ID: 1105845299

View in Genome Browser
Species Human (GRCh38)
Location 13:24288926-24288948
Sequence TTGAATAGTACAGCTTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105845299_1105845303 29 Left 1105845299 13:24288926-24288948 CCTACAAAAGCTGTACTATTCAA 0: 1
1: 0
2: 1
3: 12
4: 190
Right 1105845303 13:24288978-24289000 TATTACTTCTGTATTTTGCAGGG 0: 1
1: 0
2: 3
3: 36
4: 352
1105845299_1105845302 28 Left 1105845299 13:24288926-24288948 CCTACAAAAGCTGTACTATTCAA 0: 1
1: 0
2: 1
3: 12
4: 190
Right 1105845302 13:24288977-24288999 GTATTACTTCTGTATTTTGCAGG 0: 1
1: 0
2: 2
3: 19
4: 229
1105845299_1105845300 -10 Left 1105845299 13:24288926-24288948 CCTACAAAAGCTGTACTATTCAA 0: 1
1: 0
2: 1
3: 12
4: 190
Right 1105845300 13:24288939-24288961 TACTATTCAAATAATTTATTTGG 0: 1
1: 0
2: 3
3: 47
4: 574

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105845299 Original CRISPR TTGAATAGTACAGCTTTTGT AGG (reversed) Intronic
903086087 1:20860614-20860636 TGCCATAATACAGCTTTTGTAGG - Intronic
903381230 1:22898286-22898308 TTAAATAGGACAGCTTGGGTTGG + Intronic
904435003 1:30489160-30489182 TTGAATTGAACAGCTTTAATGGG + Intergenic
907744797 1:57202360-57202382 TTGATGAGGACAGATTTTGTTGG + Intronic
909202834 1:72713672-72713694 TTGAATATTAGACCTTTTTTAGG + Intergenic
910541876 1:88368768-88368790 TTTAATAATACTGCTTTTCTGGG + Intergenic
912643051 1:111365636-111365658 TTTAATAGTACATCTTTGGGGGG - Intergenic
917343251 1:174002724-174002746 TAGAAAAGGGCAGCTTTTGTAGG - Intronic
918796276 1:188900994-188901016 TTGAATAGTAAAGATTTTATTGG + Intergenic
918829793 1:189380011-189380033 TTACATATTACAACTTTTGTAGG + Intergenic
918883057 1:190152059-190152081 TTGAATACTACAGCCCTTTTTGG - Intronic
919051061 1:192511939-192511961 TGGAATAATACAGCTATTCTAGG - Intergenic
919883538 1:201916547-201916569 TTTCATAAAACAGCTTTTGTTGG - Intronic
921010525 1:211136031-211136053 TTGAATACTACAATTTTTGGTGG + Intergenic
921559701 1:216642344-216642366 ATGAATAGTAAAGATTTTGAAGG - Intronic
923084302 1:230690796-230690818 ATGTATAATACAGTTTTTGTGGG + Intronic
1063397152 10:5699460-5699482 TTGAATTGTACACTTTATGTGGG + Intronic
1063915088 10:10873584-10873606 TTGAATAGGAGAGCCTTGGTAGG - Intergenic
1064842331 10:19607777-19607799 TCCATTAGAACAGCTTTTGTTGG - Exonic
1066611740 10:37255849-37255871 AGGAATAGTCCAGCTTTTATGGG - Intronic
1069402850 10:68067890-68067912 TTGAATTTTTTAGCTTTTGTTGG + Intronic
1070766389 10:79058833-79058855 TTGAATAGTATGGCTTCTGGAGG - Intergenic
1072197024 10:93125043-93125065 ATGAACAGCACAGCCTTTGTGGG - Intergenic
1073885186 10:108030811-108030833 TAAAATAGTACAGCTTCTGTGGG + Intergenic
1074797886 10:116967309-116967331 TTGGAAAGTACAGCTTTTGTGGG + Intronic
1076227704 10:128793487-128793509 TTGAATAGTAAAGATTATGGGGG - Intergenic
1076641194 10:131918178-131918200 TGGAATGGCACAGCGTTTGTAGG + Intronic
1076641330 10:131918900-131918922 TGGAATGGCACAGCGTTTGTAGG + Intronic
1076641399 10:131919268-131919290 TGGAATGGCACAGCGTTTGTAGG + Intronic
1076641419 10:131919370-131919392 TGGAATGGCACAGCGTTTGTAGG + Intronic
1079551845 11:21709227-21709249 TTGAATGGTACAGGCTTTTTTGG + Intergenic
1080245715 11:30177331-30177353 TTGCAGAGTACAGCTTTCATGGG + Intergenic
1080678833 11:34454066-34454088 TTGATCAGTACTGATTTTGTTGG + Intronic
1081096880 11:38947230-38947252 TTGTATATTACATCCTTTGTTGG - Intergenic
1083046124 11:59736701-59736723 TTGAGTAAAACAGCGTTTGTGGG - Intronic
1085578846 11:77632226-77632248 TAAAATAATACAGCTTTTGTAGG - Intronic
1094445633 12:30526827-30526849 TATAATAGAACAGCTTTTATTGG + Intergenic
1094562152 12:31565502-31565524 ATGAAAATTACAGATTTTGTTGG - Intronic
1095123360 12:38444485-38444507 TTAAATAGTTCACCTTTTCTGGG - Intergenic
1095622926 12:44280033-44280055 TTGAATATTACTGCTTTTTATGG - Intronic
1097306345 12:58073343-58073365 TGAATAAGTACAGCTTTTGTGGG - Intergenic
1098508964 12:71289322-71289344 TAAAATTGTAAAGCTTTTGTAGG - Intronic
1098608542 12:72424757-72424779 TTTAATATTAAAGCTTTTGGGGG + Intronic
1098717473 12:73849205-73849227 TTGAATAGGATAGTTTTTGGTGG - Intergenic
1098809711 12:75070778-75070800 TTTATTAGGACAGCATTTGTGGG + Intronic
1098823372 12:75261580-75261602 TTGTACAGTACAGTTTTTGCTGG - Intergenic
1099109523 12:78540044-78540066 TTCAAAAGTAAAGCTTTTGTGGG + Intergenic
1100712256 12:97270152-97270174 TTAAATATTAAAACTTTTGTTGG - Intergenic
1104325644 12:127793973-127793995 TTCAATAGTACAACTTTGTTAGG - Intergenic
1105845299 13:24288926-24288948 TTGAATAGTACAGCTTTTGTAGG - Intronic
1106014619 13:25856970-25856992 AGGAATAGTCCAGCTTTTATGGG - Intronic
1109432570 13:62254436-62254458 TTAAAAAGTATAGCATTTGTCGG + Intergenic
1109598488 13:64591082-64591104 TTCATTAATACAGCTTTTTTGGG - Intergenic
1110689695 13:78417860-78417882 TAGCATATTACAGTTTTTGTTGG + Intergenic
1111683167 13:91468818-91468840 TTGAATAGTAAAGATTTTATTGG - Intronic
1114593329 14:23890177-23890199 TAGAAGAGTAAAGCTCTTGTGGG - Intergenic
1114906539 14:27135210-27135232 TTGAATAGTAGATCTTCTATTGG - Intergenic
1116070877 14:40043738-40043760 TTGTATAGTACAGATTTTGGGGG - Intergenic
1120608907 14:86614821-86614843 TTGAATAGTACTGTTTTTAAGGG - Intergenic
1122120117 14:99548553-99548575 TTCACTAGTACAGCTGGTGTTGG - Intronic
1123917351 15:25045650-25045672 TTGACAAATTCAGCTTTTGTTGG + Intergenic
1131800726 15:96067155-96067177 TTGATTAAAACAGCTTTTCTGGG - Intergenic
1132384963 15:101393709-101393731 TGGAATAGAGCAGCTTGTGTTGG - Intronic
1134265261 16:12687097-12687119 TTAAATAGTTTAGGTTTTGTGGG - Intronic
1137321105 16:47383527-47383549 TTGGATAGTAGCGCTTGTGTAGG - Intronic
1140852689 16:78949481-78949503 TTCAATAGAATTGCTTTTGTGGG + Intronic
1140960427 16:79906780-79906802 TTGAATAGTACAGCTATAAAAGG + Intergenic
1141301876 16:82823650-82823672 TTCAATAATACTGCTTTTGGAGG + Intronic
1142779760 17:2172385-2172407 TTAAATAGTGCAGCTTGTGTTGG - Intronic
1143617350 17:8060645-8060667 TTAAATAGTCAAACTTTTGTTGG + Intergenic
1147272353 17:39283695-39283717 TTCTAGAGTACCGCTTTTGTAGG + Intronic
1147273616 17:39295820-39295842 TTGTATAATACACCTTTTATAGG - Intronic
1148041106 17:44708128-44708150 TGGATAAGTACAGTTTTTGTGGG + Intergenic
1148616307 17:49003120-49003142 TTTAATGGCACAGCTTTTGGTGG + Intronic
1149138417 17:53399370-53399392 GTGAATAGTGGAGCTTTTGGAGG - Intergenic
1150457419 17:65318103-65318125 TTAAATAGGACAGTTTTTGCAGG - Intergenic
1150944567 17:69731011-69731033 TTGAATAGTACTTCTGTTGAAGG + Intergenic
1152057357 17:78040524-78040546 TAGAATATTACAGCTAGTGTTGG + Intronic
1152919433 17:83058585-83058607 TTGATTTGTAAAGCTTGTGTTGG + Intergenic
1153683696 18:7524785-7524807 TTTACTAGTACATCTTTTGTTGG + Intergenic
1154363525 18:13685627-13685649 TTGAATTGTCCTGCTTTTCTAGG + Intronic
1157076060 18:44468925-44468947 CTGCTTGGTACAGCTTTTGTAGG - Intergenic
1158847500 18:61459986-61460008 TTGAAAAGAAAAGCTCTTGTTGG + Intronic
1159205949 18:65252822-65252844 TGGAAGAGTAAAACTTTTGTTGG + Intergenic
1160194700 18:76742925-76742947 TTGAACAGTCCTGCTTTTGGTGG + Intergenic
1166419821 19:42627799-42627821 TTCTATAGTACATCTGTTGTTGG + Intronic
1168174114 19:54610486-54610508 TTGAATAGGCCTGTTTTTGTTGG - Intronic
925835921 2:7946792-7946814 TTGAAAAGTACAGATATTGTTGG + Intergenic
927358768 2:22207429-22207451 ATGGATAGTTCAGCTTTAGTGGG + Intergenic
928204538 2:29274609-29274631 CTGAATAGAACAGCTTTGGAGGG + Intronic
931089449 2:58869649-58869671 TGGAATAGTACACCCTTTGGGGG + Intergenic
935120330 2:100178521-100178543 TTGAACAGTACTGCTCTTCTGGG - Intergenic
935942901 2:108260047-108260069 TTCATTAGTACAGCATTTGTTGG + Intronic
936578440 2:113674607-113674629 TTGACTAGCACAGCTTATGCAGG - Intergenic
938657557 2:133449879-133449901 TTGCATAGCACAATTTTTGTGGG + Intronic
941414218 2:165198938-165198960 TTTAATAGGACACGTTTTGTGGG - Intronic
942704727 2:178757679-178757701 TGGAAAACTACATCTTTTGTTGG + Exonic
942961637 2:181836635-181836657 TTGAATAGGACAGCATTTAAAGG - Intergenic
943231006 2:185252240-185252262 TTTAAGACTACAGCTTCTGTAGG + Intergenic
943231493 2:185258570-185258592 TTAAATAATACTGCTTTGGTGGG + Intergenic
944649955 2:201819888-201819910 TTGATAATTACAGTTTTTGTAGG - Intronic
945636703 2:212363151-212363173 TTGGATAGTATAGCTTTTAAAGG + Intronic
945916193 2:215706478-215706500 TTTAATACTACTGCATTTGTGGG + Intergenic
946515637 2:220408013-220408035 TTGACTAGTCTAGCTTTTTTTGG + Intergenic
1173886907 20:46467735-46467757 TTAAATAGTAGAGCTTTTAGAGG - Intergenic
1177577234 21:22974205-22974227 TTGAATTATACAGCATTTTTAGG + Intergenic
1177665815 21:24157903-24157925 TTGAATATGACAGCTTCTGAAGG - Intergenic
1178833758 21:36078675-36078697 TTGACTCTTCCAGCTTTTGTGGG - Intronic
1182881395 22:33736983-33737005 TTGACCTGTACATCTTTTGTGGG - Intronic
1182890844 22:33817751-33817773 TTCAGTAGTACACCTTCTGTTGG + Intronic
1182943144 22:34297487-34297509 TGGAGTAGTCGAGCTTTTGTAGG - Intergenic
1183103569 22:35598841-35598863 TTTAAGAGTACAGATTTTGGCGG + Intergenic
951041136 3:17989855-17989877 TTGAACAGTATGGATTTTGTAGG + Intronic
952699258 3:36308424-36308446 TTTTATAGTACATCTTTTTTGGG - Intergenic
954934996 3:54318271-54318293 GAGAATAGGACAGCTTTGGTGGG + Intronic
955127505 3:56128135-56128157 ATGAATAGGAGAGCTTGTGTTGG - Intronic
955138588 3:56246157-56246179 TTTAATATTTCAGCTTTTCTTGG + Intronic
956470985 3:69566632-69566654 GTAAATAGTTCAGGTTTTGTAGG + Intergenic
956519735 3:70090709-70090731 GTTAAAAGTACAGCTTTTATTGG + Intergenic
958466353 3:94464371-94464393 TTGATTAGCACAGATTTTCTTGG - Intergenic
958577754 3:95974273-95974295 TTGAGTATTGCAGCTTTTCTAGG - Intergenic
959343039 3:105155831-105155853 TTGTATAGTACATTTGTTGTAGG - Intergenic
959405522 3:105958177-105958199 TTGAATTTCACAGCTTTTCTGGG + Intergenic
960790271 3:121422571-121422593 GTCAGTAGTACTGCTTTTGTAGG - Exonic
961666790 3:128497738-128497760 TGGAAAAATACAGCCTTTGTCGG - Intergenic
965229430 3:166031263-166031285 TTGGATAGAACAACTTTAGTAGG + Intergenic
967325237 3:188232084-188232106 TTGAAAAGGACTGCTTTGGTCGG - Intronic
970382983 4:15526744-15526766 TTGATTACTACAGCTACTGTGGG - Intronic
970744440 4:19278617-19278639 TGTAATAGCACAGTTTTTGTTGG + Intergenic
971264635 4:25087127-25087149 TTGAACAGTGCAGCTTTAGAAGG - Intergenic
971469032 4:27000023-27000045 TTGAAAAGTACACCTTTTAAAGG + Intronic
973690730 4:53427660-53427682 TTGAATACTTCAACTTTGGTTGG + Intronic
974310946 4:60209410-60209432 TTGAGTAGTGCAGCTTTTCCAGG + Intergenic
974571665 4:63658654-63658676 TTTAATACTACAACTTTTCTTGG - Intergenic
978406000 4:108379290-108379312 TTGAATTGTGCAATTTTTGTAGG + Intergenic
979114417 4:116803919-116803941 TTGAATAAAACAGGCTTTGTAGG - Intergenic
979425222 4:120555585-120555607 TTGAATTGTACAGTGTCTGTGGG - Intergenic
980992078 4:139746921-139746943 TGGACTAGGCCAGCTTTTGTCGG + Intronic
981365619 4:143898928-143898950 ATGAATAGTACAGCTATTTGAGG - Intronic
981375625 4:144011931-144011953 ATGAATAGTACAGCTATTTGAGG - Intronic
981386238 4:144134119-144134141 ATGAATAGTACAGCTATTTGAGG - Intronic
982649043 4:158063868-158063890 TTAAATATTTCAGGTTTTGTAGG + Intergenic
983405208 4:167320725-167320747 TCGCATAGTAAAGCTTTTCTCGG + Intergenic
984133548 4:175907984-175908006 TTGAATAGTAAAGGATTTTTAGG + Intronic
985108803 4:186526240-186526262 TAGAATAGAACAGCGTTTGTTGG + Intronic
987959727 5:24790823-24790845 TTCCATAGTACAGGTTTTTTTGG - Intergenic
989050096 5:37311524-37311546 ATGAATAGTGTGGCTTTTGTTGG - Intronic
989099769 5:37812955-37812977 TTGGATCCTACAGCTTTTTTGGG + Intronic
989159654 5:38378227-38378249 TTGCTTAGTACAGCTGTCGTTGG + Intronic
990431665 5:55740871-55740893 TTCCATATTACAACTTTTGTGGG + Intronic
991907848 5:71530025-71530047 TTGAATTGTACACCTTAAGTGGG + Intronic
992461320 5:76963003-76963025 TTGAAAAGTAAAGCATTTTTTGG + Intronic
993390509 5:87314977-87314999 TTGAATATTACACCTTTTTGAGG + Intronic
1002987460 6:2204508-2204530 TTGAATAGCACAGCTCTGGAAGG - Intronic
1003123919 6:3340106-3340128 CTGGATAATACCGCTTTTGTGGG - Intronic
1003784235 6:9466222-9466244 TTGAATATTACGATTTTTGTTGG - Intergenic
1004913101 6:20306058-20306080 TTGCATAGTACAGCTCTGGAAGG + Intergenic
1005364916 6:25067084-25067106 TTGCAAAGCACAGGTTTTGTGGG + Intergenic
1008902883 6:56642888-56642910 CTGAATATTACAGCTTTTAGTGG + Exonic
1011408337 6:87039331-87039353 ATCAATAGTACAGCATTTGGGGG - Intergenic
1011825988 6:91306023-91306045 TTGAATAGAAAAGACTTTGTGGG + Intergenic
1012218611 6:96620288-96620310 TTGAAAAGTACTGATCTTGTGGG + Intergenic
1014962989 6:127710568-127710590 TTAGATAGTACAGCTTATGCTGG - Intronic
1014982482 6:127960883-127960905 TTTAATGGTACTGCTTTTATTGG + Intergenic
1016359104 6:143249213-143249235 TTGACTTGTACACCTTCTGTGGG + Intronic
1017997545 6:159545739-159545761 TAGAATAGTAAAGCTTATTTTGG - Intergenic
1019821207 7:3244143-3244165 TTGAATAGAACAGGTTATGAGGG - Intergenic
1020570076 7:9849601-9849623 TTTAAAAATAAAGCTTTTGTTGG + Intergenic
1021123950 7:16828524-16828546 TTAAATAGTAGAGTTTTTATTGG + Intronic
1023401419 7:39794797-39794819 TTAAAAAGTACAGCTTAAGTTGG + Intergenic
1027798776 7:82725571-82725593 TTAAATAGTACAACTTTGGCTGG - Intergenic
1028949779 7:96621315-96621337 TTGAATTGTGAAGCTTTGGTAGG + Intronic
1029018494 7:97339222-97339244 TTGAATAGTTGATCTTATGTTGG + Intergenic
1029857027 7:103527979-103528001 TAAAAGAGTACAGCTGTTGTGGG + Intronic
1030378806 7:108787376-108787398 TTGAATAGTATTTCTTTTTTAGG - Intergenic
1031332793 7:120486784-120486806 TTTAAAAGGACAGCTTTGGTAGG - Intronic
1032753570 7:134866456-134866478 TTGTATAGTTTTGCTTTTGTTGG + Intronic
1039005224 8:33028714-33028736 TTGTATAGAGGAGCTTTTGTAGG - Intergenic
1041887019 8:62821924-62821946 TCGAAAAGTACAGCTTCTGGGGG - Intronic
1042005838 8:64178619-64178641 TTTTATAGTGCAGGTTTTGTAGG - Intergenic
1043289136 8:78574031-78574053 TTGAATAGTACATCTAATGAAGG - Intronic
1043957683 8:86380483-86380505 TTGAATTGTACAGTTTAAGTGGG + Intronic
1045042110 8:98235314-98235336 TTGAATTTTCCAGCTATTGTTGG - Intronic
1046005441 8:108476578-108476600 TAGAATAGAATAGCTTTTTTGGG + Intronic
1047048087 8:121077625-121077647 TTCTATAATACACCTTTTGTGGG - Intergenic
1050041681 9:1502033-1502055 TAAAATGGTACAGCTGTTGTGGG - Intergenic
1051483336 9:17582528-17582550 TTTAAAAATACAGATTTTGTAGG - Intronic
1051619218 9:19034531-19034553 GTGAATATTTTAGCTTTTGTGGG - Intronic
1051638312 9:19201414-19201436 TTGAATTGTACAGCTTAAATTGG + Intergenic
1053281981 9:36826459-36826481 TTGATTATTTCAGCTTCTGTGGG + Intergenic
1054837731 9:69697338-69697360 TTCAATAGATTAGCTTTTGTAGG + Intergenic
1056893559 9:90519037-90519059 TTGAATACTATAGATATTGTTGG - Intergenic
1057532586 9:95864881-95864903 TTAAATAGTACAGCTATTATTGG - Intergenic
1185742847 X:2547685-2547707 TTACATAATACAGCTTTTGCGGG - Intergenic
1186366165 X:8895958-8895980 TAGAATAATGCATCTTTTGTGGG - Intergenic
1186945495 X:14561538-14561560 TTAAATAGTTTAGCCTTTGTGGG - Intronic
1187967694 X:24628960-24628982 ATAAATGATACAGCTTTTGTAGG - Intronic
1188309003 X:28594683-28594705 TTTATTAGTACAGCTAATGTTGG + Intronic
1188819593 X:34758160-34758182 TGTAATAGAATAGCTTTTGTTGG - Intergenic
1193763750 X:85499409-85499431 GAGAAAAGGACAGCTTTTGTTGG + Intergenic
1193858608 X:86637352-86637374 TTGAATAGTATATTTTTTTTGGG - Intronic
1194491390 X:94554348-94554370 CTGAATAATACAGATTTTGGTGG + Intergenic
1194784794 X:98069497-98069519 TGGAACAGTCAAGCTTTTGTTGG + Intergenic
1199776890 X:151019955-151019977 ATGAATATAACAGCTTTTCTGGG + Intergenic