ID: 1105847811

View in Genome Browser
Species Human (GRCh38)
Location 13:24308307-24308329
Sequence TGCACCGCAGGCGGCCCCGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 66}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105847811_1105847818 9 Left 1105847811 13:24308307-24308329 CCGTCGGGGCCGCCTGCGGTGCA 0: 1
1: 1
2: 0
3: 7
4: 66
Right 1105847818 13:24308339-24308361 GACCAGCCACGCGAGCAAGAGGG 0: 1
1: 0
2: 0
3: 3
4: 68
1105847811_1105847817 8 Left 1105847811 13:24308307-24308329 CCGTCGGGGCCGCCTGCGGTGCA 0: 1
1: 1
2: 0
3: 7
4: 66
Right 1105847817 13:24308338-24308360 AGACCAGCCACGCGAGCAAGAGG 0: 1
1: 0
2: 0
3: 6
4: 157
1105847811_1105847821 16 Left 1105847811 13:24308307-24308329 CCGTCGGGGCCGCCTGCGGTGCA 0: 1
1: 1
2: 0
3: 7
4: 66
Right 1105847821 13:24308346-24308368 CACGCGAGCAAGAGGGAGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105847811 Original CRISPR TGCACCGCAGGCGGCCCCGA CGG (reversed) Intronic
902719305 1:18293422-18293444 TGCTCCCCAGGCGGCCCGGCTGG + Intronic
904822840 1:33256497-33256519 TGAACAGCAGGCGACCCGGAAGG + Intergenic
906315963 1:44786568-44786590 GGCGCAGCAGGCGGCCCCGCTGG + Exonic
913942262 1:125119599-125119621 TGCACTGCGCTCGGCCCCGATGG + Intergenic
917001651 1:170367551-170367573 TGCACTGCAGGCTGCCTCCAGGG + Intergenic
1072501500 10:96022844-96022866 TGCACAGCAGGAGGCCCTGAGGG + Intronic
1072661044 10:97363701-97363723 TGCATAGCAGGCGGTCCAGAAGG - Intronic
1077008663 11:370444-370466 TTCACCGAAGGCGCCCCCGCCGG - Intronic
1083203361 11:61132984-61133006 AGCACAGCAGGAGGCCCCCAGGG - Intronic
1090636934 11:128695087-128695109 TGCAACGGAGGCGGCTCCGAAGG - Intronic
1091916089 12:4272641-4272663 TTCACCGCAGTCGGCTCCCAGGG + Intergenic
1096503572 12:52079864-52079886 TGCACCGCGCGCGGCCCCTCGGG - Intergenic
1096774389 12:53955314-53955336 CCGAGCGCAGGCGGCCCCGACGG - Exonic
1097063065 12:56300277-56300299 TGCACCAGAGGCCGCGCCGACGG + Exonic
1103120175 12:118373194-118373216 CGCACCCCAGGCGGGCCCGTAGG - Intergenic
1103937223 12:124483092-124483114 TGCACAGCAGGCAGCCCCCTGGG - Intronic
1105801058 13:23903650-23903672 TGCACCGCGGGCGGCCCCGACGG + Intergenic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1113556078 13:111236160-111236182 TGCACCACAGGAGTCCCAGAAGG - Intronic
1113653353 13:112053676-112053698 GGCACCGGAGGCGGCCCCTGGGG - Intergenic
1115203024 14:30874281-30874303 TGGAGGGCCGGCGGCCCCGACGG - Intergenic
1119262517 14:73245945-73245967 TCCACCTCCGGCGGCTCCGATGG + Intronic
1122116605 14:99530695-99530717 AGCACCCCAGGCGGTCCCAAGGG - Intronic
1122561157 14:102615387-102615409 AGCACTGCAGGAGGCCACGATGG - Intronic
1124237767 15:28004435-28004457 TGCCCCGCTGGCGTCCCCGCAGG - Intronic
1126422525 15:48489963-48489985 AGTACCCCAGGCTGCCCCGACGG + Exonic
1130284127 15:82541259-82541281 ACCAGCGCAGGCTGCCCCGATGG + Intronic
1131108625 15:89750733-89750755 GGCACAGCGGGCAGCCCCGAGGG + Exonic
1134254913 16:12602903-12602925 AGCAACGCAAGCAGCCCCGACGG + Intergenic
1135474310 16:22760809-22760831 AGCACCCCAGGTGGCCCCCAGGG - Intergenic
1137748529 16:50841380-50841402 TACAGCGGAGGCGGCCCCCACGG - Intergenic
1142431261 16:90029137-90029159 TGCCCCGTAGGCTGCCCCGTAGG - Exonic
1144576619 17:16433747-16433769 TGCACTGCAGGGGGGCCCCAGGG - Intronic
1148371053 17:47100156-47100178 GGCAGAGGAGGCGGCCCCGAGGG - Intergenic
1151553993 17:74837464-74837486 TGCACTGTAGGAGGCCCTGAGGG - Exonic
1153964153 18:10165696-10165718 AGCACCGCTGAGGGCCCCGAGGG + Intergenic
1160909460 19:1468072-1468094 TGGACGGCCGGCGGCTCCGAGGG - Exonic
935904518 2:107827916-107827938 TGGCCCGGAGGCGGCCTCGATGG + Intronic
940140199 2:150485357-150485379 TGAACCGCTGGAGCCCCCGAGGG - Intronic
945426849 2:209716446-209716468 TGCACCACATGTGGCCCCAAGGG - Intronic
948290269 2:236819302-236819324 TGCAGGGCAGGTGGCCCCGAGGG + Intergenic
948933653 2:241149066-241149088 TTCACCGCAGCCGGCCCTGCGGG - Intronic
1173553621 20:43950226-43950248 TGCATCTCAGGTTGCCCCGATGG - Intronic
1176088630 20:63309266-63309288 CCCACCGCAGGTGGCCCCGTCGG + Intronic
1177677317 21:24317346-24317368 TGCAGAGCAGGCTGCCCCGTAGG + Intergenic
1179172720 21:38985255-38985277 GCCACCGCAGGCTGCCCCCACGG + Intergenic
1179631809 21:42683552-42683574 GGCAGCCCAGGCGGCCCCGGAGG - Intronic
1180093586 21:45544202-45544224 TGCCACGCAGGGGGACCCGAGGG - Intronic
1181669262 22:24418571-24418593 TGCACTGCAGGCGGGACGGATGG - Intronic
1183068577 22:35380716-35380738 TGCACCCCAGGCGTCCCAGAAGG - Intronic
1183259866 22:36787751-36787773 TGCATCCCAGGCGGCCCCGCAGG + Intergenic
1184096221 22:42317894-42317916 TGCACGGCAGGCAGCCAGGAGGG - Intronic
1184308810 22:43628008-43628030 TGCACCCCAGGAGGCCCCCTCGG - Intronic
950462969 3:13136063-13136085 TGTCCCGCAGGCGGCCCTGTGGG - Intergenic
950550631 3:13663963-13663985 TCGGCCGCAGGCTGCCCCGATGG + Intergenic
953910169 3:46888844-46888866 TGCCCCGAAGGCGGCCACGCTGG + Intronic
968609088 4:1549043-1549065 TGCACTGCAGGCAGCCCAGAGGG + Intergenic
968642639 4:1722041-1722063 TCCGCCGCAGGCGGCCTAGATGG - Intronic
981331403 4:143514018-143514040 AGCAACAAAGGCGGCCCCGAAGG + Exonic
985528594 5:420707-420729 TGCATGGAAGGCGGCCCAGAAGG + Intronic
990003799 5:50922802-50922824 TGCACTGCAGGCAGCCCAGAGGG - Intergenic
994320796 5:98392433-98392455 TGCCCCGCAGCCGGCCCAGCAGG - Intergenic
1002158781 5:177303054-177303076 GGCCACGAAGGCGGCCCCGATGG + Exonic
1002313979 5:178331557-178331579 TGCTCCGCACCCTGCCCCGAGGG - Intronic
1022510819 7:30933819-30933841 TGCCCTGCAGGGGTCCCCGAAGG - Intergenic
1037262849 8:17027358-17027380 GTCACCGCAGGCCGCCCCCACGG - Exonic
1041107869 8:54459230-54459252 TGAGCCGCAGGCGGCCGCGCTGG + Exonic
1049383980 8:142331639-142331661 TGCACCGCAGGATGGCCTGAGGG + Intronic
1049391831 8:142375564-142375586 TGCACCGAAGGCTGCCCAGTGGG - Intronic
1060548679 9:124475274-124475296 TCCTCCGCAGGCGGGCACGAGGG + Intronic
1061863435 9:133479261-133479283 GGCACCGCGTGCGCCCCCGAAGG + Intergenic
1062421532 9:136484676-136484698 TGCACCGCCTGCGGCCCTGCTGG - Exonic
1194383605 X:93225034-93225056 TGCACCGCAGGCGGAGGCGGAGG + Intergenic
1200144951 X:153921627-153921649 TGCTCCCCAGGCGGCCTCCACGG + Exonic
1202101593 Y:21314289-21314311 GCCACCGCAGCCGGCCCAGAAGG - Intergenic