ID: 1105847809

View in Genome Browser
Species Human (GRCh38)
Location 13:24308295-24308317
Sequence GGCCCCGACGGAACGCGCGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 23}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105847809_1105847818 21 Left 1105847809 13:24308295-24308317 CCGTCGCGCGTTCCGTCGGGGCC 0: 1
1: 0
2: 0
3: 2
4: 23
Right 1105847818 13:24308339-24308361 GACCAGCCACGCGAGCAAGAGGG 0: 1
1: 0
2: 0
3: 3
4: 68
1105847809_1105847814 -7 Left 1105847809 13:24308295-24308317 CCGTCGCGCGTTCCGTCGGGGCC 0: 1
1: 0
2: 0
3: 2
4: 23
Right 1105847814 13:24308311-24308333 CGGGGCCGCCTGCGGTGCAGGGG 0: 1
1: 1
2: 0
3: 10
4: 230
1105847809_1105847812 -9 Left 1105847809 13:24308295-24308317 CCGTCGCGCGTTCCGTCGGGGCC 0: 1
1: 0
2: 0
3: 2
4: 23
Right 1105847812 13:24308309-24308331 GTCGGGGCCGCCTGCGGTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 189
1105847809_1105847821 28 Left 1105847809 13:24308295-24308317 CCGTCGCGCGTTCCGTCGGGGCC 0: 1
1: 0
2: 0
3: 2
4: 23
Right 1105847821 13:24308346-24308368 CACGCGAGCAAGAGGGAGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 182
1105847809_1105847817 20 Left 1105847809 13:24308295-24308317 CCGTCGCGCGTTCCGTCGGGGCC 0: 1
1: 0
2: 0
3: 2
4: 23
Right 1105847817 13:24308338-24308360 AGACCAGCCACGCGAGCAAGAGG 0: 1
1: 0
2: 0
3: 6
4: 157
1105847809_1105847813 -8 Left 1105847809 13:24308295-24308317 CCGTCGCGCGTTCCGTCGGGGCC 0: 1
1: 0
2: 0
3: 2
4: 23
Right 1105847813 13:24308310-24308332 TCGGGGCCGCCTGCGGTGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105847809 Original CRISPR GGCCCCGACGGAACGCGCGA CGG (reversed) Intronic