ID: 1105847815

View in Genome Browser
Species Human (GRCh38)
Location 13:24308316-24308338
Sequence TCTGACCCCTGCACCGCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105847815_1105847817 -1 Left 1105847815 13:24308316-24308338 CCGCCTGCGGTGCAGGGGTCAGA 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1105847817 13:24308338-24308360 AGACCAGCCACGCGAGCAAGAGG 0: 1
1: 0
2: 0
3: 6
4: 157
1105847815_1105847821 7 Left 1105847815 13:24308316-24308338 CCGCCTGCGGTGCAGGGGTCAGA 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1105847821 13:24308346-24308368 CACGCGAGCAAGAGGGAGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 182
1105847815_1105847818 0 Left 1105847815 13:24308316-24308338 CCGCCTGCGGTGCAGGGGTCAGA 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1105847818 13:24308339-24308361 GACCAGCCACGCGAGCAAGAGGG 0: 1
1: 0
2: 0
3: 3
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105847815 Original CRISPR TCTGACCCCTGCACCGCAGG CGG (reversed) Intronic