ID: 1105847818

View in Genome Browser
Species Human (GRCh38)
Location 13:24308339-24308361
Sequence GACCAGCCACGCGAGCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 68}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105847815_1105847818 0 Left 1105847815 13:24308316-24308338 CCGCCTGCGGTGCAGGGGTCAGA 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1105847818 13:24308339-24308361 GACCAGCCACGCGAGCAAGAGGG 0: 1
1: 0
2: 0
3: 3
4: 68
1105847808_1105847818 22 Left 1105847808 13:24308294-24308316 CCCGTCGCGCGTTCCGTCGGGGC 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1105847818 13:24308339-24308361 GACCAGCCACGCGAGCAAGAGGG 0: 1
1: 0
2: 0
3: 3
4: 68
1105847809_1105847818 21 Left 1105847809 13:24308295-24308317 CCGTCGCGCGTTCCGTCGGGGCC 0: 1
1: 0
2: 0
3: 2
4: 23
Right 1105847818 13:24308339-24308361 GACCAGCCACGCGAGCAAGAGGG 0: 1
1: 0
2: 0
3: 3
4: 68
1105847816_1105847818 -3 Left 1105847816 13:24308319-24308341 CCTGCGGTGCAGGGGTCAGAGAC 0: 1
1: 0
2: 0
3: 14
4: 163
Right 1105847818 13:24308339-24308361 GACCAGCCACGCGAGCAAGAGGG 0: 1
1: 0
2: 0
3: 3
4: 68
1105847811_1105847818 9 Left 1105847811 13:24308307-24308329 CCGTCGGGGCCGCCTGCGGTGCA 0: 1
1: 1
2: 0
3: 7
4: 66
Right 1105847818 13:24308339-24308361 GACCAGCCACGCGAGCAAGAGGG 0: 1
1: 0
2: 0
3: 3
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105847818 Original CRISPR GACCAGCCACGCGAGCAAGA GGG Intronic