ID: 1105847816

View in Genome Browser
Species Human (GRCh38)
Location 13:24308319-24308341
Sequence GTCTCTGACCCCTGCACCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105847816_1105847821 4 Left 1105847816 13:24308319-24308341 CCTGCGGTGCAGGGGTCAGAGAC 0: 1
1: 0
2: 0
3: 14
4: 163
Right 1105847821 13:24308346-24308368 CACGCGAGCAAGAGGGAGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 182
1105847816_1105847818 -3 Left 1105847816 13:24308319-24308341 CCTGCGGTGCAGGGGTCAGAGAC 0: 1
1: 0
2: 0
3: 14
4: 163
Right 1105847818 13:24308339-24308361 GACCAGCCACGCGAGCAAGAGGG 0: 1
1: 0
2: 0
3: 3
4: 68
1105847816_1105847817 -4 Left 1105847816 13:24308319-24308341 CCTGCGGTGCAGGGGTCAGAGAC 0: 1
1: 0
2: 0
3: 14
4: 163
Right 1105847817 13:24308338-24308360 AGACCAGCCACGCGAGCAAGAGG 0: 1
1: 0
2: 0
3: 6
4: 157
1105847816_1105847825 30 Left 1105847816 13:24308319-24308341 CCTGCGGTGCAGGGGTCAGAGAC 0: 1
1: 0
2: 0
3: 14
4: 163
Right 1105847825 13:24308372-24308394 GAACTGCTGAGAGCCCCCAGCGG 0: 1
1: 0
2: 2
3: 27
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105847816 Original CRISPR GTCTCTGACCCCTGCACCGC AGG (reversed) Intronic