ID: 1105847494

View in Genome Browser
Species Human (GRCh38)
Location 13:24306338-24306360
Sequence CAGCATAATTACCTGGAGTT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105847491_1105847494 -7 Left 1105847491 13:24306322-24306344 CCCAGTCAGAATAGAACAGCATA 0: 1
1: 0
2: 0
3: 10
4: 157
Right 1105847494 13:24306338-24306360 CAGCATAATTACCTGGAGTTAGG 0: 1
1: 0
2: 1
3: 14
4: 163
1105847490_1105847494 17 Left 1105847490 13:24306298-24306320 CCTTCATGCAGATCAACTTGGTG 0: 1
1: 0
2: 0
3: 4
4: 104
Right 1105847494 13:24306338-24306360 CAGCATAATTACCTGGAGTTAGG 0: 1
1: 0
2: 1
3: 14
4: 163
1105847492_1105847494 -8 Left 1105847492 13:24306323-24306345 CCAGTCAGAATAGAACAGCATAA 0: 1
1: 0
2: 2
3: 8
4: 163
Right 1105847494 13:24306338-24306360 CAGCATAATTACCTGGAGTTAGG 0: 1
1: 0
2: 1
3: 14
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105847494 Original CRISPR CAGCATAATTACCTGGAGTT AGG Exonic
902968430 1:20029246-20029268 CAGCAGAACTACATGGAGTTTGG - Intronic
903687454 1:25142381-25142403 CAGCATAACAGCCAGGAGTTCGG - Intergenic
904863190 1:33555933-33555955 CAGCAACATTAACAGGAGTTTGG + Intronic
906652070 1:47519965-47519987 CAGGATAAGCACCTGGAGTGGGG + Intergenic
906665129 1:47616084-47616106 CAGCATAATCCCTGGGAGTTTGG + Intergenic
906973513 1:50544429-50544451 CATCAAAATTACCTGGGGTGGGG - Intronic
909919154 1:81358852-81358874 CAGAAGAATTACCTGGTGGTAGG + Intronic
911753111 1:101521550-101521572 CAGCATATTTACCTGTGGCTTGG - Intergenic
911825917 1:102485212-102485234 CAGTATAATTTCCAGGAATTAGG + Intergenic
917321959 1:173791908-173791930 CTGCCTTATTACCTGAAGTTTGG - Intergenic
918339642 1:183557742-183557764 CAGCTCAATTGTCTGGAGTTTGG - Intronic
918519949 1:185404397-185404419 CAGCAGAATGATGTGGAGTTTGG + Intergenic
919157330 1:193783083-193783105 CATTATATTTACCTGAAGTTAGG + Intergenic
919436160 1:197563844-197563866 CAGCAACATTAACAGGAGTTTGG + Intronic
921188645 1:212691033-212691055 CAGCATAATTCCTTGTTGTTGGG - Intronic
922180954 1:223232252-223232274 CAGTATTATTAACTGGAGTCTGG - Intronic
923824594 1:237485925-237485947 CAGCATAACCACCTACAGTTTGG + Intronic
924697812 1:246418741-246418763 CAGCAGAACGACGTGGAGTTTGG - Intronic
1062820017 10:527930-527952 CTACATAATTACGTGGAGCTGGG - Intronic
1064125761 10:12658701-12658723 CAGCAGAAGGACGTGGAGTTTGG + Intronic
1066638998 10:37536814-37536836 CAGCATACTGAGCTGGAGGTGGG - Intergenic
1068129206 10:52876389-52876411 CAGCATGAATACCAGGAGGTAGG + Intergenic
1068586420 10:58804757-58804779 CAACATAAATACATCGAGTTAGG - Intronic
1068690603 10:59909937-59909959 CAGCAAAATTACCTCCAGTTTGG + Intergenic
1071141755 10:82517778-82517800 TAGCATAATTACCTCAAATTTGG - Intronic
1071228119 10:83555475-83555497 TAGTATAATTACCTAGAATTAGG + Intergenic
1072836221 10:98716314-98716336 TAGCATTATTAACAGGAGTTTGG - Intronic
1072868659 10:99092581-99092603 AAGCATAATCAACTGAAGTTTGG + Intronic
1074604581 10:114948583-114948605 TAGAAAAATTATCTGGAGTTGGG - Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1083589962 11:63888093-63888115 GAGCATAATTTCAGGGAGTTTGG - Intronic
1088806780 11:113359750-113359772 CAGGGTAATGCCCTGGAGTTAGG + Intronic
1088856110 11:113755292-113755314 TAGCAAAATTAACAGGAGTTTGG + Intronic
1096171650 12:49476268-49476290 CGGCAGAATGACATGGAGTTTGG + Intronic
1096502996 12:52076698-52076720 GAGCATAATTCCCTGGGGTGTGG + Intronic
1097639334 12:62160655-62160677 CAACATGATCACCTGCAGTTGGG + Intronic
1103198421 12:119066716-119066738 CAGAAGCATTGCCTGGAGTTAGG + Intronic
1105393133 13:20000967-20000989 CAGCATTATTAACCAGAGTTTGG + Intronic
1105847494 13:24306338-24306360 CAGCATAATTACCTGGAGTTAGG + Exonic
1105956581 13:25288337-25288359 CCGGATAATTCCCTGTAGTTGGG - Intergenic
1106418776 13:29568368-29568390 CACCAAAATTACCTGGAATCAGG + Intronic
1108622633 13:52199199-52199221 CAGCATAAATACCTGCAATGTGG + Intergenic
1108745222 13:53386631-53386653 TTGCATAATTCCCGGGAGTTGGG + Intergenic
1115574008 14:34693516-34693538 CAGCAGAATAACGTGGAGTTTGG + Intergenic
1116134410 14:40902513-40902535 CAGCATTATTACATAGAGATTGG + Intergenic
1124601665 15:31137810-31137832 GAGTATTATTTCCTGGAGTTTGG - Intronic
1126824212 15:52532740-52532762 TAGAATAACTAGCTGGAGTTGGG - Intergenic
1128025252 15:64430804-64430826 CAGCATAATTCCTTGAAGATAGG - Intronic
1134233415 16:12447072-12447094 CAGCAGAATCACTTGAAGTTGGG + Intronic
1135254953 16:20933686-20933708 CAGCATACTGACCAGGAGTCAGG - Intronic
1135907665 16:26528095-26528117 GAGGATAATAACCTGAAGTTTGG + Intergenic
1138337868 16:56267214-56267236 CAGCATACCTACTTGGAGGTGGG - Intronic
1140291694 16:73665304-73665326 CAGGATAATTACTTGGACCTGGG - Intergenic
1140910610 16:79448516-79448538 CAGGATAATTGCCTGGACCTGGG - Intergenic
1142703118 17:1676500-1676522 CAGCACAACTACCTGAAGGTTGG - Exonic
1146097432 17:29945009-29945031 CTGCATAATTATGTGGAATTTGG - Intronic
1147666076 17:42149128-42149150 AAGCATGATTACCTGGATTTTGG + Intronic
1148055992 17:44796026-44796048 AAGCAGAATGACATGGAGTTTGG - Intergenic
1150913104 17:69409757-69409779 CAGCAGAATTACTTGAACTTGGG + Intergenic
1154482093 18:14840444-14840466 CAGGATAATTACTTGGTCTTTGG + Intronic
1156130917 18:33973420-33973442 TAGCAAAATTAACAGGAGTTTGG - Intronic
1158227903 18:55219429-55219451 CACAATAATTACCTGAAGGTAGG - Intergenic
1158601741 18:58862461-58862483 CAGCACAATTAGCTTGACTTGGG + Intergenic
1168031604 19:53684144-53684166 CAGGCTAATCACCTGGAGTCAGG + Intergenic
1168304134 19:55425416-55425438 CAGGAGAATTACCTGAAGTCAGG + Intergenic
1168610263 19:57793422-57793444 CTTCATATTTACCTGGAGTCTGG + Intronic
926139252 2:10358686-10358708 CAGCAGAATGCCCCGGAGTTTGG + Intronic
927081453 2:19634811-19634833 CACCATAATTACAAGGACTTGGG - Intergenic
927902209 2:26828625-26828647 CAGGAGAATTACCTGAGGTTGGG + Intergenic
928362132 2:30672632-30672654 CAGCATAATTACTTTGTGGTTGG - Intergenic
928915976 2:36470931-36470953 CAGAATATTAACATGGAGTTTGG + Intronic
929291831 2:40201487-40201509 CAGCAAAATTATCTCCAGTTAGG + Intronic
929526218 2:42705302-42705324 CATCATAAATACCTTGAATTGGG + Intronic
930491933 2:52084938-52084960 TAGCAACATTACCAGGAGTTTGG - Intergenic
933076890 2:77940105-77940127 CAGCATGAATACCTGGAGGCAGG + Intergenic
935008842 2:99111721-99111743 GAACATAATTACATAGAGTTTGG + Intronic
935224254 2:101039326-101039348 CAGAATAATAACATGGAGTTAGG + Intronic
935882199 2:107575855-107575877 CAGCAGAACTATATGGAGTTTGG + Intergenic
938401896 2:131000045-131000067 CAGCAGAACTACCTGTATTTAGG + Intronic
939190140 2:138907728-138907750 CAGGATATTTACCTGATGTTGGG + Intergenic
939873689 2:147552767-147552789 CATTATCATTACATGGAGTTAGG + Intergenic
940975481 2:159938645-159938667 CAGCAGAATTCCCAGGAGTGAGG + Exonic
945713876 2:213334291-213334313 CAGCATTATTACCTGTCTTTTGG - Intronic
947194730 2:227550435-227550457 CTGCATTATTCCATGGAGTTTGG + Intronic
948527180 2:238578339-238578361 CAGCACATGTACCTGGAGATTGG + Intergenic
1169322308 20:4643850-4643872 TAGCAACATTAACTGGAGTTTGG + Intergenic
1170270990 20:14527118-14527140 CAGCAGAACGACATGGAGTTTGG - Intronic
1174589637 20:51634994-51635016 CAGCATGAGTACCAGGAGGTGGG - Intronic
1174701357 20:52612384-52612406 CAGCATGAATACCAGGAGGTGGG - Intergenic
1174943290 20:54956115-54956137 CAGGAGAAGCACCTGGAGTTCGG - Intergenic
1176798511 21:13396175-13396197 CAGGATAATTACTTGGTCTTTGG - Intergenic
1179030782 21:37717935-37717957 CAGGACAATTGCCTGGAGCTGGG - Intronic
1181050445 22:20235838-20235860 CAGCAGAATGACCTGGAGTTTGG + Intergenic
1181260093 22:21591360-21591382 CACCACAATCACCTGGACTTGGG - Intronic
949270277 3:2208250-2208272 CAGCAACATTACCAGAAGTTTGG + Intronic
950686052 3:14619391-14619413 CAGCAGATTTAACTGGAGTGGGG + Intergenic
950695876 3:14700923-14700945 CAGCATCAGTTCCAGGAGTTGGG + Intronic
951464700 3:22989753-22989775 CGGCAGAAATTCCTGGAGTTGGG - Intergenic
952564363 3:34637085-34637107 AAACATAATTCCCTGGATTTTGG + Intergenic
954293251 3:49660768-49660790 AAGCTCAAGTACCTGGAGTTGGG + Exonic
956778598 3:72587070-72587092 CAGCACAACAACATGGAGTTTGG + Intergenic
957233621 3:77554571-77554593 CATCAACATTACCAGGAGTTTGG + Intronic
959394829 3:105824154-105824176 CAGCTTATAAACCTGGAGTTTGG - Intronic
959524703 3:107363626-107363648 CAGTATGATGGCCTGGAGTTTGG - Intergenic
959859108 3:111196526-111196548 AAGCCTCATTCCCTGGAGTTTGG + Intronic
962364539 3:134769335-134769357 CACCAGAGTTACCTGGGGTTGGG - Intronic
964403826 3:156327987-156328009 GAGCATAATTCCATGGAGTCAGG - Intronic
966026745 3:175293151-175293173 CAAGATAATTAGTTGGAGTTAGG - Intronic
969604115 4:8193754-8193776 AAGCAGCATTACCTGGAGGTGGG + Intronic
971926859 4:33022538-33022560 CAGGAGAATCACTTGGAGTTAGG - Intergenic
972177486 4:36426602-36426624 TATCATAGTTACCAGGAGTTTGG - Intergenic
972560416 4:40222900-40222922 TAGCAACATTAACTGGAGTTTGG + Intronic
978216296 4:106208541-106208563 CAGCACCCTTACCTGAAGTTGGG - Intronic
979668408 4:123337388-123337410 TAGCAACATTAACTGGAGTTTGG + Intergenic
986041926 5:4001872-4001894 CAGCATAAGTTCCTGGAGCAGGG - Intergenic
989661760 5:43806801-43806823 GAGCATAATGAACTGGGGTTAGG + Intergenic
991115232 5:62946932-62946954 CAGCGGAATGACGTGGAGTTTGG + Intergenic
993012174 5:82495614-82495636 AACCATAATTATCTGTAGTTTGG - Intergenic
993695258 5:91053742-91053764 TAGCAAAACCACCTGGAGTTTGG - Intronic
993771265 5:91930967-91930989 CAGCAGAAATATCTGCAGTTTGG - Intergenic
997095966 5:130911879-130911901 CAGCATAAAAACCATGAGTTGGG - Intergenic
997406854 5:133655997-133656019 CAGCATAGTGACCTGGAGGGCGG - Intergenic
1000127936 5:158265620-158265642 CAGCATTATCACCTGGAGGTGGG - Intergenic
1000734171 5:164878592-164878614 TAGAAAAATTCCCTGGAGTTTGG - Intergenic
1001061238 5:168490907-168490929 CAGGTGAATTACCTGGAGTCAGG + Intronic
1001421919 5:171594021-171594043 CATCAGAATCACCTGGGGTTGGG - Intergenic
1001637857 5:173225425-173225447 CATCAAATTTGCCTGGAGTTGGG + Intergenic
1001795266 5:174496915-174496937 CAGCATTATTTCATGGAGCTAGG + Intergenic
1002161367 5:177315600-177315622 CAGCATAATGATCAGGAGTTGGG + Intergenic
1003131208 6:3396718-3396740 CAGCAGAATGACATGGAATTTGG + Intronic
1004000042 6:11589285-11589307 CAGCCTAATTGCCTGGACTCAGG + Intergenic
1005690037 6:28295870-28295892 CAAAATAATTATCTGTAGTTTGG + Intronic
1010995124 6:82523831-82523853 AAGCAGAACAACCTGGAGTTTGG + Intergenic
1011940288 6:92834481-92834503 CATCATAATTAACTAGAGTAGGG - Intergenic
1012703231 6:102489814-102489836 CAGCATAATTCTCTGAAGATTGG - Intergenic
1014044422 6:116868516-116868538 CTGCATAATTCCCTGGATTTGGG + Intergenic
1014075817 6:117233064-117233086 CGGCATATTTTCCTGGATTTGGG + Intergenic
1014373934 6:120648276-120648298 ATTCCTAATTACCTGGAGTTAGG + Intergenic
1014447656 6:121547158-121547180 CAGCAGAATGATGTGGAGTTTGG - Intergenic
1016109567 6:140205989-140206011 CAGCAGAACAACGTGGAGTTTGG + Intergenic
1017872616 6:158499974-158499996 CCACATAAATACCTGTAGTTTGG + Intronic
1018265818 6:162023493-162023515 CAGCAGAACCACGTGGAGTTTGG - Intronic
1019145720 6:169974194-169974216 CAGCCTATTTACCCGGAGTTTGG + Intergenic
1020131747 7:5562782-5562804 CAGCAGAATTCCTGGGAGTTGGG + Intronic
1021696053 7:23277379-23277401 CAGCAGAATCACCTGAAGTTTGG + Intergenic
1025979892 7:66396708-66396730 GAACATAAAAACCTGGAGTTTGG + Intronic
1027252980 7:76410656-76410678 CAGCATCATGACCAGGAGTCAGG - Intronic
1027397667 7:77772860-77772882 CAGAATCTTTACCTGGGGTTTGG - Intronic
1028606564 7:92662276-92662298 CATCTTAATTAACTGGAGATGGG + Intronic
1036825998 8:11976666-11976688 CAGCATAATGAACTGTTGTTTGG - Intergenic
1040977015 8:53204632-53204654 CAGCTTCATTACCAGGAGTTCGG - Intergenic
1041452122 8:58016631-58016653 CAGGATGAATACGTGGAGTTGGG - Intronic
1041542491 8:59002065-59002087 CAGGATAATTACTTGAATTTGGG - Intronic
1042875485 8:73437240-73437262 CAGGTTAAGTACCTGGAGATGGG + Intronic
1043726249 8:83614701-83614723 CAGGATAATTCCCTGAACTTGGG - Intergenic
1043789425 8:84445080-84445102 GAGCATCAGTACCTGGATTTTGG - Intronic
1046303347 8:112327913-112327935 CAGCATTATTTTCTGGAATTGGG - Intronic
1047627307 8:126669279-126669301 CAGCACAATTACCTGCAATGTGG + Intergenic
1048950438 8:139492241-139492263 CATCAGAATCACCTGGAGGTGGG + Intergenic
1052344360 9:27393845-27393867 TAGCAAAATGACATGGAGTTTGG - Intronic
1052690418 9:31809371-31809393 CAGTGGAATTACATGGAGTTTGG - Intergenic
1055630036 9:78214414-78214436 CTGCAGAATTAGCTGGACTTAGG - Intergenic
1057400981 9:94723468-94723490 CAGAATAGTTGCCTGGAATTTGG - Intergenic
1058495768 9:105557722-105557744 CAGCATAACTCCCTGAAGTTTGG - Intergenic
1060126813 9:121055440-121055462 AAGCATCAGTACCTGAAGTTTGG - Intergenic
1061300206 9:129700047-129700069 TAGTATATTTATCTGGAGTTAGG - Intronic
1061953517 9:133949592-133949614 CAGCAGCATTGCCTGGAGTGTGG - Intronic
1185573111 X:1149618-1149640 GAGCAGAATTATCTGCAGTTGGG + Intergenic
1190157025 X:48002583-48002605 CAACATACTTACCTGGGGTTTGG + Exonic
1190537970 X:51447963-51447985 CAGCTGCATTACCTGGAGATGGG + Intergenic
1192386514 X:70677441-70677463 AAGCAAAATTACCTGAAGCTAGG - Intronic
1192480895 X:71484704-71484726 AAGCATAAATACCAGGAGTTGGG - Intronic
1192880567 X:75279067-75279089 CAGCACAATTACCTGTGGTCAGG - Intronic
1193416397 X:81229619-81229641 CAGCAGAACGACATGGAGTTTGG - Intronic
1193607676 X:83588563-83588585 CAGCAGAATGAGATGGAGTTTGG - Intergenic
1197831712 X:130649943-130649965 CAGCATCTTGAGCTGGAGTTTGG + Intronic
1197971791 X:132122030-132122052 CAGCTCTATTACCTGGAGGTGGG + Intronic
1200107038 X:153720134-153720156 CAGCAGAATTGCCTGGAGCAGGG - Intronic
1201537482 Y:15066873-15066895 CAGGATAATTGCTTGAAGTTAGG + Intergenic