ID: 1105846827

View in Genome Browser
Species Human (GRCh38)
Location 13:24300697-24300719
Sequence CCTTCAGAGGGGCTGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 350}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105846820_1105846827 1 Left 1105846820 13:24300673-24300695 CCATTGGAATGTGGGCATAGGAA 0: 1
1: 0
2: 0
3: 26
4: 411
Right 1105846827 13:24300697-24300719 CCTTCAGAGGGGCTGCTGGAGGG 0: 1
1: 0
2: 2
3: 35
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105846827 Original CRISPR CCTTCAGAGGGGCTGCTGGA GGG Intronic
900767302 1:4513955-4513977 GCTCCAGGGAGGCTGCTGGAGGG + Intergenic
900799455 1:4728312-4728334 CCTTCCGATGGCATGCTGGAGGG + Intronic
900805090 1:4762417-4762439 CCTTCAGAGGGGCTGGAGACTGG + Intronic
901203505 1:7480593-7480615 CCTGAAGAGGTGCTGCTGGGAGG - Intronic
901301453 1:8202573-8202595 CCGTCAGAGGAGCTGCTGCAGGG + Intergenic
901685582 1:10941789-10941811 CCTTCTGAGGGGCCTCTGGAGGG - Intergenic
902217027 1:14940753-14940775 CTTCCAGAGGGGCTGCCTGATGG - Intronic
902608023 1:17580078-17580100 CCTTCAGCAGGGCTACCGGAAGG + Intronic
903029353 1:20451878-20451900 CCTGCTGAGGGGTTGCTGGAGGG - Intergenic
905313107 1:37064352-37064374 ATTTCTGAGAGGCTGCTGGAAGG + Intergenic
905502291 1:38449330-38449352 CCCTCTGAAGGGCTGCTGGGTGG - Intergenic
905771460 1:40640544-40640566 CCTTCAAATAGGCAGCTGGATGG - Intronic
905793563 1:40802765-40802787 CCTACAGAGGGGTTGCAGAAAGG - Intronic
907280512 1:53344158-53344180 CACTGAGAGGGCCTGCTGGATGG + Intergenic
908702771 1:66920189-66920211 ACTTCAGAGGGACAGCTTGATGG + Intronic
916743893 1:167669745-167669767 CCTCAAGAGGGGGTACTGGAGGG - Intronic
917361892 1:174185717-174185739 CTTTCAAAGGGGGTGCAGGAAGG - Intronic
917458294 1:175204771-175204793 CCTCCTGAGGAGCTGCTGGATGG - Intergenic
919588048 1:199463529-199463551 CCTGCATAGGGCCTGCTGGGAGG + Intergenic
919768873 1:201144514-201144536 CCTGCAGAGGGGCTGATGGGAGG - Intronic
920096926 1:203492400-203492422 CCATCAGAGGCTCTGCTGGGTGG - Intergenic
920335152 1:205240280-205240302 CTCACAGAGGGGCAGCTGGATGG - Intronic
920353919 1:205356468-205356490 CATTCTGAGGGCCTGCTGGTGGG - Intronic
920873976 1:209817284-209817306 TCTTCAAAGGGGCTCCAGGATGG - Intergenic
923133440 1:231096960-231096982 ACTGCAGAGGGGCTGCACGAGGG + Intergenic
923712784 1:236400336-236400358 CCTCCAGAGAGGTTGCTGTAGGG + Intronic
924778661 1:247128514-247128536 CTCTCAGAGGAGCAGCTGGATGG + Intronic
924782993 1:247169905-247169927 CTCTCAGAGGAGCAGCTGGATGG - Intronic
1063131868 10:3185372-3185394 ACTTCAGAGGGCCGGCTTGACGG + Intergenic
1063134158 10:3201853-3201875 CTTTCTGAGGGGCTGGGGGAGGG + Intergenic
1063534848 10:6873378-6873400 CCTGCAGAGGGGCTGCCTGGTGG - Intergenic
1066281025 10:33918532-33918554 ACTTCAGAGGGACGGCTTGATGG - Intergenic
1066281656 10:33923730-33923752 ACTTCAGAGGGACAGCTTGACGG + Intergenic
1067405568 10:46020359-46020381 GCTACAGAGGGGCTGCAGTAAGG + Intronic
1067947125 10:50696631-50696653 CCTTCTGAAGGGAAGCTGGAAGG - Intergenic
1068904436 10:62307367-62307389 ACTTCAGAGGGACAGCTTGACGG - Intergenic
1069125610 10:64628846-64628868 ACTTCAGAGGGACAGCTTGATGG + Intergenic
1069247197 10:66220768-66220790 ACTTCAGAGGGACGGCTTGATGG - Intronic
1070154969 10:73827708-73827730 CCTACAGACTGGCAGCTGGAGGG - Intronic
1070240320 10:74673904-74673926 ACTTCAGAGGGACAGCTTGATGG - Intronic
1070586935 10:77773466-77773488 CCTGCATAAGGGCTGCTTGAGGG - Intergenic
1070882436 10:79861621-79861643 CCTTCTGAAGGGAAGCTGGAAGG - Intergenic
1071420509 10:85492642-85492664 CCTGAGGAGGGGCTGCTGGAAGG + Intergenic
1071428460 10:85583034-85583056 ACTTCAGAGGGACAGCTTGATGG - Intergenic
1071510550 10:86259856-86259878 CCTTCAGAGGGACTGCTGGTGGG - Intronic
1071649006 10:87377932-87377954 CCTTCTGAAGGGAAGCTGGAAGG - Intergenic
1072295127 10:94001354-94001376 CCTTTAGAGGGGCTGATGATGGG + Intronic
1072357160 10:94623141-94623163 CCTCCAGATGGTCTGCTTGATGG + Intergenic
1074685654 10:115960233-115960255 CCACCAGAGAGGCTGCAGGATGG + Intergenic
1075485345 10:122818016-122818038 CCTGCAGATGGGCACCTGGATGG + Intergenic
1076345726 10:129777866-129777888 CCCTGAGCTGGGCTGCTGGAAGG - Intergenic
1076566585 10:131403373-131403395 CCTTCGGAGTGGCCTCTGGATGG + Intergenic
1076827185 10:132974928-132974950 CCTTCATAGGGACAGCAGGAAGG + Intergenic
1077148434 11:1056377-1056399 CTTTCAGAGGGCCTCCTGGCCGG - Intergenic
1077503843 11:2921375-2921397 CCTGCAGAGGTGCTGCAGGCTGG + Intronic
1077863653 11:6205269-6205291 GCTTCAGAGATGCTGCTGAAGGG + Intergenic
1081248407 11:40798310-40798332 CTTTCAGAGTGACAGCTGGATGG - Intronic
1081507609 11:43734548-43734570 CCCTCACTGGGGCAGCTGGAGGG - Intronic
1081862090 11:46339089-46339111 CCTGCAGAGGGGCTGGGGGCAGG + Intronic
1085059107 11:73428187-73428209 CCTCCACAGAGGCTGCTGTAGGG - Intronic
1085730715 11:78996359-78996381 CCTTCACAGGGTCAGTTGGAAGG - Intronic
1086340027 11:85839389-85839411 GCTTCAGATGTGCTGCTGGGAGG - Intergenic
1086453395 11:86938721-86938743 CCTTCCGAGGGGCTGGGGGTAGG + Intronic
1086783038 11:90930848-90930870 ACTTCAGAGGGACAGCTTGATGG + Intergenic
1087604165 11:100355385-100355407 CCTTCAGAAGGGCTTCCAGAAGG - Intronic
1087608435 11:100405480-100405502 ACTTCAGAGGGACAGCTTGAGGG - Intergenic
1088625336 11:111726353-111726375 ACTGCAGAGAGGCTACTGGAAGG + Exonic
1088821306 11:113460186-113460208 CCCTCAGTGGGGCTGCTCCAGGG + Intronic
1088953164 11:114590591-114590613 CCTACAGAGGGGCTGAGGGCTGG - Intronic
1089438456 11:118493102-118493124 CCTTCGGGGGAGCTGCGGGAAGG - Exonic
1090384351 11:126347968-126347990 CCCCCAGTGGTGCTGCTGGAGGG + Intergenic
1091452154 12:579391-579413 CTTTCACAGGGGCTTCGGGAAGG - Intronic
1091842132 12:3628750-3628772 CCTTCAGAAAGGCCTCTGGAGGG + Intronic
1092187335 12:6490521-6490543 TTTTCAGAGGGGTGGCTGGAAGG - Intergenic
1092904135 12:13086960-13086982 CCTTCTGAGGGGGTACAGGAAGG - Intronic
1094819174 12:34211415-34211437 CCAGCGCAGGGGCTGCTGGAAGG + Intergenic
1094829359 12:34292879-34292901 CCTGCACAGGGGCTGCTGGGAGG + Intergenic
1094836050 12:34322559-34322581 CCTGCGCAGGGGCTGCTGGGAGG + Intergenic
1095964340 12:47857048-47857070 CCTGCCCTGGGGCTGCTGGATGG - Intronic
1098545760 12:71709447-71709469 CAATTAGAGGGGCTGCTGAATGG - Intergenic
1099280662 12:80641619-80641641 CCTTCAGAGGACCTGCTTGATGG + Intronic
1099365149 12:81758965-81758987 ACTCCAGAGGGGCTCCAGGAGGG - Intronic
1099540794 12:83904895-83904917 ACTTCAGAGGGACAGCTTGATGG - Intergenic
1101164045 12:102009780-102009802 CTGGCAGAGGTGCTGCTGGAAGG - Intronic
1101216693 12:102592999-102593021 ACTTCAGAGGGACAGCTTGATGG - Intergenic
1101432812 12:104641040-104641062 ACTTCAGAGGGACAGCTTGATGG + Intronic
1102395597 12:112583286-112583308 ACTTCAGAGGGGCTGTTGTAAGG - Intronic
1103965158 12:124634078-124634100 CAGTCAGAGGGGCTGGTGGCTGG + Intergenic
1104554885 12:129790514-129790536 ACTTCAGAGGGACGGCTTGATGG - Intronic
1104982573 12:132580851-132580873 CCCTGGGAGGGGCTGCTGCAGGG - Intronic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1105846827 13:24300697-24300719 CCTTCAGAGGGGCTGCTGGAGGG + Intronic
1105892297 13:24690377-24690399 CCTTCAGAGCAGCTGGTGGTGGG + Exonic
1106345657 13:28874584-28874606 CTTTCTGTGGGGCTGCTTGAGGG + Intronic
1106786666 13:33114259-33114281 CCTTCTGAGGGGGTCCTGGCTGG + Intronic
1106870228 13:34011411-34011433 ACTTCAGAGGGACAGCTTGATGG + Intergenic
1107875077 13:44783209-44783231 ACTTCAGAGGGACAGCTTGATGG - Intergenic
1108440411 13:50447434-50447456 ACTTCAGAGGGACAGCTTGACGG - Intronic
1111103948 13:83621913-83621935 ACTTCAGAGGGACAGCTTGATGG + Intergenic
1111366450 13:87251762-87251784 CCTTCAGAGTCACTGCTGGCAGG + Intergenic
1111636231 13:90907678-90907700 ACTTCAGAGGGACAGCTTGACGG - Intergenic
1112547182 13:100382301-100382323 ACTTCAGAGGGACAGCTTGATGG - Intronic
1113782885 13:112986677-112986699 CCATCGGAGGGTCTGCTGGGCGG + Intronic
1115153720 14:30314866-30314888 ACTTCAGAGGGACAGCTTGATGG + Intergenic
1116385940 14:44329993-44330015 CTTTTAGATGGGCTGCTGGGTGG + Intergenic
1116964623 14:51001056-51001078 CCTTCATTGTGGCTGTTGGAGGG + Intronic
1116966600 14:51021662-51021684 GCTTCAGAGTGGCTACTGGTGGG - Intronic
1118863461 14:69683816-69683838 CCTCCAGGTGGGCTGCAGGAAGG + Intronic
1119234565 14:73008675-73008697 CTTTCTGAGGAGCTTCTGGATGG + Intronic
1121321525 14:92994388-92994410 TCATCAGAGGGTCTGCGGGAAGG + Intronic
1121740767 14:96250893-96250915 GCTGCACAGGGCCTGCTGGAGGG + Intronic
1122357833 14:101134621-101134643 CCTTCAGCGGGGCTGCGTGCAGG + Intergenic
1122446477 14:101773343-101773365 CCAGCAGAGGGGCTGCCAGAGGG - Intronic
1122641682 14:103163703-103163725 ACTTCAGAGGGGCAGCTTGATGG + Intergenic
1122657917 14:103274178-103274200 GCTGCTGCGGGGCTGCTGGAGGG - Intergenic
1122830576 14:104393675-104393697 CCAGCAGAGGGGCCGCAGGAGGG - Intergenic
1122883014 14:104698522-104698544 CCCTGAGAGAGGCTGCTGGCTGG + Intronic
1122901376 14:104783682-104783704 CCTTGGGAGTGGCTGCTGGCAGG - Intronic
1122946013 14:105009879-105009901 CCTGCAGAAAGGTTGCTGGAGGG + Exonic
1123492116 15:20789131-20789153 TCTGCTGAGGGCCTGCTGGACGG + Intergenic
1123548620 15:21358221-21358243 TCTGCTGAGGGCCTGCTGGACGG + Intergenic
1124510577 15:30320895-30320917 CATTCAGTGGGTGTGCTGGAAGG - Intergenic
1124732311 15:32209632-32209654 CATTCAGTGGGTGTGCTGGAAGG + Intergenic
1125046958 15:35252566-35252588 CCTTGAGAAGCACTGCTGGAGGG + Intronic
1128367397 15:67013997-67014019 CCTGCAGTGGGGCTGAGGGAGGG + Intergenic
1128558294 15:68646525-68646547 CCATCAGAGGGGCAGCTGCAGGG + Intronic
1128678628 15:69629985-69630007 CCCTCAGAAGGGCTGCAGGTGGG - Intergenic
1130892422 15:88144491-88144513 TCTTGAGAGGGGCTTCTGGAAGG + Intronic
1130912259 15:88278873-88278895 CCTTCAGAGGCCCTGGGGGAAGG + Intergenic
1130967202 15:88706065-88706087 CCATCACTGTGGCTGCTGGATGG - Intergenic
1131366380 15:91845534-91845556 TCTGCAGAGGGGATGCTGGCTGG - Intergenic
1131386637 15:92013725-92013747 CCTTTAGAGGTCCTGCTGGCAGG + Intronic
1132117785 15:99150103-99150125 CCTGCAGAGGTGCTGATGGTTGG + Intronic
1202956954 15_KI270727v1_random:85452-85474 TCTGCTGAGGGCCTGCTGGACGG + Intergenic
1135950986 16:26913984-26914006 CCTGGACAGGGGCTGCTGGTTGG - Intergenic
1136455546 16:30378001-30378023 CCTTCAGAGTGTCTGCGCGAGGG + Intergenic
1137586302 16:49665703-49665725 CCTCCAGAGGTGCTGATGGGGGG - Intronic
1138265570 16:55657324-55657346 CCTTTTGATGGTCTGCTGGAAGG + Intronic
1138743952 16:59341616-59341638 GCTTCAAAGCAGCTGCTGGAAGG + Intergenic
1139641919 16:68297695-68297717 CCTATAGAGGGGCTGCTTTATGG + Exonic
1139674201 16:68511661-68511683 CCTTAAGAAGGGCTGCAGGCTGG + Intergenic
1143328401 17:6116806-6116828 CCTGCAGAGGGGCAGGTGGTAGG + Intronic
1144163195 17:12581761-12581783 ACTTCAGAGGGACAGCTTGATGG + Intergenic
1144844565 17:18209758-18209780 CCCTGAGAGGGGCTTCTTGATGG - Exonic
1145904237 17:28507604-28507626 ACTTCAGAGAGGCTCCAGGAAGG - Intronic
1146628675 17:34454472-34454494 CCATCAGAGGAGGTGGTGGAGGG - Intergenic
1147188350 17:38724996-38725018 CCCTCAGAGGGGAGGCAGGAAGG - Intronic
1147378155 17:40035242-40035264 TCTGCAGAGCGGCTGCGGGAGGG - Exonic
1147920287 17:43912152-43912174 ACTTCAGTGGAGGTGCTGGAGGG - Intergenic
1147945360 17:44077524-44077546 CCTGCAGAGGGGCTCCAGGCTGG - Exonic
1148215623 17:45832763-45832785 CCCTCTGGGGGGCTGCTGGTGGG - Intronic
1148846446 17:50532801-50532823 CCCTCAGAGGGGCAGCGGCAGGG - Exonic
1148876911 17:50693601-50693623 CCTCCAGAGGAGCAGCTGCAGGG - Exonic
1149237270 17:54607121-54607143 ACTTCAGAGGGACAGCTTGATGG + Intergenic
1149626124 17:58082410-58082432 CCTCCAGAGGGGCTGCTTCCTGG + Intergenic
1150294108 17:63998717-63998739 CCACGAGAGGGGCTGCAGGAAGG - Exonic
1150553023 17:66228484-66228506 TCTTTAGAGTGGATGCTGGAGGG - Intronic
1151802549 17:76386433-76386455 GCTACACAGGGGCTTCTGGATGG - Exonic
1152069182 17:78126694-78126716 CCTGAGCAGGGGCTGCTGGAAGG - Intronic
1152408810 17:80111888-80111910 CCTGCACAGGGGCTCCTGGGAGG + Intergenic
1152656918 17:81524089-81524111 CTTTCTGAGGTGCTGGTGGACGG - Intergenic
1152879592 17:82807601-82807623 CCTACAGAGCAGCTGCTGGTCGG + Exonic
1152920795 17:83065615-83065637 CCTGCAGAGGGGCAGCTTGTGGG - Intergenic
1153703203 18:7717328-7717350 ACTTCAGAGGGACAGCTTGATGG + Intronic
1153825215 18:8868575-8868597 ACTCCAGAGCAGCTGCTGGAAGG + Intergenic
1153925647 18:9832726-9832748 TCTTCAGAGGGACTTCTGGCCGG - Intronic
1155807099 18:30185061-30185083 ACTTCAGAGGGACAGCTTGATGG + Intergenic
1155830223 18:30507666-30507688 CCTGCAAAGGAGCTGATGGAGGG - Intergenic
1155964913 18:32026611-32026633 CCTAAAGAGGGGGTGCTGGGAGG - Intronic
1156291673 18:35753301-35753323 CCTCCAGATGGTCTGCTTGATGG - Intergenic
1158768399 18:60484614-60484636 CCTCCATAGGGGATGATGGAGGG - Intergenic
1160038406 18:75321903-75321925 GCTGCAGAGTGGGTGCTGGAAGG + Intergenic
1161095477 19:2387933-2387955 CCTCCAGACGGGATGCTGGTGGG + Intergenic
1161136141 19:2620957-2620979 CCTTCAGAGCGCCTGCAGGAAGG - Intronic
1162974934 19:14203201-14203223 CCCACAGAGGGGCTGGAGGAGGG + Intronic
1164054819 19:21613831-21613853 CTCTCAGAGGAGCAGCTGGATGG - Intergenic
1164553696 19:29233648-29233670 CCTTCAGGTGGGCAGCTGGGGGG - Intergenic
1165717875 19:38058303-38058325 CCTTCTGTGGTGCTGCTGAAGGG + Intronic
1167463060 19:49636396-49636418 CCTCAGGAGAGGCTGCTGGACGG - Intronic
1168557619 19:57356300-57356322 GCTTCAGAGGGGATGATGGAGGG + Exonic
925012653 2:497121-497143 GCTTCTGAGAGGCTGCGGGATGG - Intergenic
925928002 2:8684587-8684609 GCTTCAGGGGTGCTGCTGGTGGG - Intergenic
927964726 2:27262074-27262096 CGCTCAGAGGGGCAGGTGGACGG + Intronic
928860056 2:35846512-35846534 ACTTCAGAGGGACAGCTTGATGG - Intergenic
929552885 2:42905596-42905618 CGTTCAGCAGGGCTGCTGGGTGG + Intergenic
929753551 2:44742480-44742502 CCTTCACAGGGGCAGCTTGATGG - Intronic
929886009 2:45879213-45879235 ACTTCAGAGGGACGGCTTGATGG + Intronic
931458652 2:62432101-62432123 ACTTCAGAGGGACAGCTTGATGG + Intergenic
931459797 2:62440711-62440733 TCTTCATAGGGGAGGCTGGAGGG - Intergenic
931462936 2:62463909-62463931 ACTTCAGAGGTGCAGCTTGATGG + Intergenic
931689112 2:64820208-64820230 CCTTGACAGGGACTGCTGTAAGG + Intergenic
932592418 2:73075367-73075389 CCTCAACTGGGGCTGCTGGAAGG - Exonic
932750149 2:74366341-74366363 CACTCATAGGGGCTGCTGGAGGG + Exonic
933165453 2:79070147-79070169 ACTTCAGAGGGGCAGCTTGATGG + Intergenic
933427061 2:82126658-82126680 ACTTCAGAGGGACGGCTTGATGG - Intergenic
933615540 2:84479071-84479093 ACTTCAGAGGGACAGCTTGATGG - Intergenic
934716454 2:96547394-96547416 CTTTGACAGGGGCTGCTGCAAGG - Exonic
936657613 2:114506280-114506302 ACTTCAGAGGGACAGCTTGATGG + Intronic
936868627 2:117107405-117107427 ACTTCAGAGGGACAGCTTGATGG + Intergenic
937840384 2:126518981-126519003 ACTTCAGAGGGACAGCTTGACGG + Intergenic
937932448 2:127217898-127217920 TCCTCAGAGGGGCTGCAGGAAGG + Intronic
938300746 2:130209866-130209888 CCTTCTGAGGGGCTTCTGAGGGG - Intergenic
944940401 2:204619230-204619252 CATGCAGTGAGGCTGCTGGATGG - Intronic
947344892 2:229180608-229180630 CCTTCAGAGGGCTTGCTAGGTGG - Intronic
948058337 2:235026093-235026115 CCTACAGAGGGGATGGGGGAGGG + Intronic
948465510 2:238149961-238149983 CCTGCAGGGGGGCTGCAGGAAGG - Intronic
948676653 2:239600872-239600894 CCTTCAGAGGGGGACATGGATGG + Intergenic
948922666 2:241073060-241073082 CCTCCAGAGGGTCAGCAGGAGGG + Intronic
1168733258 20:105851-105873 CCTTCGGAGGGGCTACAGGTAGG - Intergenic
1170009334 20:11704438-11704460 CTTTTAGAGGGGCTGACGGAGGG + Intergenic
1170547300 20:17445375-17445397 TCTTCAGAGTTGCTGCTGGAGGG + Intronic
1172158380 20:32846148-32846170 CCCTCAGTGGGGCTCATGGAGGG + Intronic
1173644783 20:44626586-44626608 CCTTCCCAGGGGCTGCCGGGAGG - Exonic
1173954664 20:47021732-47021754 GCTCCTGAGTGGCTGCTGGAGGG - Intronic
1173998826 20:47359546-47359568 CTTTAAGAGGAGCTGCTGAATGG - Intergenic
1174426755 20:50437159-50437181 CATTCAGAGTGGCTGCTGGTGGG + Intergenic
1175113662 20:56666508-56666530 CCTTGTGTGGGGCTGCTGGAAGG - Intergenic
1175129117 20:56775942-56775964 CCTTCAGAGGGTCTCCTGCCAGG - Intergenic
1175862148 20:62156296-62156318 CCTTCAGATGAACTGCAGGAAGG - Intronic
1176094351 20:63333124-63333146 ACTACAGAGGGGCCTCTGGAGGG - Intronic
1176741465 21:10607352-10607374 CCTTTAGTTGGGCTGCTGCACGG - Intergenic
1178261472 21:31103933-31103955 CCTCCAGATGGTCTGCTTGATGG - Intergenic
1178981708 21:37269950-37269972 GTATCAGAGGGCCTGCTGGAAGG - Intergenic
1179487507 21:41719912-41719934 CACTCAGAGGGGGTCCTGGAGGG + Intergenic
1179629585 21:42668191-42668213 CCTCCAGAGGGGCTGCCGCCTGG + Intronic
1180025837 21:45161579-45161601 CCTGCCGAGGGGCGGCTGCAAGG - Intronic
1180700810 22:17780676-17780698 GCTTCAGAGTGGGGGCTGGATGG + Intergenic
1183257555 22:36772102-36772124 CCTTCAGAGGCTGTGCAGGAAGG - Intronic
1183469308 22:37997191-37997213 CCTTCAGAGGAGGGGATGGAGGG - Intronic
1184033724 22:41909076-41909098 CCTTCAGAGAAGCTCCTGGGAGG + Intergenic
1184033771 22:41909248-41909270 GCTGCAGAGTGGCGGCTGGAGGG + Intergenic
1184604544 22:45564691-45564713 CCTTCACAGAGCCTTCTGGAAGG - Intronic
949232512 3:1767842-1767864 CCTTCACTGTTGCTGCTGGATGG - Intergenic
949631202 3:5928830-5928852 ACTTCAGAGGGACAACTGGATGG + Intergenic
951251141 3:20395439-20395461 ACTTCAGAGGGACAGCTTGATGG + Intergenic
951931658 3:27974034-27974056 ACTTCAGAGGGACAGCTTGAGGG - Intergenic
952107755 3:30088894-30088916 ACTTCAGAGGGACAGCTTGATGG - Intergenic
952181440 3:30920640-30920662 ACTTCAGAGGGACAGCTTGATGG + Intergenic
952491455 3:33877977-33877999 CCTGCAGAGGGGATGATGGCTGG + Intergenic
952635295 3:35522140-35522162 CTCCCAGAGGGGCTGCTGCAAGG - Intergenic
953926304 3:46984393-46984415 CCTGGAGAGGGGGTGCTGAAAGG - Intronic
954563536 3:51579060-51579082 ACTTCAGAGGGACAGCTTGATGG - Intronic
954654045 3:52183092-52183114 CCTGCAGCAAGGCTGCTGGAGGG - Intergenic
955040104 3:55308191-55308213 TCTGCAGAGGGCCTGCTGGCTGG + Intergenic
955939483 3:64134111-64134133 GCTGCAGTGGGGCTGCTGGGTGG - Intronic
958100206 3:88999273-88999295 ACTTCAGAGGGGTGGCTTGATGG + Intergenic
960817800 3:121690722-121690744 ACTTCAGCTGGGCTGGTGGAAGG + Exonic
961660839 3:128468061-128468083 CCTCCATAGGGCCTGCTGGAGGG + Intergenic
961819718 3:129569775-129569797 TCTTCAGAGGGGCTGGGGCAAGG + Intronic
962234446 3:133695136-133695158 CCCTCAGAGGGGCTGCATGGGGG + Intergenic
966033291 3:175377798-175377820 ACTTCAGAGGGACAGCTTGATGG + Intronic
966742713 3:183249324-183249346 TTTTCACAGGGGCTGTTGGAGGG + Intronic
967099047 3:186200917-186200939 CTTTGAGAGGGGCAGCTGGAAGG + Intronic
967929613 3:194681311-194681333 CTTTCAGAGGGGCAGGTTGAAGG + Intergenic
967983191 3:195077742-195077764 CCTGCAGAAGGGCAGCTGGCAGG + Intronic
968750138 4:2384571-2384593 CCTCCTGAGGGAGTGCTGGATGG + Intronic
968756702 4:2419824-2419846 CCTTCAGAGGGTCGACTGGGTGG - Intronic
968908285 4:3464333-3464355 CCTGCAGAGGGGACGCAGGAGGG - Intronic
969576006 4:8036171-8036193 CCTGCAGAGTGGCTGATGTAGGG + Exonic
972274161 4:37541504-37541526 CCCTAAGAGGGGCTGGTAGAGGG - Intronic
972444055 4:39126737-39126759 CCTCCAGATGGTCTGCTTGATGG - Intronic
976031368 4:80758328-80758350 ACTTCAGAGGGACAGCTTGAAGG - Intronic
976380923 4:84397602-84397624 CCCTCAGAGGGGCAGATGCATGG - Intergenic
976473399 4:85455384-85455406 ACTTCAGAGGGACGGCTTGATGG + Intergenic
977338719 4:95730199-95730221 ACTTCAGAGGGACAGCTTGATGG - Intergenic
977672885 4:99716248-99716270 ACTTCAGAGGGACAGCTTGATGG + Intergenic
978503955 4:109436728-109436750 CCTTCAAAGGGGATGATGGGTGG - Intronic
979596617 4:122541756-122541778 TCTTCAGAGGGACAGCTTGATGG + Intergenic
980985294 4:139689310-139689332 CCTTCAGTGGTGCTGCTTGTAGG - Intronic
982670912 4:158319391-158319413 TCTCCAAAGGGGCTGCTGGTGGG + Intronic
982861997 4:160463887-160463909 ACTTCAGAGGGACAGCTTGATGG - Intergenic
983057786 4:163119109-163119131 CATTCAGAGAGGTTTCTGGAAGG - Intronic
985104258 4:186485706-186485728 CCTTCAGAGGCGCTGCGGCCAGG - Intronic
986374296 5:7114721-7114743 CCTTCAGAGGGGAGGCAGGGAGG - Intergenic
986929877 5:12805019-12805041 ACTTCAGAGGGACAGCTTGATGG + Intergenic
987053916 5:14172988-14173010 CCATCAGAGGGGCTGGTGGGTGG - Intronic
987105777 5:14637527-14637549 CCTCCTGAGTGGCTGCTGAAGGG + Intergenic
988231365 5:28483890-28483912 ACTTCAGAGGGACGGCTTGATGG - Intergenic
988350898 5:30106257-30106279 ACTTCAGAGGGACAGCTCGACGG + Intergenic
988395313 5:30690623-30690645 CTTTCACTGGGGCTGGTGGAGGG - Intergenic
989707993 5:44361122-44361144 CCTTGAGAGTTGCTGCTGCAAGG - Intronic
989743620 5:44801223-44801245 CTTCCAGAGGTGCTACTGGAAGG - Intergenic
992831193 5:80595096-80595118 TATTCAGAGTGGCTGCTGGATGG + Intergenic
994188082 5:96837917-96837939 ACTTCAGAGGGACGGCTTGATGG - Intronic
995980756 5:118100244-118100266 GCTTCAAAGGGGTTGCTGCATGG - Intergenic
996762340 5:126999001-126999023 CCTTGAGAGGGGTTGCTGAGAGG - Intronic
997738259 5:136230780-136230802 CTTCCAGAGGTGATGCTGGAAGG - Intronic
998774880 5:145588066-145588088 ACATCAGTGGGGCTGCTGGAAGG - Intronic
999044572 5:148453202-148453224 GTTTCTGAGGGGCTGCTGTAAGG - Intronic
999280850 5:150364564-150364586 CGTTCAGAAGTACTGCTGGAGGG + Intronic
999309883 5:150545147-150545169 CCTCCAGTGGGGATTCTGGAGGG - Intronic
1000810662 5:165857395-165857417 ACTTCAGAGGGACAGCTTGATGG + Intergenic
1001492635 5:172166203-172166225 CCTTCAGAGTGGCTGCCGGAGGG + Intronic
1002305811 5:178282111-178282133 CCTGCAGAGGAGCAGCTGAACGG - Intronic
1002642392 5:180636422-180636444 CCCTCAGAGGGACTGCTGTAGGG - Intronic
1002688867 5:181036883-181036905 CCATCACAGGGGCTGCAGCAGGG + Intergenic
1003783083 6:9451388-9451410 CCTTCAGAGGGACAGTTTGAAGG + Intergenic
1003887586 6:10535211-10535233 CCTCCAGAGGACCTGCTGGATGG - Intronic
1003966599 6:11257734-11257756 CACTCTGCGGGGCTGCTGGAAGG - Intronic
1004258015 6:14082826-14082848 TCTTCAGAGTGGATACTGGATGG + Intergenic
1004977519 6:20984691-20984713 ACTTCAGAGGGACAGCTTGAAGG - Intronic
1005363385 6:25053759-25053781 ACTTCAGAGGGACAGCTTGATGG - Intergenic
1006466207 6:34196365-34196387 TATTCAGCGGAGCTGCTGGAGGG - Intergenic
1006564099 6:34939300-34939322 ACTCCAGTGAGGCTGCTGGAGGG - Intronic
1007281167 6:40713534-40713556 CCTACCAAAGGGCTGCTGGAGGG + Intergenic
1012637946 6:101570489-101570511 CCTTCAGAGAGGGAGCTGGCAGG - Intronic
1015848563 6:137548436-137548458 CCTGAAGTGGGGCTGCTGGCTGG + Intergenic
1016183125 6:141171288-141171310 ACTTCAGAGGGACAGCTTGATGG - Intergenic
1017728209 6:157290803-157290825 CCTGCAGAGGGGAGGCTGGCAGG - Exonic
1018636297 6:165862036-165862058 CCACCACAGTGGCTGCTGGAAGG - Intronic
1018731699 6:166656523-166656545 CCTGCCGAGGCCCTGCTGGAGGG - Intronic
1019279839 7:193984-194006 CCTTGGGAGGGGCTGCCGGCTGG + Intronic
1019825389 7:3280025-3280047 CCTTCAGTGGGGCAGGTGCAGGG + Intergenic
1020013147 7:4817130-4817152 CCTTCTGGGGGGCTGAGGGAGGG - Intronic
1021073567 7:16273429-16273451 ACTTCAGAGGGACAGCTTGAAGG + Intronic
1021210659 7:17848170-17848192 ACTTCAGAGGGACAGCTTGATGG + Intronic
1022562999 7:31369374-31369396 ACTTCAGAGGGACAGCTTGATGG - Intergenic
1022679640 7:32532196-32532218 ACTTCAGAGGGACAGCTTGATGG - Intronic
1024934285 7:54697717-54697739 GCTGCGGAGGGGCTGCTGGAGGG - Intergenic
1024980303 7:55152674-55152696 GCTCCAGGGAGGCTGCTGGAGGG - Intronic
1026338473 7:69414938-69414960 GCTTCTGAGGGGCCACTGGAAGG - Intergenic
1026944741 7:74308305-74308327 GCCTCAGAGGGGATGCTGGCTGG + Intronic
1026955536 7:74374093-74374115 CTCTCAGAGGGACTGCTGGGGGG - Intronic
1027193627 7:76012962-76012984 CATTCAGAGGGCAGGCTGGATGG - Intronic
1027229290 7:76262949-76262971 CCTTCCTCTGGGCTGCTGGAAGG - Intronic
1027250547 7:76396093-76396115 CTTTAAGAGGGGCTGTAGGAGGG - Intronic
1027449382 7:78312767-78312789 CCTTGAGTGGGATTGCTGGATGG - Intronic
1029549790 7:101231654-101231676 CCTCCAGAGGCTCTTCTGGAAGG + Intergenic
1030546890 7:110907379-110907401 ACTTCAGAGGGACAGCTTGATGG - Intronic
1031696166 7:124857595-124857617 ACTTCAGAGGGACAGCTTGATGG + Intronic
1032625843 7:133590625-133590647 ACTTCAGAGGGACGGCTTGATGG + Intronic
1033611829 7:142970620-142970642 CTGTCAGAGGTGCTGGTGGAGGG + Intergenic
1033663208 7:143417925-143417947 CCCACAGAGGTGCTCCTGGAAGG - Intergenic
1034634766 7:152558430-152558452 CATTCAGTGGTGCTGCTAGACGG - Intergenic
1037289616 8:17336769-17336791 GCGTCAGAGGAGCTGCTGGGAGG + Intronic
1038066320 8:23967310-23967332 CCTCCCAAGGGGCTGTTGGAGGG - Intergenic
1038369072 8:26969806-26969828 ACTTCAGAGGGACAGCTTGATGG - Intergenic
1039469523 8:37804656-37804678 CCTTCAGAGGGGCTGGGAGTGGG - Intronic
1039645525 8:39278162-39278184 ACTTCAGAGGGACAGCTTGATGG - Intronic
1039828661 8:41195488-41195510 CCTTCTGAGGGGCTGCCAGCAGG + Intergenic
1040908306 8:52491644-52491666 ACTTCAGAGGGACAGCTTGATGG - Intergenic
1041118896 8:54566600-54566622 CCCTCAGAGAAGCAGCTGGAAGG - Intergenic
1041948390 8:63472955-63472977 CCTTCAGATGGCCCACTGGAGGG - Intergenic
1045224578 8:100232003-100232025 CCTTCTGAAGTGCTGCGGGAAGG + Intronic
1049274890 8:141715253-141715275 CCTCCTGTGGGGCTGCTGGGAGG + Intergenic
1049308761 8:141922292-141922314 GCTCCTGAGGGCCTGCTGGAAGG + Intergenic
1049373457 8:142278450-142278472 CCTTCCTGGGAGCTGCTGGAAGG - Intronic
1049483571 8:142839642-142839664 CCTTGAGTCGGGCTGCTGAAGGG + Intronic
1049598789 8:143497698-143497720 CCTGCTGTGGGGCTGCTGGCCGG - Intronic
1050280247 9:4043124-4043146 CCTTGAGTGGGGCTGTGGGAAGG - Intronic
1050296963 9:4215212-4215234 CTTTCAGAGGGGAGGTTGGAAGG - Intronic
1050819180 9:9856162-9856184 ACTTCAGAGGGACAGCTTGACGG - Intronic
1052465875 9:28829155-28829177 ACTTCAGAGGGACAGCTTGATGG + Intergenic
1052966906 9:34347220-34347242 CCCTCAGAGGGGCTGGGGCAGGG - Intergenic
1053596505 9:39567012-39567034 GCTCCACAGGGGCTGCTGCATGG + Intergenic
1053854470 9:42323652-42323674 GCTCCACAGGGGCTGCTGCACGG + Intergenic
1054569754 9:66798006-66798028 GCTCCACAGGGGCTGCTGCATGG - Intergenic
1054912441 9:70466475-70466497 ACTACAGAGGGGCAGCTGTAAGG + Intergenic
1056019813 9:82430181-82430203 CCTTCTGAAGGGAGGCTGGAAGG + Intergenic
1057072025 9:92106849-92106871 CCTTCTGAAGGGAGGCTGGAAGG - Intronic
1057212736 9:93209560-93209582 ACTTCAGAGGGGGTTCTGTAGGG + Intronic
1057255089 9:93539833-93539855 CCTGCAAAGGGGCAGCTGGAGGG - Intronic
1057814664 9:98285701-98285723 CTTTCAGAGGAGCTGCAGGAAGG + Intergenic
1057950140 9:99363353-99363375 CCTTCAGCCGGGCTGCCGTAGGG + Intergenic
1058249216 9:102669907-102669929 CCTTCAGGGGGGATAATGGATGG + Intergenic
1059308138 9:113370567-113370589 CCCTCAGAGGGGCAGATGCATGG - Exonic
1060533025 9:124359741-124359763 CCATCAGAGGAGCTGCTGGTTGG - Intronic
1061063239 9:128261286-128261308 CCTGGAGAGGGGCTGGTGGCTGG + Intronic
1061257517 9:129461024-129461046 CCTTCCCAGGGGCTCCTGGAGGG - Intergenic
1061954205 9:133953204-133953226 CCTCCAGGGCTGCTGCTGGAAGG + Intronic
1062017395 9:134297674-134297696 CCCTCAGAGGGGCAGCAAGAAGG + Intergenic
1062146409 9:134992173-134992195 CCTGCAGAGGGTCTCCCGGAAGG + Intergenic
1062146531 9:134992482-134992504 CCTGCAGAGGGTCTCCTGGAAGG + Intergenic
1062318365 9:135978859-135978881 CCTGCAGAGGGGCTGATGCCTGG - Intergenic
1062319998 9:135986224-135986246 CCTGCAGGGGCGGTGCTGGAGGG + Intergenic
1185735387 X:2491909-2491931 CCTCCTGAGTGGCAGCTGGAAGG - Intronic
1185945205 X:4367838-4367860 ACTTCAGAGGGACAGCTTGACGG + Intergenic
1186087138 X:6002868-6002890 ACTTCAGAGGGACAGCTTGATGG + Intronic
1188182394 X:27072509-27072531 ACTTCAGAGGGACAGCTTGATGG + Intergenic
1189179110 X:38986771-38986793 CCACCAGAGGGGCTGCAGGGAGG - Intergenic
1190055854 X:47180558-47180580 GCTTCAGAGAGGGTGCAGGAGGG - Intronic
1191057263 X:56254727-56254749 ACTTCAGAGGGACAGCTTGATGG - Intronic
1193500463 X:82267711-82267733 CCTCCAGATGGTCTGCTTGATGG + Intergenic
1193905293 X:87236758-87236780 CTTGCAGAGGGGCTGATGGGTGG - Intergenic
1194615930 X:96103489-96103511 ACTTCAGAGGGACAGCTTGATGG - Intergenic
1199680683 X:150222316-150222338 CCTCCATAGTGGCTGCAGGATGG - Intergenic
1201179516 Y:11332186-11332208 CCTTTATAGGAGCTGCTGGCTGG + Intergenic
1202599793 Y:26581587-26581609 CCTTTAGTTGGGCTGCTGCACGG - Intergenic