAATAAATCATGG - Intronic
908599954 1:65728050-65728072 GAGAACTGAAAATTATGTCAAGG - Intergenic
909606050 1:77509188-77509210 GGGCACTGATAAATAAGGCATGG + Intronic
910336572 1:86138742-86138764 GTGAAGAGAAAAATAAGTAAGGG - Intronic
910814501 1:91276170-91276192 GGGACCTGAAGGATAAGCCAAGG - Intronic
912105633 1:106270218-106270240 AAAAACTTAAAAATAAGTCATGG - Intergenic
912234792 1:107837970-107837992 GGGACCTGGCAAATAATTCATGG + Intronic
915499902 1:156308552-156308574 GGGCAGAGAAAAATAACTCATGG + Intergenic
917708314 1:177657430-177657452 GGGAATTGGGGAATAAGTCAGGG + Intergenic
917778175 1:178361410-178361432 GGCAACTCAAAAAAAAGTCAAGG - Intronic
919878530 1:201888000-201888022 AGGAACTGCAAATTAAGCCAGGG - Intergenic
920763643 1:208810227-208810249 GGGATGTGAAAAATAACTAAAGG + Intergenic
921993609 1:221393995-221394017 GGTAACAAAAAAAAAAGTCAAGG + Intergenic
922391956 1:225153070-225153092 GCAAACTGTAAAATCAGTCAAGG + Intronic
922704874 1:227785201-227785223 GGGAACTGCAAATTAAAACAAGG + Intergenic
923521378 1:234737595-234737617 GGGAATTTAAAAATAAGAAAAGG + Intergenic
1063254681 10:4313714-4313736 GGGAATTGACAAAAAAGCCATGG + Intergenic
1063886333 10:10583343-10583365 GAGAACAGAAAAATATGTGAGGG - Intergenic
1064221611 10:13445637-13445659 TGGAACTGAAAAAAATGTCAAGG - Intronic
1065464968 10:26009913-26009935 GGAAATGGAAAAATAAGACAAGG + Intronic
1067679912 10:48427304-48427326 GGGAACTTAAGATTAAGTTAAGG - Intronic
1067930762 10:50559126-50559148 GGGAACTGGTAAACATGTCACGG + Intronic
1068406486 10:56596472-56596494 GAGCAGTGAAAACTAAGTCATGG + Intergenic
1068793765 10:61055028-61055050 GAGACCTGAATGATAAGTCATGG - Intergenic
1071674812 10:87645472-87645494 TTAACCTGAAAAATAAGTCATGG + Intergenic
1072683184 10:97521359-97521381 GGGAACAGAAAAGTAACTCCTGG - Intronic
1073275933 10:102311397-102311419 GGGAAGGGAAAATGAAGTCATGG + Intronic
1073796945 10:106998917-106998939 GAGAACTGAAAAATAATACAAGG - Intronic
1075200509 10:120399491-120399513 GGGACATGATAAATAAGGCAGGG + Intergenic
1075607836 10:123827862-123827884 CAGAACAGAAAAATAAATCAGGG + Intronic
1076841252 10:133046902-133046924 GGGCACTGAACAATAATGCATGG - Intergenic
1077817661 11:5702746-5702768 GAGCACTGAAAAAGAAGTAAAGG - Intronic
1078678294 11:13448556-13448578 GGGAAATGAAAAAGAAGTCAAGG - Intronic
1079580676 11:22060108-22060130 GGGAAAGGAAAGAGAAGTCATGG + Intergenic
1079871804 11:25807484-25807506 GGGAATTGAACAATAACACATGG + Intergenic
1082578032 11:54833463-54833485 GGGAACACAAAAAAAAGGCAGGG + Intergenic
1083938744 11:65883790-65883812 GGGAACTGAGACATATCTCAGGG - Intronic
1084066895 11:66709576-66709598 TAGAAAAGAAAAATAAGTCATGG - Intronic
1086023206 11:82257409-82257431 GGGAACTGGAATAGAAATCAGGG - Intergenic
1087129797 11:94658760-94658782 GGGAACTGGAAAAGTAATCAAGG + Intergenic
1087337338 11:96861507-96861529 GGAAACAGAAAAAAAAGTAAGGG - Intergenic
1087955729 11:104285576-104285598 TGGAAGTGCAAGATAAGTCAGGG - Intergenic
1090101186 11:123798318-123798340 GGTTTCTGAAAAACAAGTCAGGG + Intergenic
1090434243 11:126673613-126673635 GGGGAATGAAAAATAAATGAGGG + Intronic
1091478614 12:802633-802655 AGAAACTGAAAATTAAGTAAAGG - Intronic
1091821307 12:3477333-3477355 GGGAAATGAAACAGAAGGCATGG + Intronic
1092836636 12:12495759-12495781 GGCAAATGCAAAATTAGTCATGG - Intronic
1092872637 12:12819728-12819750 GGCAACAGAAAAATTAGTCCTGG - Intronic
1092985321 12:13839453-13839475 GGGAGCTGAAAAACATCTCAGGG - Intronic
1094161753 12:27398081-27398103 GGGAACTGGGAAATGAGACACGG - Intronic
1094339828 12:29398713-29398735 GGGAACTGAAAAGAATGTAAGGG + Intergenic
1095166753 12:38982266-38982288 GGTAATTTAAAAATAGGTCATGG + Intergenic
1095255099 12:40025493-40025515 GGGAACTGCTAGATAAGACATGG + Intronic
1097198660 12:57259616-57259638 AGGAACTGACAAATGATTCAAGG + Intronic
1098509446 12:71294289-71294311 GGGAAGTGATAAATAAGTAATGG - Intronic
1099291037 12:80776853-80776875 GAGAACTGAAAACTCTGTCAAGG - Intergenic
1099341062 12:81435257-81435279 GGGAGCTGAAATATAGCTCAGGG - Intronic
1100040505 12:90311746-90311768 GGGAACTGATTAATATTTCATGG + Intergenic
1100216150 12:92450822-92450844 TGCAATTGAAAAATAAATCAGGG + Intergenic
1100936277 12:99670897-99670919 GGTACATGAAAAATAAATCAGGG + Intronic
1101385425 12:104253043-104253065 GAGATCTGGAAAGTAAGTCATGG - Intronic
1101430851 12:104625791-104625813 TGGAAATGAAAAAGAAGACAGGG - Intronic
1103284972 12:119793299-119793321 GGGAACTGAATTAAAAATCATGG - Intronic
1103419832 12:120771510-120771532 GAGAAATGAAAAATAAGACAAGG - Intronic
1103754376 12:123192007-123192029 GGCAAATAATAAATAAGTCAAGG + Intronic
1104413106 12:128575745-128575767 TGGAATTGTAAAATAGGTCAAGG + Intronic
1105843272 13:24273771-24273793 GGGAACTGAAAAATAAGTCATGG + Intronic
1106316961 13:28602826-28602848 GGGACCTGAACAATATATCATGG - Intergenic
1106967372 13:35087645-35087667 CAGAACTGTAAAAGAAGTCATGG + Intronic
1107501325 13:40979580-40979602 AGGAACTGTAAAATAAATAATGG + Intronic
1107878410 13:44810771-44810793 GTGACAAGAAAAATAAGTCAGGG + Intergenic
1110364662 13:74668474-74668496 TGGAACTGGATAATAAGTAAAGG + Intergenic
1111145596 13:84175102-84175124 GGGAATTGAACAATAACACATGG - Intergenic
1111519174 13:89377741-89377763 GGGAAATAAAAAATAAATTAAGG + Intergenic
1112240426 13:97676268-97676290 GGGTAATGAAAAATAGGTTATGG - Intergenic
1112643979 13:101308362-101308384 GGGAAGGGAAAAATGAGTCCAGG - Intronic
1113020298 13:105877616-105877638 GGGAACTGAAGAAATAATCATGG + Intergenic
1113187398 13:107704504-107704526 GGGAACTAAAAAATAACTTTGGG - Intronic
1114135272 14:19841200-19841222 GTGAACTCAAAAATATCTCATGG + Intergenic
1114412468 14:22514046-22514068 GTACACTGAAAAATAATTCAAGG - Intergenic
1114961855 14:27901855-27901877 GAGAACTGAAAATTGTGTCAGGG - Intergenic
1115618398 14:35118214-35118236 GGGAACAGAAAAATGAGGAATGG + Intronic
1115721232 14:36163016-36163038 AAGAACTGAAAAATAAAGCAAGG + Intergenic
1115726320 14:36220631-36220653 GAAAATTGAAAAATAAATCAAGG + Intergenic
1115844251 14:37508330-37508352 GGGAATTGAAAAATTAGAGATGG - Intronic
1115857085 14:37642107-37642129 GAGATCTGAAAGAGAAGTCAAGG - Intronic
1116066004 14:39984102-39984124 AGGAACTAAAAAATAAGAGAAGG + Intergenic
1117861820 14:60099903-60099925 GGGAAAAAAAAAATTAGTCAGGG + Intronic
1118803671 14:69214936-69214958 TAGAATGGAAAAATAAGTCATGG - Intronic
1119921785 14:78453337-78453359 AAGAACTGGAAAATAAGGCAAGG + Intronic
1120014779 14:79459350-79459372 TGAAACTGAAAAATAAAGCAAGG - Intronic
1120221118 14:81734857-81734879 GTGAATTTAAAAATAAATCAAGG + Intergenic
1120774609 14:88420082-88420104 GAGAATGGAAAAATAAGTCTGGG + Intronic
1120821434 14:88915189-88915211 AGGAACAGAAGAATGAGTCAAGG + Intergenic
1121175611 14:91888735-91888757 GGGAACTGGAACATGAGTCAGGG + Intronic
1121752251 14:96366891-96366913 GGGAAATGAAAGAAAAGCCAAGG + Intronic
1121920666 14:97877903-97877925 GAGAATAGAAAAATAATTCATGG + Intergenic
1122065587 14:99171576-99171598 GGGAAGAGAAAAATAAGTACAGG + Exonic
1123152025 14:106191289-106191311 GGGAACTGCAAAAGAGGGCAAGG - Intergenic
1123172145 14:106383603-106383625 GGGTACTGCAAAAGAAGGCAAGG - Intergenic
1123400412 15:19979115-19979137 GGGAACTGCAAAAGAGGGCAAGG - Intergenic
1124512865 15:30341397-30341419 GGGAATTGAACAATAACACATGG - Intergenic
1125742373 15:41974229-41974251 GGGAAGTGAAAAGAAAGCCAAGG + Intergenic
1126363167 15:47866897-47866919 GAGAACTGATAAATAAATCATGG + Intergenic
1126561942 15:50053559-50053581 GGGAACTGAAAGAGAATCCAAGG - Intronic
1126910663 15:53414152-53414174 GGGAAATGAAAAATAATTGTTGG - Intergenic
1127139292 15:55957909-55957931 GGGAACTGAACAATAACACCTGG + Intronic
1127713280 15:61622841-61622863 GGGGACTCCAAAATAAGTCATGG + Intergenic
1129038987 15:72669908-72669930 CGGGATTAAAAAATAAGTCATGG + Intergenic
1129210847 15:74067006-74067028 TGGGATTAAAAAATAAGTCATGG - Intergenic
1129399501 15:75273760-75273782 CGGGATTAAAAAATAAGTCATGG + Intronic
1129403164 15:75298323-75298345 TGGGATTAAAAAATAAGTCATGG + Intergenic
1129716143 15:77852229-77852251 GAAGACTCAAAAATAAGTCACGG + Intergenic
1130418589 15:83718116-83718138 GGGATCTGCAAAATATGTCCTGG - Intronic
1131851319 15:96546539-96546561 GGGAACTGCTTAATAAATCAGGG + Intergenic
1132141617 15:99401655-99401677 AGGAACTGAAAAATCACTCCAGG + Intergenic
1133110581 16:3545789-3545811 GGGAAGTGAGAAATGAGTCCAGG + Intronic
1133377925 16:5304962-5304984 AGGAACTGAAAAACAGGTAAAGG - Intergenic
1134213850 16:12300662-12300684 TGGAACTCAAAGAGAAGTCAGGG - Intronic
1134568697 16:15273453-15273475 GGGAACAGAGAAATACCTCATGG + Intergenic
1134733736 16:16482909-16482931 GGGAACAGAGAAATACCTCATGG - Intergenic
1134933764 16:18229373-18229395 GGGAACAGAGAAATACCTCATGG + Intergenic
1135935884 16:26779603-26779625 GTGATCTGCAAAATAACTCAGGG - Intergenic
1138886303 16:61083365-61083387 AGGAAGTGAAAAATAAGACAAGG + Intergenic
1140715562 16:77722699-77722721 GGGAGCTGCAAAATCAGTCCCGG - Intronic
1140901976 16:79376728-79376750 GGGAATTGAACAATAACACATGG - Intergenic
1144148537 17:12421169-12421191 GGGCAATGCAAAATAAGACAGGG - Intergenic
1144929785 17:18850044-18850066 TGGAAATGAAAAACAAGTCCTGG - Intronic
1144929974 17:18851249-18851271 TGGAAATGAAAAAAAAGTCCTGG + Intronic
1146827920 17:36040114-36040136 GGCAAATGGAAAATAAATCACGG - Intergenic
1148992873 17:51681656-51681678 GGTAAGAGAAAAATAAGTCGTGG + Intronic
1149576562 17:57717444-57717466 GGGAGATGAAAAATAATTGAAGG - Intergenic
1150018901 17:61590338-61590360 GGAAACTGAAGAATAAGCCAGGG + Intergenic
1153498658 18:5725121-5725143 TGGAACTGAAAAGCAAGTAATGG - Intergenic
1154184090 18:12166538-12166560 GGAAACTAAAAAAAAATTCAAGG - Intergenic
1154459402 18:14565155-14565177 GTGAACTCAAAAATATCTCATGG + Intergenic
1155683461 18:28518356-28518378 GGGAGCTGAACAATAACACATGG + Intergenic
1155704917 18:28797337-28797359 GAGGACTGATAACTAAGTCAGGG - Intergenic
1156249024 18:35332923-35332945 GGGAAATGCAAAATAAGAAAAGG + Exonic
1156593409 18:38518012-38518034 GGGAACTGCACAATTAGTGAAGG - Intergenic
1156809952 18:41236219-41236241 GGGAACATAAAAATAAACCAAGG - Intergenic
1158669753 18:59464135-59464157 TGGAACTTAAAAAGTAGTCAGGG + Intronic
1159030344 18:63224404-63224426 GGGAAAAGAAAAATAAGGTAAGG + Intronic
1159182415 18:64925525-64925547 GGGAAAGGAAAAATAACTAATGG + Intergenic
1159561775 18:70002613-70002635 GAGATCTGAAAAATAAATCTAGG - Intergenic
1161159193 19:2752390-2752412 GAAAAATTAAAAATAAGTCAGGG - Intergenic
1162005828 19:7778298-7778320 GGGAACTGGAAACTGTGTCAAGG + Intergenic
1165451875 19:35888521-35888543 GGGGACTGGAAAATCAGTCCAGG + Exonic
1165613890 19:37181642-37181664 GTGAATGGATAAATAAGTCATGG + Exonic
1165650003 19:37478530-37478552 GGCAACAGAAAAATAAATTAAGG - Intronic
1165689187 19:37850122-37850144 TGGAACTGAAAACTGTGTCAAGG - Intergenic
1167563497 19:50241027-50241049 AGGAAGTGAAAAATAAATCAAGG + Intronic
927693948 2:25227637-25227659 GGAAGCTGAAAAATAAGTTATGG - Intergenic
928083859 2:28333455-28333477 GGGAACTGAATCAGGAGTCAGGG - Intronic
928676519 2:33656638-33656660 GGGAATTGAACAATAACACAAGG + Intergenic
929089432 2:38200320-38200342 TTGAACTGAAAAATATCTCACGG + Intergenic
929298241 2:40272166-40272188 GGGAATTAAAAAATAAGTTTTGG - Intronic
929422366 2:41806148-41806170 GGGAGCTGAACAATGAGACATGG + Intergenic
929735908 2:44548957-44548979 GTGAACTGATAAATGAGTGATGG + Intronic
929824476 2:45299596-45299618 GTAAAATGAAAAATGAGTCAGGG - Intergenic
930798799 2:55420771-55420793 GGGAACTTAAAATTATTTCAAGG - Intergenic
930997645 2:57740513-57740535 ATGAACTGAAAAATAAGTGAGGG + Intergenic
931308106 2:61052547-61052569 GGAAACTGAAAAATAAATAATGG - Intergenic
933270405 2:80226905-80226927 GGGAAATGAAATAAAAGTGAAGG - Intronic
933284383 2:80369292-80369314 GGACACTTAAAAATAAGGCAGGG + Intronic
933381509 2:81552656-81552678 GTGAACTGGAATATAAGTGAAGG + Intergenic
933471363 2:82729897-82729919 GGGAACAGAAAATTAAATTAGGG + Intergenic
935513417 2:104004096-104004118 GAGAAATGACAAATAAGACATGG + Intergenic
935545117 2:104392919-104392941 GCATACTGAAAAATAATTCATGG - Intergenic
936715731 2:115185460-115185482 CAGAACTGAAAGATAACTCATGG + Intronic
937878378 2:126844855-126844877 TGGAACTGAATAAAAAGTCCAGG + Intergenic
937948698 2:127366614-127366636 AGCAACCGAAAAATAATTCAGGG - Intronic
939215739 2:139236165-139236187 GGGACCTGAAAAATGAGTTGTGG + Intergenic
940690320 2:156909777-156909799 TGGCACTGAAAAATAAATGATGG - Intergenic
942096578 2:172540053-172540075 GGCAAGTGAAAAATCTGTCAGGG + Intergenic
942383047 2:175412799-175412821 GGGGAGAGAAAAATATGTCAAGG - Intergenic
942617210 2:177805324-177805346 GCAAACTGAAAAAAAAATCATGG - Intronic
944345808 2:198664436-198664458 GAGAAATGAAAAATAAGTTATGG + Intergenic
944357094 2:198803504-198803526 GTGACAGGAAAAATAAGTCAAGG + Intergenic
945033342 2:205684764-205684786 GGGAATTTAGAAATAAGGCAAGG - Intronic
945172768 2:207013977-207013999 GTTAACTGAAAAATAAGACTAGG + Intergenic
945399273 2:209359834-209359856 GGGAATTGTAAAATAAATAATGG + Intergenic
945911214 2:215651550-215651572 GGGAAAGGAAAAGTAAGTGAAGG + Intergenic
946517903 2:220433305-220433327 AGGAATTGAACAATAAGTCTTGG + Intergenic
948378702 2:237538825-237538847 AGGTACAGAAAAATAAATCAAGG + Intronic
1169924050 20:10764955-10764977 GTGAAGTGAAAAATTAGTAAAGG + Intergenic
1170302838 20:14905345-14905367 GCAAACTGAAAAATAAGCAAAGG + Intronic
1170774880 20:19366538-19366560 GGGGACAGAAAAACATGTCAGGG - Intronic
1171113840 20:22507639-22507661 GGGAATTGAAATAGCAGTCATGG + Intergenic
1173161189 20:40653628-40653650 GGGAAATGAGAAATGAGGCAGGG + Intergenic
1174537305 20:51261211-51261233 GGTTTCTGAAAAATAATTCAGGG + Intergenic
1175048046 20:56125830-56125852 GGGAACTAAAAATTGAGTAATGG + Intergenic
1175613474 20:60371949-60371971 GGGAACTGCAAACTAATTCCAGG + Intergenic
1176612894 21:9002016-9002038 GGGAATTGAACAATAACACATGG + Intergenic
1176712221 21:10161448-10161470 GGGAATTGAACAATAACACATGG - Intergenic
1176814742 21:13588183-13588205 GTGAACTCAAAAATATCTCATGG - Intergenic
1177375035 21:20258820-20258842 TAGAACTGAAAACTATGTCAGGG + Intergenic
1177456001 21:21340663-21340685 GAGTATAGAAAAATAAGTCAAGG - Intronic
1181853016 22:25763320-25763342 GGGGACTGAAAAAGAGGCCAAGG + Exonic
1181876607 22:25945459-25945481 TGGAACTGAAGAATAACTCCTGG + Intronic
1181948550 22:26537919-26537941 GGGAATGGAAAAATAAGTGATGG - Intronic
1184048862 22:41989696-41989718 GGGAACAGGAAAAGAAGACAGGG - Intronic
949308165 3:2666794-2666816 GGGAATTGAACAATAACACATGG - Intronic
950900214 3:16490761-16490783 GGGGACTGCAAAATAAATTATGG + Intronic
951349599 3:21590222-21590244 GGGAGTGGAAAAATAAGTAATGG + Intronic
952360715 3:32627614-32627636 TAGAACAGAAAAATAAGACAAGG + Intergenic
953217996 3:40939199-40939221 GGGAACTGCCAAAGAGGTCAGGG - Intergenic
953577583 3:44125642-44125664 GTGAACAGATAAATAAGCCATGG + Intergenic
954640718 3:52096203-52096225 GGGAACTGAGTAGTGAGTCAGGG - Intronic
954904900 3:54052853-54052875 ATGAACAGAAAAATAAATCAGGG - Intergenic
955322050 3:57981557-57981579 GGGAACTTCAAATGAAGTCAAGG + Intergenic
958270710 3:91495819-91495841 GGGAACTGAAATAGAAGTCTGGG + Intergenic
958849150 3:99302826-99302848 GGAAAGTGAAAAAAAAGGCAGGG + Intergenic
959540656 3:107534003-107534025 GAAAAATGAAAAATATGTCATGG + Intronic
960853908 3:122083614-122083636 AGGAACAGAAAAATCAGCCAAGG - Intronic
961150203 3:124631497-124631519 GGGATATGAAAAAAGAGTCAAGG - Intronic
963116811 3:141737313-141737335 GGGGCCTGAAAAATAAGTGTGGG + Intergenic
963989331 3:151635103-151635125 ACAAACAGAAAAATAAGTCAGGG + Intergenic
964013227 3:151916026-151916048 AGGAGCTGAAAAATAATTCTAGG - Intergenic
964732895 3:159885977-159885999 GGTAAGTGAAAAATAATTTAAGG - Intronic
964903416 3:161689216-161689238 GCGAAATGAAAAATATGTCAAGG - Intergenic
965081145 3:164033922-164033944 GGAAAAGGAAAAATAAGACACGG + Intergenic
965521535 3:169672673-169672695 AGAAACTGAAAAATAATTCTAGG + Intergenic
966641078 3:182191383-182191405 GAGTACTGAAAAATGAGTCCAGG + Intergenic
967062929 3:185888712-185888734 GGCAACGGAAAATTAAGTCTGGG + Intergenic
967404496 3:189100365-189100387 GGAAAATGAAAAATCATTCAAGG + Intronic
967506338 3:190257056-190257078 GGTAACTGCAAAATCAGTCCGGG + Intergenic
970334440 4:15020358-15020380 AGGAAAAGAAAAATTAGTCAAGG + Intronic
970596781 4:17607729-17607751 GTGAAATGAAAAAAAAATCAAGG - Exonic
970967163 4:21942059-21942081 GGGAAGTGAAAAGTGTGTCAAGG - Intronic
971351403 4:25859374-25859396 GAGGGCTGAAAGATAAGTCACGG - Intronic
971742772 4:30541120-30541142 GAAACCTGAAAAATAATTCATGG + Intergenic
971906570 4:32733330-32733352 TGGAACTGAAAAATGCATCATGG + Intergenic
972204068 4:36749538-36749560 GTGAATTTAAAATTAAGTCATGG - Intergenic
973096288 4:46204370-46204392 GGGAACGGAAAAATAAGATTAGG + Intergenic
973622174 4:52737857-52737879 GAAAACTGAAGAATAAGTCTGGG + Intronic
974475090 4:62368477-62368499 GTGAACAGAAAAATAAATGATGG + Intergenic
974548206 4:63339505-63339527 GGGAATTGAACAATAACACATGG + Intergenic
975408774 4:74023306-74023328 GTAAAGTGAAAAATAAGTAAGGG + Intergenic
975525280 4:75341896-75341918 GGGAGTTGAACAATAAGACATGG - Intergenic
975549138 4:75592693-75592715 GGAAAGTGAAAAATAAGCTAGGG - Intronic
975553290 4:75634955-75634977 AGGAAATGAAAAGTAAGTGAGGG - Intergenic
975934318 4:79560133-79560155 GGTAAATAATAAATAAGTCATGG + Intergenic
977220686 4:94334412-94334434 GGGAAATGAAAAAAAAATCAAGG - Intronic
979407428 4:120330386-120330408 GTGAACAGAAAAATAACTCATGG + Intergenic
980224997 4:129971407-129971429 GGGAACTGTAAGACAAGTGAAGG - Intergenic
981595117 4:146411631-146411653 GGCACTTGAAAAATAATTCATGG + Intronic
981714187 4:147736741-147736763 GGGAACTGTTAAAGCAGTCAGGG + Intronic
983420930 4:167516174-167516196 GGGAACTTAGAAATAACTCAAGG + Intergenic
983703243 4:170624297-170624319 GGGAAGTGAACCATAAGACATGG - Intergenic
985089993 4:186352716-186352738 GGGAAATCAAAAAGAAGGCAAGG - Intergenic
988269902 5:29000670-29000692 AGGAACTGAAAAATAATTCCTGG + Intergenic
989281325 5:39646901-39646923 GAGGACTGAAAAATGAATCAGGG + Intergenic
989650744 5:43687092-43687114 AGGAACTGGTAAATAAGACATGG + Intronic
989801482 5:45546545-45546567 GGGAAATGAAAAATCACTTAGGG - Intronic
990031671 5:51268030-51268052 GGGACCTGAAAAAAAATGCAAGG + Intergenic
990136597 5:52652449-52652471 GGAAACTGGAAAATACATCATGG + Intergenic
990140836 5:52702213-52702235 GGAAACTGAAAAGTTACTCAAGG - Intergenic
990337063 5:54785089-54785111 AAGAACTAAGAAATAAGTCATGG + Intergenic
990438023 5:55813609-55813631 AGGAAATGAAAAATAAAGCAGGG - Intronic
991218113 5:64179952-64179974 GGAAAATGAAAAATAAAACAAGG - Intronic
991320049 5:65362691-65362713 GGGAAAAGAAAAATATGTGATGG - Intronic
991413251 5:66366072-66366094 GGAAAATGAAAAAAAAGTCTTGG - Intergenic
991499063 5:67257782-67257804 GGTAACTCAAAGATAACTCATGG - Intergenic
992270733 5:75060300-75060322 AGGAACTTAAAAATATGTCCAGG + Intergenic
992988003 5:82253541-82253563 GAAAACTAAAAATTAAGTCAGGG - Intronic
993094534 5:83465969-83465991 GGGAAGTGAGAAATGAGGCAGGG - Intergenic
993553012 5:89298836-89298858 AGGAACTGGAAAATAAGCTATGG + Intergenic
994526592 5:100913480-100913502 GGGAACAGAAAACTAAATCAAGG + Intergenic
995308736 5:110687123-110687145 GAGAAAAGAAAAATAACTCAGGG + Intronic
996402868 5:123082505-123082527 GGAAACTGAAAAACAGTTCAGGG - Intergenic
997369202 5:133346854-133346876 AGGAGCCGAAGAATAAGTCAAGG - Intronic
999046728 5:148477729-148477751 GGGATCAGAGAAATAAGTAAAGG - Intronic
999549657 5:152672535-152672557 GGAAACTGAAAAATCAGTCTGGG - Intergenic
999662624 5:153881568-153881590 GGGAAGCCAAAAGTAAGTCAAGG + Intergenic
1000923695 5:167168616-167168638 AGTAACTGTAAAATAAGTCTGGG - Intergenic
1002976844 6:2087715-2087737 TGAACCTGAAAAATAAGTCTTGG + Intronic
1003591403 6:7440159-7440181 AGGAGATGAAAAATAAGTCAAGG - Intergenic
1007055809 6:38883345-38883367 GGGAACTGCAAAAACTGTCATGG + Exonic
1008247960 6:49202530-49202552 GAGGACTGGAAAATAAATCATGG + Intergenic
1008498430 6:52156043-52156065 GAGAACTGAAAAAGGAGGCATGG - Intergenic
1008984436 6:57525514-57525536 GGGAACTGAAATAGAAGTCTGGG - Intronic
1009172487 6:60418413-60418435 GGGAACTGAAATAGAAGTCTGGG - Intergenic
1010013209 6:71073893-71073915 AGGAAGTGACATATAAGTCAAGG + Intergenic
1010096861 6:72057038-72057060 GGGAAAGGAAAAATAACTAATGG + Intronic
1010246665 6:73666142-73666164 AGGAAATGAAAAATAAGTCAAGG - Intergenic
1010354439 6:74915025-74915047 GGGAGCTGGAAAATAAATCAGGG - Intergenic
1012555527 6:100506557-100506579 GGGAAGTGAGAACCAAGTCAAGG - Intergenic
1012814002 6:103999065-103999087 AGGATCTGAAAAATAACTAATGG - Intergenic
1013215494 6:108023755-108023777 GGGAGCTGAACAATAACACATGG + Intergenic
1016533321 6:145083197-145083219 TTGATCTGAAGAATAAGTCAAGG + Intergenic
1017134266 6:151134469-151134491 ATGAACTGAGAAATAAGCCAGGG + Intergenic
1017225255 6:152013984-152014006 GGTAACTGAAACATAAGCAAAGG + Intronic
1017543390 6:155426067-155426089 GGGAACTGTAAAATCATCCAAGG + Intronic
1018801519 6:167226265-167226287 GGGAACTGAAGAGGAAGTAAGGG + Intergenic
1019827744 7:3298717-3298739 GCTACCTGCAAAATAAGTCATGG + Intergenic
1021255257 7:18384538-18384560 GGGAATTCAAAAATAAGCTAAGG - Intronic
1022881017 7:34587539-34587561 CTCAAGTGAAAAATAAGTCAAGG + Intergenic
1023485500 7:40681951-40681973 GGTTTCTGAAAAACAAGTCAGGG + Intronic
1024822356 7:53347851-53347873 GGGAACTGAACAATAAGACTTGG + Intergenic
1024842238 7:53600484-53600506 GAGAACTGAAAATTGTGTCAAGG + Intergenic
1025025380 7:55512433-55512455 AGGAAAAGAAAAATAAATCAAGG + Intronic
1026445073 7:70477217-70477239 GGCAACTGAAAAATATGGCTGGG - Intronic
1027466907 7:78526611-78526633 AAAAACTGAAGAATAAGTCAGGG - Intronic
1028416251 7:90583570-90583592 GGGAACTGAACCATAAGAAATGG - Intronic
1028697038 7:93726192-93726214 AGGAAGTGACAAATAAGCCAGGG - Intronic
1029231122 7:99069517-99069539 AGAAATTGAAAAATTAGTCAGGG - Intronic
1030110701 7:106024148-106024170 GGGAACTGAAAAACAACTCTAGG - Intronic
1030599722 7:111580033-111580055 GAAAACAGAAAAATAAGTGAGGG + Intergenic
1030970192 7:116046334-116046356 GGTAACTGAAAAATGGGTGACGG + Intronic
1030971633 7:116064525-116064547 GGAAACTGAAAAGCAACTCAAGG + Intronic
1031226782 7:119048383-119048405 GGAAACTGGAAAATCAGTGATGG - Intergenic
1032878800 7:136066577-136066599 TAGAACTGTAAAATAAGTGAAGG - Intergenic
1033968016 7:147001932-147001954 TGGAAATTAAAAATAAGACATGG + Intronic
1035902968 8:3477934-3477956 GCTGACTGAAAAATAAGTCAAGG + Intronic
1036021409 8:4851150-4851172 GGGAATTGAATAATAACACATGG - Intronic
1037455631 8:19060805-19060827 AGGAACTGAAAGATGAGACATGG + Intronic
1037730217 8:21517783-21517805 GGGAACAGAGAAGTGAGTCAGGG - Intergenic
1038250064 8:25895168-25895190 CAGATCTGAAAACTAAGTCATGG + Intronic
1038507277 8:28095423-28095445 GGGAAGAGGAAAATAAGGCATGG - Intronic
1041206767 8:55507552-55507574 GGGAATTGAACAATAACACATGG - Intronic
1042581648 8:70285798-70285820 GGGGAATGAAAAACAAATCAGGG + Intronic
1042934785 8:74047589-74047611 GGGGACTGGTAAATAAGTTATGG + Intergenic
1043720234 8:83540099-83540121 GGCAACTGAATAAAAAATCAGGG + Intergenic
1044571880 8:93728404-93728426 GGAAACAGAAAAATAATTAAAGG + Exonic
1044653739 8:94525452-94525474 GGAAACTCAAAACTAAGACAAGG + Intronic
1046172603 8:110530485-110530507 TGGAACTGAAAAATATGTTAAGG - Intergenic
1047511057 8:125515882-125515904 GAGATCAGAAAAATAAATCAGGG + Intergenic
1050245187 9:3681900-3681922 GGGAGCAGAAAAATAGGACATGG + Intergenic
1053607453 9:39675345-39675367 AGATACTGAAAGATAAGTCAGGG - Intergenic
1053649217 9:40147178-40147200 GGGAATTGAACAATAACACATGG - Intergenic
1053756527 9:41316706-41316728 GGGAATTGAACAATAACACATGG + Intergenic
1053865302 9:42431702-42431724 AGATACTGAAAGATAAGTCAGGG - Intergenic
1054535364 9:66228995-66229017 GGGAATTGAACAATAACACATGG + Intergenic
1054560204 9:66701597-66701619 AGATACTGAAAGATAAGTCAGGG + Intergenic
1055408591 9:76002606-76002628 ACAAACTGAAAAATAGGTCAGGG - Intronic
1055516412 9:77038006-77038028 GAAAACTGAGAAATAAGTTATGG - Intergenic
1056030815 9:82551579-82551601 GAGAACTGAAAGATAAGACTTGG + Intergenic
1057537017 9:95920205-95920227 AGGAAGTGAAAAGGAAGTCAAGG - Intronic
1058895375 9:109396373-109396395 GGAAAATGAAAAAAAAGTGAAGG - Intronic
1059381474 9:113930203-113930225 GGAAACTGAAATGTATGTCAAGG + Intronic
1061051021 9:128195166-128195188 GGGAATAGCTAAATAAGTCATGG + Intronic
1202796974 9_KI270719v1_random:130437-130459 GGGAATTGAACAATAACACATGG - Intergenic
1185498037 X:572665-572687 GGTCATTGAAAAATATGTCATGG + Intergenic
1186345620 X:8689368-8689390 TGGAATTGAAAATTAAGTTAGGG - Intronic
1187100990 X:16191639-16191661 AGGAAATGAAAACTAAGGCAGGG - Intergenic
1188489812 X:30725530-30725552 GGCAACTAGAAAAGAAGTCAAGG - Intronic
1189722364 X:43933309-43933331 GGAAAGAAAAAAATAAGTCAGGG + Intergenic
1190444028 X:50505008-50505030 TGCCACTGAAAAATAAGACATGG - Intergenic
1191707444 X:64108930-64108952 GGGAACTGAACAAGAACACATGG - Intergenic
1191885856 X:65887293-65887315 GGGAACTGAAAATAATTTCACGG - Intergenic
1193457524 X:81749086-81749108 GGGAATTGAACAATAACACATGG + Intergenic
1193694204 X:84687005-84687027 GGGAACAGAAAAATATGACCTGG + Intergenic
1193703112 X:84787966-84787988 GCCAACCGAAAAATAAGCCAAGG - Intergenic
1193898784 X:87149171-87149193 TGGAACTGGATAATAAGTAAAGG - Intergenic
1195650921 X:107283531-107283553 TGGAACTGATAAATAAATCCAGG + Intergenic
1195854305 X:109313732-109313754 GGGAACTGAACAATAACACATGG - Intergenic
1197419920 X:126226356-126226378 CAGAATAGAAAAATAAGTCATGG - Intergenic
1198752030 X:139945770-139945792 GTGGACTGAGAAATAACTCAAGG - Intergenic
1199167201 X:144690890-144690912 GGGAGCTGAACAATAACACATGG - Intergenic