ID: 1105847811

View in Genome Browser
Species Human (GRCh38)
Location 13:24308307-24308329
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 66}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105847811_1105847817 8 Left 1105847811 13:24308307-24308329 CCGTCGGGGCCGCCTGCGGTGCA 0: 1
1: 1
2: 0
3: 7
4: 66
Right 1105847817 13:24308338-24308360 AGACCAGCCACGCGAGCAAGAGG 0: 1
1: 0
2: 0
3: 6
4: 157
1105847811_1105847821 16 Left 1105847811 13:24308307-24308329 CCGTCGGGGCCGCCTGCGGTGCA 0: 1
1: 1
2: 0
3: 7
4: 66
Right 1105847821 13:24308346-24308368 CACGCGAGCAAGAGGGAGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 182
1105847811_1105847818 9 Left 1105847811 13:24308307-24308329 CCGTCGGGGCCGCCTGCGGTGCA 0: 1
1: 1
2: 0
3: 7
4: 66
Right 1105847818 13:24308339-24308361 GACCAGCCACGCGAGCAAGAGGG 0: 1
1: 0
2: 0
3: 3
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105847811 Original CRISPR TGCACCGCAGGCGGCCCCGA CGG (reversed) Intronic