ID: 1105847818

View in Genome Browser
Species Human (GRCh38)
Location 13:24308339-24308361
Sequence GACCAGCCACGCGAGCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 68}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105847816_1105847818 -3 Left 1105847816 13:24308319-24308341 CCTGCGGTGCAGGGGTCAGAGAC 0: 1
1: 0
2: 0
3: 14
4: 163
Right 1105847818 13:24308339-24308361 GACCAGCCACGCGAGCAAGAGGG 0: 1
1: 0
2: 0
3: 3
4: 68
1105847811_1105847818 9 Left 1105847811 13:24308307-24308329 CCGTCGGGGCCGCCTGCGGTGCA 0: 1
1: 1
2: 0
3: 7
4: 66
Right 1105847818 13:24308339-24308361 GACCAGCCACGCGAGCAAGAGGG 0: 1
1: 0
2: 0
3: 3
4: 68
1105847809_1105847818 21 Left 1105847809 13:24308295-24308317 CCGTCGCGCGTTCCGTCGGGGCC 0: 1
1: 0
2: 0
3: 2
4: 23
Right 1105847818 13:24308339-24308361 GACCAGCCACGCGAGCAAGAGGG 0: 1
1: 0
2: 0
3: 3
4: 68
1105847808_1105847818 22 Left 1105847808 13:24308294-24308316 CCCGTCGCGCGTTCCGTCGGGGC 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1105847818 13:24308339-24308361 GACCAGCCACGCGAGCAAGAGGG 0: 1
1: 0
2: 0
3: 3
4: 68
1105847815_1105847818 0 Left 1105847815 13:24308316-24308338 CCGCCTGCGGTGCAGGGGTCAGA 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1105847818 13:24308339-24308361 GACCAGCCACGCGAGCAAGAGGG 0: 1
1: 0
2: 0
3: 3
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105847818 Original CRISPR GACCAGCCACGCGAGCAAGA GGG Intronic
913082847 1:115405144-115405166 GAACAGCCAAGCAAGGAAGAGGG - Intergenic
917686475 1:177421636-177421658 GCCCAGCCAAGGGAGCAAGTAGG - Intergenic
1065599102 10:27350264-27350286 GCCCAGCCCCGCCAGCAACACGG + Intergenic
1070479304 10:76866340-76866362 GACCTGCCAGGCTAGCAAGCAGG - Intergenic
1077106592 11:844933-844955 GGCCAGCCACGGGACCAGGAGGG + Intronic
1079261543 11:18887224-18887246 GACCAGCCCTGTGAGCAGGATGG + Intergenic
1080824056 11:35833085-35833107 GAACAGCCAGAAGAGCAAGAAGG - Intergenic
1083713723 11:64564064-64564086 GGGCAGCCAGGCGAGCCAGATGG + Intronic
1084020800 11:66416635-66416657 GACCAGACAGGTGGGCAAGATGG - Intergenic
1090212009 11:124927564-124927586 GACCAGCCACCTGGGCAACAAGG - Intronic
1102040893 12:109800140-109800162 GACCAGCCTGGCCAACAAGATGG - Intronic
1105755030 13:23456148-23456170 GACCAGCCAAGTGAGGAGGATGG + Intergenic
1105847818 13:24308339-24308361 GACCAGCCACGCGAGCAAGAGGG + Intronic
1119860974 14:77935889-77935911 GACCAGCCACATGAGCCACACGG + Intergenic
1121289707 14:92763990-92764012 GACCAGCCAAGCAAGCACCAGGG + Intergenic
1121291485 14:92779510-92779532 GACCAGCCAAGCAAGCACCAGGG - Intergenic
1122061846 14:99141182-99141204 GGCCACCCAGGTGAGCAAGATGG - Intergenic
1124646179 15:31439053-31439075 CACCAGCCACGTGATCACGATGG + Intergenic
1131513670 15:93063783-93063805 AACCAGCCACAGGAGAAAGAGGG + Intronic
1132611814 16:820698-820720 GACCAGCCTAGCGACCAACACGG - Intergenic
1135220275 16:20609159-20609181 TACCAGCCATGCGAGAAACATGG + Intergenic
1139268855 16:65663612-65663634 GACCAGCCATTTTAGCAAGAGGG - Intergenic
1142066724 16:88067217-88067239 GACCAGCCACACAAGCCAGTCGG - Intronic
1143093677 17:4465070-4465092 GACCAGGCTTGAGAGCAAGAGGG + Intronic
1151270022 17:72986826-72986848 GACCAGCCTCGCCAACATGAGGG + Intronic
1154218444 18:12432400-12432422 GAGCTGCTACGGGAGCAAGATGG - Intergenic
1157251225 18:46098040-46098062 GAGAAGCCACGGGTGCAAGATGG + Intronic
1162441336 19:10694139-10694161 GACCAGCCTGGCCAGCAAGGTGG - Intergenic
1164649675 19:29882797-29882819 GACCAGCCAGGCAGGCAAGGAGG + Intergenic
1165291284 19:34888227-34888249 GGCCAGGCATGCGAGCAGGATGG - Intergenic
1165732195 19:38152930-38152952 GACCAGCCAGGAGAGCACCATGG + Exonic
1166997460 19:46726560-46726582 GACCAGACACGTGACCATGAAGG + Intronic
925289056 2:2734489-2734511 GACCAGCCACTCGGACAGGAAGG - Intergenic
927287721 2:21374072-21374094 GACCAGCCTCGCCAACATGATGG - Intergenic
1173727894 20:45309522-45309544 GACCAGCCACAGGAGGGAGAAGG - Intronic
1178508851 21:33185326-33185348 CACCAGCCACATGAGCAAGCAGG + Intergenic
1179069120 21:38055061-38055083 GAGCAGCCGCAAGAGCAAGATGG - Intronic
1184380162 22:44140384-44140406 GACCAGCTAGGGGAGCAGGAGGG + Intronic
955413055 3:58668178-58668200 GACCAGCCAAGGCAGCTAGAAGG - Intergenic
956534559 3:70261300-70261322 GACAAGCCAAGAGAGCAATAAGG - Intergenic
957045039 3:75367042-75367064 TACGAGCCAGGGGAGCAAGAGGG + Intergenic
958855872 3:99384811-99384833 GACCACCCAGGAGATCAAGAAGG + Intergenic
960690084 3:120337660-120337682 GACTAACCACCAGAGCAAGAAGG - Intronic
966121704 3:176529089-176529111 GACCAGCAAGTGGAGCAAGATGG + Intergenic
970789523 4:19840212-19840234 GAGCATCCAAGAGAGCAAGATGG - Intergenic
984041183 4:174735757-174735779 GACCAGCCTGGCGAACATGACGG - Intronic
985895512 5:2748405-2748427 GGCCAGCGACGCGGGCAAGGCGG - Exonic
990658446 5:57984689-57984711 AATCAGCCACGTGATCAAGAGGG - Intergenic
992541682 5:77771650-77771672 ATCCAGCCATGCGTGCAAGACGG - Intronic
993853711 5:93044416-93044438 GACCAGCCTGGCCACCAAGATGG + Intergenic
995463016 5:112421935-112421957 GACCAGCCTCGCCAGCATGGTGG - Intergenic
1007039806 6:38711263-38711285 AACCAGCCCCGCCAGCAACATGG - Intergenic
1007730448 6:43942334-43942356 GGCCAGCCAGGCGAGGGAGATGG - Intergenic
1010150565 6:72727181-72727203 GACCTGCCATGGGGGCAAGAGGG + Intronic
1012238253 6:96843053-96843075 CACCAGCCACCCTAGAAAGATGG - Intergenic
1012238266 6:96843149-96843171 CACCAGCCACCCGAGAAAGATGG - Intergenic
1013596137 6:111662762-111662784 GCCCAGCCACGCTGGCATGATGG - Intronic
1016322669 6:142864074-142864096 AAGCAGCCAAGCCAGCAAGAGGG + Intronic
1019381510 7:726702-726724 GACCGGCGACGCGGGCAAGATGG + Exonic
1019413088 7:915033-915055 CACCAGGCACGCCAGCCAGAGGG - Intronic
1022405724 7:30088148-30088170 GAGCAGCCAAGGGAGCAGGAGGG - Intronic
1040870822 8:52098801-52098823 GAGCAGCCCCCCAAGCAAGAAGG - Intergenic
1045482237 8:102601544-102601566 GATCAGCCAGGCGAGCTTGAAGG - Intergenic
1049008266 8:139871462-139871484 CCCCAGCCCCGCGAGCCAGAAGG + Intronic
1049679774 8:143912978-143913000 CACCAGCCATGAGAGCCAGAGGG + Intergenic
1053325047 9:37136672-37136694 GACCAGCAACATGAGCAACATGG - Intronic
1056555807 9:87686302-87686324 GACCAGCCACCCGGGCAACAGGG + Intronic
1058172914 9:101704636-101704658 GTCCAGCCACACGATCAGGAGGG + Intronic
1060585036 9:124780430-124780452 GCCCAGCCAGGGGAGCAGGAGGG + Intronic
1060803477 9:126559221-126559243 GACCAGCCTAGCCAACAAGATGG + Intergenic
1062451949 9:136619474-136619496 GTCCTGCCACGGGAGGAAGAGGG + Intergenic
1062533072 9:137010221-137010243 GACCGGCGACGAGAGCACGACGG - Exonic