ID: 1105847817

View in Genome Browser
Species Human (GRCh38)
Location 13:24308338-24308360
Sequence AGACCAGCCACGCGAGCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 157}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105847811_1105847817 8 Left 1105847811 13:24308307-24308329 CCGTCGGGGCCGCCTGCGGTGCA 0: 1
1: 1
2: 0
3: 7
4: 66
Right 1105847817 13:24308338-24308360 AGACCAGCCACGCGAGCAAGAGG 0: 1
1: 0
2: 0
3: 6
4: 157
1105847816_1105847817 -4 Left 1105847816 13:24308319-24308341 CCTGCGGTGCAGGGGTCAGAGAC 0: 1
1: 0
2: 0
3: 14
4: 163
Right 1105847817 13:24308338-24308360 AGACCAGCCACGCGAGCAAGAGG 0: 1
1: 0
2: 0
3: 6
4: 157
1105847815_1105847817 -1 Left 1105847815 13:24308316-24308338 CCGCCTGCGGTGCAGGGGTCAGA 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1105847817 13:24308338-24308360 AGACCAGCCACGCGAGCAAGAGG 0: 1
1: 0
2: 0
3: 6
4: 157
1105847808_1105847817 21 Left 1105847808 13:24308294-24308316 CCCGTCGCGCGTTCCGTCGGGGC 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1105847817 13:24308338-24308360 AGACCAGCCACGCGAGCAAGAGG 0: 1
1: 0
2: 0
3: 6
4: 157
1105847809_1105847817 20 Left 1105847809 13:24308295-24308317 CCGTCGCGCGTTCCGTCGGGGCC 0: 1
1: 0
2: 0
3: 2
4: 23
Right 1105847817 13:24308338-24308360 AGACCAGCCACGCGAGCAAGAGG 0: 1
1: 0
2: 0
3: 6
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105847817 Original CRISPR AGACCAGCCACGCGAGCAAG AGG Intronic
902674303 1:17997826-17997848 AGACCAGCCAGGCCAACATGGGG + Intergenic
903490696 1:23726017-23726039 AGACCAGCCAGGCCAACATGGGG - Intergenic
906325371 1:44842475-44842497 AGACCAGCCAGGCCAACATGGGG - Intronic
908755624 1:67466635-67466657 AGACCAGCCAGGCCAACATGGGG + Intergenic
910775696 1:90872586-90872608 AGACCAGCCTCGCCAACATGGGG - Intergenic
913082848 1:115405145-115405167 AGAACAGCCAAGCAAGGAAGAGG - Intergenic
922282083 1:224135834-224135856 AGACCAGCCTGGCGAACATGGGG + Intronic
923220470 1:231888360-231888382 AGGCAAGCCAAGTGAGCAAGGGG + Intronic
924194260 1:241588416-241588438 AAACCAGTCACGCGAGCACAAGG - Intronic
1063417536 10:5886390-5886412 AGACCAGCCTGGCCAACAAGGGG + Intronic
1063420946 10:5912159-5912181 AGACCAGCCTGGCCAACAAGGGG + Intronic
1065756028 10:28931982-28932004 AGACCAGCCTCGCCAACATGGGG + Intergenic
1066576504 10:36831677-36831699 AGACCAGCCAGGCCAACATGGGG + Intergenic
1069836081 10:71308991-71309013 AGCCCAGCCACGCGAGAGACTGG - Intergenic
1069860738 10:71469801-71469823 AGACCAGCCTCGCCAACATGTGG - Intronic
1069924752 10:71841090-71841112 ATTCCAGCCAAGTGAGCAAGTGG + Intronic
1070290550 10:75111012-75111034 AGACCAGCCTGGCCAGCATGGGG - Intronic
1070903399 10:80050383-80050405 AGACCAGCCTAGCCAGCATGGGG + Intergenic
1073220210 10:101865685-101865707 AGACCAGCCTGGCCAGCATGGGG - Intronic
1075669252 10:124252605-124252627 AGACCAGCCTGGCGATCATGAGG - Intergenic
1077075614 11:700326-700348 AGACCAGCCAGGCCAACATGGGG + Intronic
1077106591 11:844932-844954 AGGCCAGCCACGGGACCAGGAGG + Intronic
1078992960 11:16668172-16668194 AGACCAGCCAGGCCAACATGGGG + Intronic
1079932121 11:26577356-26577378 AGACCAGCCAGGCCAACATGGGG + Intronic
1083297192 11:61721193-61721215 AGACCAGCCTGGCGAACATGGGG + Intronic
1083811783 11:65110519-65110541 AGAGCAGCGACTCCAGCAAGAGG + Exonic
1084121111 11:67069555-67069577 AGACCAGCCTGGCCAACAAGGGG - Intronic
1085336843 11:75702826-75702848 AGACCAGCCTGGCCAGGAAGTGG + Intergenic
1091276185 11:134352844-134352866 AGACCAGCCCGGCCAACAAGGGG - Intronic
1094718814 12:33040624-33040646 AGACCAGCCTGGCCAACAAGAGG - Intergenic
1095959613 12:47826014-47826036 AGACCAGCCTGGCCAGCATGGGG + Intronic
1096218066 12:49809317-49809339 AGACCAGGCATGGGAGGAAGGGG + Intronic
1097283666 12:57861505-57861527 AGACCAGCCTGGGCAGCAAGGGG - Intergenic
1097292392 12:57929074-57929096 AGACCAGCCTGGCCAGCATGAGG - Intergenic
1103754573 12:123194068-123194090 AGACCAGCCAGGCCAACATGGGG + Intronic
1103967082 12:124646767-124646789 AGCCCAGCCACGTGAGCACGCGG - Intergenic
1104969139 12:132523337-132523359 AAACCGGCCACCCGAGGAAGGGG + Intronic
1105847817 13:24308338-24308360 AGACCAGCCACGCGAGCAAGAGG + Intronic
1106753339 13:32796983-32797005 AGACCAGCCAGGCCAGCAGAGGG - Intergenic
1109623442 13:64941609-64941631 AGACCAGCCAGGCCAACATGGGG + Intergenic
1111156663 13:84336954-84336976 AGACCAGCCTGGCCAGCATGGGG + Intergenic
1111333589 13:86792481-86792503 AGACCTGCCCCGCGAGAAGGCGG - Intergenic
1115977477 14:39012846-39012868 AGACCAGCCTGGCCAGCATGAGG + Intergenic
1121411086 14:93748682-93748704 AGATAAGCCAGGGGAGCAAGTGG - Intronic
1121510292 14:94507684-94507706 GGACCAGCCACACGAGGACGTGG + Intronic
1122049075 14:99042907-99042929 AGACCAACCAAGGGAGCAAATGG + Intergenic
1125322059 15:38499489-38499511 AGGCCAGCCACGACAGAAAGAGG + Intronic
1125632728 15:41160754-41160776 AGACCAGCCTGGCGAACATGGGG - Intergenic
1126455111 15:48852701-48852723 AGACCAGCCTCGCCAACATGGGG + Intronic
1127411045 15:58707182-58707204 AGACCAGCCTGGGGAACAAGGGG + Intronic
1127928355 15:63570362-63570384 TGCCCAGCCACACCAGCAAGAGG - Intronic
1129553042 15:76474007-76474029 AGACCAGCCTGGCCAACAAGAGG - Intronic
1131513669 15:93063782-93063804 AAACCAGCCACAGGAGAAAGAGG + Intronic
1132051829 15:98613828-98613850 AGACCAGCCTGGCCAACAAGAGG + Intergenic
1133679381 16:8106695-8106717 AGACCAGCCTCGCCAACATGGGG + Intergenic
1134247446 16:12550334-12550356 AGACCAGCCTAGCCAACAAGAGG + Intronic
1134832168 16:17332361-17332383 AGACCAGCCTGGCCAGCATGGGG + Intronic
1135712182 16:24727225-24727247 AGACCAGCCTGGCCAGCATGAGG - Intergenic
1135719648 16:24804655-24804677 ACACCAGCCAAGCAAACAAGTGG - Intronic
1136132455 16:28232162-28232184 AGACCAGCCTGGCGAACATGGGG + Intergenic
1136240514 16:28940499-28940521 AGACCAGCCTGGCCAGCATGGGG - Intergenic
1136544235 16:30947006-30947028 AGACCAGGCAGGTGAGCAAGGGG - Intronic
1138538227 16:57671531-57671553 AGACCAGCCTGGCCAGCATGGGG - Intronic
1141521330 16:84581701-84581723 AGACCAGCCAGGCCAACATGGGG - Intronic
1143779082 17:9219997-9220019 AGACCAGCCAGGCTGGCCAGCGG - Intronic
1144185489 17:12791449-12791471 AGACCAGCCAAGTGACCAGGAGG + Intronic
1146134222 17:30304587-30304609 AGACCAGCCAGGCCAACAGGGGG + Intergenic
1146971261 17:37074301-37074323 AGACCAGCCTGGCCAACAAGGGG - Intergenic
1151270021 17:72986825-72986847 AGACCAGCCTCGCCAACATGAGG + Intronic
1151788452 17:76288183-76288205 AGACCAGCCTTGCCAACAAGGGG + Intronic
1157692989 18:49698869-49698891 AGACCAGCCTTGCAAACAAGCGG - Intergenic
1161272875 19:3399671-3399693 AGACCAGCCTGGCCAACAAGGGG + Intronic
1162270659 19:9612416-9612438 AGACCAGCCTGGCGAACATGGGG - Intronic
1162830838 19:13283225-13283247 AGAGCAGCCAGGCTAGGAAGGGG + Intronic
1163751336 19:19080032-19080054 AAACCTGCCAGGCGAGCAAGTGG - Intronic
1163963158 19:20716904-20716926 AGACCAGCCACGGAAACAAATGG + Intronic
1164493741 19:28738287-28738309 AGACCAGCCTGGCCAACAAGGGG + Intergenic
1164625606 19:29725685-29725707 AGCCCAGCCACATGAGAAAGTGG - Intergenic
1166157506 19:40924973-40924995 AGACCAGCCTCGCCATCATGGGG + Intergenic
1167134039 19:47606541-47606563 AGACCAGCCTGGCCAGCAAAGGG - Intergenic
926865414 2:17351840-17351862 AGAACAGCCTCATGAGCAAGAGG + Intergenic
928569237 2:32586615-32586637 AGACCAGCCTGGGCAGCAAGGGG - Intronic
932419526 2:71593327-71593349 AGACCAGCCTGGCCAACAAGGGG - Intronic
937416626 2:121720027-121720049 AGACCAGCCTGGCCAGCATGGGG - Intergenic
939573810 2:143871885-143871907 AGACCAGCCAGGCCAACATGGGG + Intergenic
939991132 2:148876955-148876977 ACACCAGCCACTGGAGGAAGGGG - Intronic
941383707 2:164827145-164827167 AGACCAGCCTGGCCAGCATGGGG - Intronic
944735429 2:202558527-202558549 ATACAAGCCACTCAAGCAAGGGG - Intronic
945106850 2:206324174-206324196 AGACCAGCCAGGTGAGAGAGTGG - Intergenic
945953305 2:216061091-216061113 AGACCAGCCTCGGCAACAAGGGG + Intronic
947528699 2:230894989-230895011 AGACCAACCAAGCAAACAAGGGG + Intergenic
948356508 2:237382182-237382204 AGACCAGCCTGGCCAACAAGGGG + Intronic
1172254566 20:33505890-33505912 AGACCAGCCTGGCCAGCATGGGG + Intronic
1172523694 20:35584824-35584846 AGACCAGCCACACTTGTAAGGGG + Intergenic
1172811571 20:37651885-37651907 AGGCCAGCCAAGAGAGGAAGGGG - Intergenic
1173252896 20:41374037-41374059 AGGCCAGCCCCTCCAGCAAGGGG - Intergenic
1173533522 20:43789481-43789503 AGACCAGCCTGGCCAGCATGGGG - Intergenic
1175311388 20:58014157-58014179 AGACCAGCCTGGCCAGCATGGGG - Intergenic
1175499563 20:59440303-59440325 AGACCAGCCTGGCCAGCATGGGG + Intergenic
1178058381 21:28825065-28825087 AGATCAGCCAGGCCAGCAATGGG + Intergenic
1180118381 21:45726733-45726755 AGACCAGCCAGGCCAGCCATGGG - Intronic
1180709327 22:17829087-17829109 AGACCAGCAACTCCAACAAGGGG - Intronic
1181631335 22:24153155-24153177 GGACCAGCCACGTGAGCCAAAGG + Intronic
1181638809 22:24186422-24186444 AGTCCAGCCACGCGAGGCTGCGG + Intronic
1181668777 22:24416009-24416031 AGACCAGCCACCAGTGGAAGCGG + Exonic
1182262387 22:29083631-29083653 AGACCAGCCTGGCGAACATGGGG + Intronic
1184355374 22:43976068-43976090 AGACCAGCCACACTGTCAAGTGG + Exonic
951018899 3:17761102-17761124 AGACCAGCCTAGCCAGCATGGGG - Intronic
954657345 3:52203340-52203362 AGACCAGCCAGGCCAACATGGGG + Intronic
960871954 3:122258970-122258992 ATGCCAGCCACGCCACCAAGTGG + Intronic
960951156 3:122999421-122999443 AGACCAGCCTGGCCAGCATGGGG - Intronic
965850681 3:173019186-173019208 AGAACATCCCCGAGAGCAAGAGG + Intronic
969607456 4:8209756-8209778 GGCCCAGCCACGCGGGCAGGAGG - Exonic
971795967 4:31228946-31228968 AAACCAGCCACACGACCAAATGG - Intergenic
972676060 4:41260457-41260479 ACACCACCCACGCCAGCCAGTGG - Intronic
975798096 4:78030871-78030893 AGACCAGCCAGGCCAACATGGGG + Intergenic
976553227 4:86420881-86420903 AGACCAGCCTGGCCAACAAGGGG + Intronic
976566007 4:86551801-86551823 AGACCAGCCTGGCCAGCATGGGG - Intronic
976738618 4:88335638-88335660 AGACCAGCCTAGCCAGCATGGGG + Intergenic
979927849 4:126590297-126590319 AGACCAGCCCGGCCAGCATGGGG - Intergenic
984106804 4:175557972-175557994 AGACCAGCCTGGCCAACAAGGGG - Intergenic
990242927 5:53833886-53833908 AGACCAGCCTGGCCAGCATGGGG + Intergenic
991366984 5:65879024-65879046 AGACCAGCCTGGCCAGCATGGGG - Intergenic
993868407 5:93221481-93221503 AGACCAGCCAAGCCAACATGGGG + Intergenic
1002072748 5:176690056-176690078 ACACCAGCCACAGGAGCAAGGGG + Intergenic
1003281691 6:4698167-4698189 AGACCAGCCTGGCCAGCATGGGG - Intergenic
1006963479 6:37958253-37958275 AGACCAGCCAGGCCAACATGGGG + Intronic
1010127960 6:72455977-72455999 AGACCAGCCAAGCCAACATGGGG + Intergenic
1011243909 6:85301561-85301583 TGACCAGCCACGCCACCAAATGG + Intergenic
1015955347 6:138592398-138592420 AGACCAGCCTGGCCAGCATGGGG + Intronic
1018184770 6:161256977-161256999 AGACCAGCCACCTTAGCCAGTGG + Intronic
1020547411 7:9550231-9550253 AGACCAGCCAGGCCAACATGGGG - Intergenic
1022725634 7:32979068-32979090 AGACCAGCCTGGCCAGCATGGGG + Intronic
1023258956 7:38339557-38339579 AGACCAGCCAGGCCAACATGAGG + Intergenic
1024163249 7:46702231-46702253 AGACCAGCGTCGCCAACAAGGGG - Intronic
1025047979 7:55708628-55708650 AGACCAGCCTGGCCAGCATGGGG - Intergenic
1026292877 7:69024648-69024670 AGACCAGCCAGGCCAACATGGGG - Intergenic
1027218692 7:76200863-76200885 AGACCAGCCAGGCCAACATGAGG - Intergenic
1032243880 7:130190317-130190339 AGACCAGCCTGGCCAACAAGGGG + Intronic
1034479458 7:151308395-151308417 AGACCAGCCTGGCAAGCAGGAGG - Intergenic
1035187410 7:157137463-157137485 AGACCAGCCTCGCCAACATGGGG - Intergenic
1036491586 8:9231206-9231228 AGAAAAGCCACGTAAGCAAGAGG + Intergenic
1038036106 8:23688296-23688318 AGACCAGCCTGGCCAGCATGGGG - Intergenic
1040309474 8:46229311-46229333 AGCCCAGCCACGCCATCAGGCGG - Intergenic
1042583640 8:70310130-70310152 AGACCAGCAAGACCAGCAAGGGG + Intronic
1043857764 8:85280985-85281007 AGACCAGCCTGGCCAACAAGAGG - Intronic
1047780949 8:128110657-128110679 AGACCAGCCTGGCCAGCATGGGG - Intergenic
1048832165 8:138487801-138487823 AGACCAGCCTCGCCAACAAGGGG + Intronic
1050625406 9:7498952-7498974 AGACCAGCCAAGAGAGTAGGAGG - Intergenic
1051471501 9:17447859-17447881 AGACCAGCCACACCAACAATTGG - Intronic
1051847909 9:21473639-21473661 AGCCCAGTCAAGGGAGCAAGTGG + Intergenic
1053475550 9:38379661-38379683 AGACCAGCCAGGCCAACATGGGG - Intergenic
1056511521 9:87310550-87310572 AGACCAGCCTGGCCAACAAGGGG + Intergenic
1056555806 9:87686301-87686323 GGACCAGCCACCCGGGCAACAGG + Intronic
1058172913 9:101704635-101704657 AGTCCAGCCACACGATCAGGAGG + Intronic
1060352699 9:122872782-122872804 AGACCAGCCTGGCCAGCATGGGG - Intronic
1060585035 9:124780429-124780451 AGCCCAGCCAGGGGAGCAGGAGG + Intronic
1060680312 9:125556816-125556838 AGACCAGAAAGGCGAGTAAGAGG + Intronic
1061359460 9:130131812-130131834 AGCCCAGGCACGAGAGCAAGAGG - Intronic
1061952992 9:133946596-133946618 AGAGCAGCCAGGCGTGCAATCGG - Intronic
1062451948 9:136619473-136619495 AGTCCTGCCACGGGAGGAAGAGG + Intergenic
1185798633 X:2988613-2988635 AGACCAGCCTCGCCAACATGGGG + Intergenic
1190197992 X:48336247-48336269 AGACCAGCCTGGCCAACAAGGGG - Intergenic
1191878212 X:65818147-65818169 AGACCAGCCTGGCCAGCATGGGG - Intergenic