ID: 1105847808

View in Genome Browser
Species Human (GRCh38)
Location 13:24308294-24308316
Sequence GCCCCGACGGAACGCGCGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 18
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 17}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105847808_1105847817 21 Left 1105847808 13:24308294-24308316 CCCGTCGCGCGTTCCGTCGGGGC 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1105847817 13:24308338-24308360 AGACCAGCCACGCGAGCAAGAGG 0: 1
1: 0
2: 0
3: 6
4: 157
1105847808_1105847812 -8 Left 1105847808 13:24308294-24308316 CCCGTCGCGCGTTCCGTCGGGGC 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1105847812 13:24308309-24308331 GTCGGGGCCGCCTGCGGTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 189
1105847808_1105847814 -6 Left 1105847808 13:24308294-24308316 CCCGTCGCGCGTTCCGTCGGGGC 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1105847814 13:24308311-24308333 CGGGGCCGCCTGCGGTGCAGGGG 0: 1
1: 1
2: 0
3: 10
4: 230
1105847808_1105847813 -7 Left 1105847808 13:24308294-24308316 CCCGTCGCGCGTTCCGTCGGGGC 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1105847813 13:24308310-24308332 TCGGGGCCGCCTGCGGTGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 88
1105847808_1105847821 29 Left 1105847808 13:24308294-24308316 CCCGTCGCGCGTTCCGTCGGGGC 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1105847821 13:24308346-24308368 CACGCGAGCAAGAGGGAGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 182
1105847808_1105847818 22 Left 1105847808 13:24308294-24308316 CCCGTCGCGCGTTCCGTCGGGGC 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1105847818 13:24308339-24308361 GACCAGCCACGCGAGCAAGAGGG 0: 1
1: 0
2: 0
3: 3
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105847808 Original CRISPR GCCCCGACGGAACGCGCGAC GGG (reversed) Intronic