ID: 1105847821

View in Genome Browser
Species Human (GRCh38)
Location 13:24308346-24308368
Sequence CACGCGAGCAAGAGGGAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 182}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105847811_1105847821 16 Left 1105847811 13:24308307-24308329 CCGTCGGGGCCGCCTGCGGTGCA 0: 1
1: 1
2: 0
3: 7
4: 66
Right 1105847821 13:24308346-24308368 CACGCGAGCAAGAGGGAGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 182
1105847809_1105847821 28 Left 1105847809 13:24308295-24308317 CCGTCGCGCGTTCCGTCGGGGCC 0: 1
1: 0
2: 0
3: 2
4: 23
Right 1105847821 13:24308346-24308368 CACGCGAGCAAGAGGGAGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 182
1105847808_1105847821 29 Left 1105847808 13:24308294-24308316 CCCGTCGCGCGTTCCGTCGGGGC 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1105847821 13:24308346-24308368 CACGCGAGCAAGAGGGAGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 182
1105847815_1105847821 7 Left 1105847815 13:24308316-24308338 CCGCCTGCGGTGCAGGGGTCAGA 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1105847821 13:24308346-24308368 CACGCGAGCAAGAGGGAGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 182
1105847816_1105847821 4 Left 1105847816 13:24308319-24308341 CCTGCGGTGCAGGGGTCAGAGAC 0: 1
1: 0
2: 0
3: 14
4: 163
Right 1105847821 13:24308346-24308368 CACGCGAGCAAGAGGGAGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105847821 Original CRISPR CACGCGAGCAAGAGGGAGCC CGG Intronic
900432051 1:2607097-2607119 CACGTGAGCCACAGGGAGGCTGG - Intronic
900724935 1:4209925-4209947 CACGGGAGAAAGATGGAGGCCGG + Intergenic
901597894 1:10399411-10399433 GACGCGTGCCAGCGGGAGCCGGG + Intronic
901833875 1:11911075-11911097 CACGGGAGAAAGATGAAGCCCGG + Intergenic
902195468 1:14794933-14794955 CACGGGAGAAAGATGGAGGCTGG - Intronic
902876547 1:19343972-19343994 CAGGCCAGCCAGAGGCAGCCGGG + Intronic
903218545 1:21856030-21856052 CACAGGAGCCAGAGGGAGCTTGG + Intronic
903885712 1:26539954-26539976 CAGGGGAGCATGAGGGATCCGGG - Intronic
908128839 1:61054491-61054513 CAAGCGAGCAAGGGGGAGACAGG + Intronic
913329160 1:117653036-117653058 CAAGCAAGCAAGAGTCAGCCAGG + Intergenic
914491513 1:148153688-148153710 CAAGAGAGGAAGAGCGAGCCAGG + Intergenic
916344764 1:163775336-163775358 CACGGGAGTCAGAGGGAGCTGGG + Intergenic
917173350 1:172201991-172202013 CCCGGGAGCAACACGGAGCCAGG - Intronic
920258442 1:204672672-204672694 AAGGAGAGCAAGAGGGAGCTAGG - Intronic
921410765 1:214834470-214834492 CACGGGAGAAAGAGGTAGGCTGG + Intergenic
922452893 1:225750981-225751003 CAGGCGAACAGGATGGAGCCTGG + Intergenic
922616670 1:226964954-226964976 TAGGAGAGCAAGAGCGAGCCAGG - Intronic
1064352132 10:14585995-14586017 CGCCCAAGCAAGAGGGATCCAGG - Intronic
1064362651 10:14679876-14679898 CACGGGAGAAAGATGGAGGCCGG - Intronic
1064423157 10:15207490-15207512 CACGGGAGAAAGATGGAGGCTGG + Intergenic
1065665860 10:28059717-28059739 CACCAGAGCAAGAAGAAGCCAGG - Exonic
1066007835 10:31164091-31164113 CACGGGAGAAAGATGGAGGCTGG + Intergenic
1070668178 10:78359981-78360003 GAGGTGAGCAGGAGGGAGCCTGG + Intergenic
1071895968 10:90067426-90067448 CACCTGAGCAAGAGGGATCCTGG - Intergenic
1073896653 10:108168216-108168238 CATGAGAGCCACAGGGAGCCAGG + Intergenic
1074148837 10:110740488-110740510 CAGGAGAGCTAGTGGGAGCCAGG + Intronic
1076386728 10:130062476-130062498 CACGGGAGAAAGAGGAAGCCTGG - Intergenic
1076739867 10:132477832-132477854 CTCGCTAGCCAGAGGCAGCCTGG + Intergenic
1076849226 10:133084906-133084928 CACGCGGCCATGAGGGACCCAGG - Intronic
1077300773 11:1846027-1846049 CACTCGATCAAGGGGAAGCCAGG + Intergenic
1081379859 11:42401058-42401080 CAAGGGAGAAAGAGGAAGCCTGG - Intergenic
1082092300 11:48099998-48100020 CACGTGGGGAAGAGGGGGCCTGG + Intronic
1083792864 11:64997073-64997095 CACGTGAGCAAGCCTGAGCCAGG - Intergenic
1084431242 11:69112527-69112549 CACCAGAGCCTGAGGGAGCCAGG - Intergenic
1085998125 11:81947254-81947276 CACGCGAGAAAGATGAAGGCCGG - Intergenic
1087812253 11:102621080-102621102 CAGGCGGGTAGGAGGGAGCCAGG - Intronic
1088777548 11:113100264-113100286 CACACAAGCAAGTGGGTGCCAGG + Intronic
1089279906 11:117366582-117366604 CAAAGGAGCAGGAGGGAGCCTGG + Intronic
1089780412 11:120869734-120869756 CACTGGAGGAAGAGGGGGCCTGG + Intronic
1091568269 12:1662993-1663015 CCCGCGAACATGAGGCAGCCGGG + Intergenic
1092017985 12:5175412-5175434 CACGGGAGAAAGATGGAGCCTGG + Intergenic
1092578909 12:9818990-9819012 CCCGGGAGCAACATGGAGCCAGG + Intergenic
1098996377 12:77125477-77125499 CTGGGGAGCAGGAGGGAGCCTGG + Intergenic
1100427166 12:94498113-94498135 CAGGTGAACAGGAGGGAGCCAGG - Intergenic
1104063849 12:125290018-125290040 CATGTCAGCAAGAGGAAGCCTGG + Intronic
1105847821 13:24308346-24308368 CACGCGAGCAAGAGGGAGCCCGG + Intronic
1106121770 13:26865666-26865688 CACTGGAGCAGGAGGGAGCAAGG - Intergenic
1106598857 13:31170329-31170351 CTAACCAGCAAGAGGGAGCCAGG + Intergenic
1107013325 13:35689410-35689432 CACGGGAGAAAGATGGAGGCTGG - Intergenic
1107587164 13:41863195-41863217 CACGCGAGAAAGATGTAGGCTGG - Intronic
1114055736 14:18965856-18965878 CAGGCCAGCAAGAGGGGGCTTGG - Intergenic
1114106811 14:19435908-19435930 CAGGCCAGCAAGAGGGGGCTTGG + Intergenic
1117002720 14:51387461-51387483 CCCTCCAGCAAGGGGGAGCCAGG - Intergenic
1117956031 14:61124442-61124464 CACTGGAGCCAGTGGGAGCCAGG - Intergenic
1119472395 14:74908143-74908165 GACGAAAGCAGGAGGGAGCCTGG + Intronic
1127357116 15:58210819-58210841 CACGGGAGAAAGATGTAGCCTGG - Intronic
1129393976 15:75234377-75234399 CACGCCAGCCTGAGGGTGCCAGG + Intergenic
1129524477 15:76205072-76205094 CACGGGACGAGGAGGGAGCCTGG - Intronic
1132747802 16:1444216-1444238 CAAGCGAGCTGGAGGGAGCCCGG + Intronic
1137802459 16:51273778-51273800 CACTCAAGCAAAAGGGAGCAAGG + Intergenic
1139048681 16:63096323-63096345 CACGGGAGAAAGATGGAGACCGG - Intergenic
1141160937 16:81628730-81628752 CACGAGAACAGGTGGGAGCCGGG - Intronic
1141587977 16:85047760-85047782 GAGGCGAGCAAGAGTGTGCCCGG - Intronic
1143493160 17:7295194-7295216 CATGGGAGCAAGTGTGAGCCGGG - Intergenic
1144085762 17:11807216-11807238 CAGGAGAGAAACAGGGAGCCCGG - Intronic
1144155216 17:12493821-12493843 CACGGGAGAAAGAAGGAGGCCGG - Intergenic
1145013671 17:19383587-19383609 CAGGGGAGCAAGGAGGAGCCAGG + Exonic
1149770721 17:59318782-59318804 CACGGGAGAAAGATGGAGGCTGG - Intergenic
1151682396 17:75628987-75629009 CAGGGGAGGAAGATGGAGCCGGG - Exonic
1152574920 17:81135776-81135798 CACACGAGGAAGAGGGAACCAGG + Intronic
1153104100 18:1508027-1508049 CACGGGAGAAAGATGGAGGCTGG - Intergenic
1154457636 18:14544261-14544283 CAGGCCTGCAAGAGGGAGCTGGG + Intergenic
1157394342 18:47329329-47329351 CACGGGAGAAAGAGGAAGGCTGG + Intergenic
1157908701 18:51594950-51594972 CATACCAGCAATAGGGAGCCTGG + Intergenic
1160741540 19:688513-688535 CCCTCGAGCAGGAGGGGGCCAGG + Intronic
1165097269 19:33416520-33416542 CAGGTGAGCAGGAGGGAGCAGGG - Intronic
1167582602 19:50355031-50355053 CACGGGAGAAAGACGGAGGCTGG + Intronic
1168353713 19:55689915-55689937 GAGGAGAGCAAGAGGGAGACTGG + Exonic
1168451373 19:56469214-56469236 CACGTGTGCAAGAGGGAGGCAGG - Intronic
925263669 2:2549302-2549324 CACGGGAGAAAGATGGAGGCCGG + Intergenic
925673421 2:6335547-6335569 CACGGGAGAAAGATGGAGACTGG + Intergenic
926358952 2:12067269-12067291 CACTCCAGGAAGAGGGAGCATGG + Intergenic
926606595 2:14904445-14904467 CACGGGAGAAAGATGGAGGCTGG + Intergenic
926748300 2:16178597-16178619 CACAGGAGCATGAGGGAGCAGGG - Intergenic
928223890 2:29430886-29430908 CAGCCGAGCAAGAGCAAGCCTGG + Intronic
929778522 2:44943054-44943076 GACGCGCGGAAGAGGGGGCCGGG + Intronic
934559722 2:95306850-95306872 CAAGCCAGCAGGAGGGTGCCTGG + Intronic
935563976 2:104587689-104587711 CACGGGAGAAAGATGTAGCCTGG + Intergenic
935597954 2:104894494-104894516 CAGGGGAGGAAGAGGAAGCCTGG - Intergenic
936416721 2:112322155-112322177 CAAGCAAGCAAGAGGGAGGGAGG - Intronic
937620262 2:123977112-123977134 CACGGGAGAAAGATGAAGCCTGG + Intergenic
938337169 2:130510437-130510459 CACGCCGGCAAGAGGGGGCTTGG + Intergenic
938352668 2:130610294-130610316 CACGCCGGCAAGAGGGGGCTTGG - Intergenic
938422443 2:131155592-131155614 CCCGGCAGCACGAGGGAGCCAGG + Intronic
941547919 2:166876992-166877014 TACCCGAGCAAAAGGGAGCCAGG - Intergenic
942352031 2:175063018-175063040 CAGACTGGCAAGAGGGAGCCAGG - Intergenic
943470837 2:188292205-188292227 CACGCTACCTGGAGGGAGCCTGG - Intronic
943513553 2:188856678-188856700 CACGAGAGAAAGATGGAGGCTGG + Intergenic
946025318 2:216668517-216668539 AACGAGAGGAAGAGGAAGCCAGG + Intergenic
947327454 2:228993245-228993267 CAACAGAGCAAGTGGGAGCCAGG - Intronic
948555484 2:238807117-238807139 CAAGCGATCAAGAGGAAGTCAGG - Intergenic
948637556 2:239349168-239349190 CAGGCAGGCAAGAGTGAGCCGGG + Intronic
1170922794 20:20694807-20694829 CACCCAAGCAAGAGCCAGCCTGG + Intronic
1171127287 20:22613574-22613596 CAAGCGAGGAAGAAGCAGCCAGG - Intergenic
1172934456 20:38609745-38609767 CTCCAGGGCAAGAGGGAGCCTGG + Intronic
1175404182 20:58716339-58716361 CACCCAAGCCAGTGGGAGCCTGG - Intronic
1176056528 20:63151834-63151856 CTGGAGAGCCAGAGGGAGCCGGG + Intergenic
1177514797 21:22135295-22135317 CACGGGAGAAAGATGTAGCCTGG - Intergenic
1179525085 21:41970902-41970924 CCCGGGAGGACGAGGGAGCCAGG - Intergenic
1179614440 21:42572805-42572827 CAAGCTGGCAGGAGGGAGCCTGG - Intronic
1179933806 21:44590398-44590420 CACAGGACCAGGAGGGAGCCAGG + Intronic
1179941086 21:44639142-44639164 CACGGGACCAAAAGGGAGCCAGG - Intronic
1180046353 21:45307557-45307579 GACGAGAGGAAGACGGAGCCGGG + Intergenic
1180048955 21:45322756-45322778 CACGCGAGGAAGAGGAGGGCGGG - Intergenic
1180474213 22:15688407-15688429 CAGGCCAGCAAGAGGGGGCTTGG - Intergenic
1180652229 22:17387515-17387537 CACGCCAGCAGGCTGGAGCCGGG - Intronic
1181982533 22:26775604-26775626 CAGGAGAGCCAGAGGGTGCCAGG + Intergenic
1183982767 22:41551975-41551997 CACTGGAGGAAAAGGGAGCCAGG - Intergenic
1184504780 22:44893997-44894019 CATGCGAGCGAGAGGGGGCATGG + Intronic
1185115141 22:48929699-48929721 AAGGCAAGCAAGAGGGAGCTGGG - Intergenic
955939254 3:64132385-64132407 CAGCCTAGCAGGAGGGAGCCAGG - Intronic
957535972 3:81503998-81504020 CAAGGGAGCAAGAGAGAGCAAGG + Intronic
958641783 3:96814548-96814570 CGCGCGCGCAAGAGCGAGCTCGG - Intergenic
959946894 3:112134441-112134463 CACGCAGGCAAGCGGGTGCCAGG - Intergenic
961316604 3:126040484-126040506 AATGCGAGCAGAAGGGAGCCTGG + Intronic
963319318 3:143795926-143795948 CCTGACAGCAAGAGGGAGCCTGG + Intronic
965191023 3:165530084-165530106 CACGGGAGAAAGATGTAGCCTGG - Intergenic
965811309 3:172593536-172593558 CACGGGAGAAACATGGAGCCAGG - Intergenic
965929048 3:174019372-174019394 CAAGAGGGCAAGAGTGAGCCAGG - Intronic
968080829 3:195845710-195845732 CAAGCGAGAAAGAGGGAGGAAGG - Intergenic
969283134 4:6184955-6184977 CACGGGAGAAAGATGGAGGCCGG - Intronic
972382645 4:38533822-38533844 CACGGGAGAAAGATGGAGGCTGG - Intergenic
976530776 4:86149807-86149829 CACACAGGTAAGAGGGAGCCAGG + Intronic
978219585 4:106255358-106255380 CACGCGGCCAAGGGAGAGCCAGG + Intronic
978968257 4:114769414-114769436 CACGGGAGAAAGATGAAGCCCGG - Intergenic
981571933 4:146160838-146160860 CACGGGAGAAAGAGGTAGGCTGG - Intergenic
982894577 4:160902611-160902633 CACGGGAGAAAGATGGAGGCTGG - Intergenic
983485488 4:168327617-168327639 GATGCGAGCGAGAGGGAGGCTGG + Intergenic
984616773 4:181907246-181907268 CAGGAGTGCAACAGGGAGCCAGG + Intergenic
984735184 4:183100880-183100902 CAGGCCAGCAACAGGCAGCCAGG - Intronic
985580934 5:694714-694736 CACCCGAGCAGGAGGGAAGCAGG - Intergenic
985595559 5:786046-786068 CACCCGAGCAGGAGGGAAGCAGG - Intergenic
986450117 5:7854857-7854879 CACGGGAGAAAGAGGTAGGCTGG + Intronic
987550409 5:19372752-19372774 CACGGGAGAAAGATGAAGCCTGG - Intergenic
987796773 5:22638425-22638447 CACGGGAGAAAGATGGAGGCTGG + Intronic
989228925 5:39065242-39065264 AGCGGGAGCAAGAGGGAGCTGGG + Intronic
990693942 5:58393881-58393903 CAAGAGAGCAAGTGGAAGCCTGG - Intergenic
992480466 5:77146499-77146521 CACGGGGGCAAGTGAGAGCCAGG + Intergenic
993868812 5:93225590-93225612 CAAGGGAGAAAGAGAGAGCCCGG + Intergenic
996391707 5:122969761-122969783 CACTGGGGCAAGAGGGATCCAGG - Intronic
996556626 5:124785285-124785307 CACGGGAGAAAGATGCAGCCTGG - Intergenic
997521335 5:134526101-134526123 CGAGCGAGCAAGAGAGAGCGAGG - Exonic
999424149 5:151472257-151472279 CACGGGAGAAAGATGTAGCCTGG + Intronic
1001513348 5:172338632-172338654 CACGCGAGGCAAAGGCAGCCTGG - Exonic
1002356406 5:178632885-178632907 CACACGGGCAGGAGGGAGCCAGG - Intergenic
1002471088 5:179436534-179436556 CACGGCAGCAGGAGGGCGCCTGG - Intergenic
1002584283 5:180232119-180232141 CGCCCGAGAAAGAGGGTGCCTGG - Intergenic
1006516626 6:34549195-34549217 CTCTGGAGCAGGAGGGAGCCAGG - Intronic
1013298318 6:108780184-108780206 CACGAGAGCAAGAGTGGGGCTGG + Intergenic
1014339788 6:120190326-120190348 CATGGGAGCAACATGGAGCCAGG + Intergenic
1017468412 6:154716550-154716572 CAAGAGAGCAAGTTGGAGCCGGG + Intergenic
1018278271 6:162156548-162156570 CACGGGAGAAAGATGGAGGCCGG + Intronic
1019020268 6:168912164-168912186 CACGGGAGAAAGATGGAGGCAGG - Intergenic
1022234534 7:28448152-28448174 CACGGGAGAAAGAGGTAGGCTGG - Intronic
1023049546 7:36239241-36239263 CACACAACCCAGAGGGAGCCAGG - Intronic
1029226679 7:99033786-99033808 CACCTGAGCAAGAAGGGGCCTGG - Intronic
1034119015 7:148610401-148610423 CACGGGAGAAAGAGGTAGGCTGG - Intronic
1034880845 7:154761418-154761440 GACCCAAGCAAGAGAGAGCCAGG + Intronic
1036464856 8:8987395-8987417 CAATCAAGCAAGATGGAGCCAGG - Intergenic
1040471108 8:47736804-47736826 CCAGCGAGCACCAGGGAGCCCGG - Intergenic
1043373655 8:79622986-79623008 CAGGAGAGCAGGAGGGTGCCAGG - Intronic
1048311174 8:133323480-133323502 CACGCGGGCAAGTGGGTGCAAGG - Intergenic
1048737791 8:137520778-137520800 CACGGGAGAAAGATGGAGGCCGG - Intergenic
1051774493 9:20620480-20620502 CGCGCGGGCAGGCGGGAGCCGGG + Intronic
1052258445 9:26486880-26486902 CAACCTATCAAGAGGGAGCCAGG - Intergenic
1052443817 9:28533167-28533189 CACCCGAGCAAGATGAAGGCCGG - Intronic
1053609468 9:39697466-39697488 CAGGAGAGCAGAAGGGAGCCAGG - Intergenic
1053867364 9:42454051-42454073 CAGGAGAGCAGAAGGGAGCCAGG - Intergenic
1054088847 9:60774026-60774048 CAGGAGAGCAGAAGGGAGCCAGG + Intergenic
1054244056 9:62644931-62644953 CAGGAGAGCAGAAGGGAGCCAGG + Intergenic
1054558181 9:66679479-66679501 CAGGAGAGCAGAAGGGAGCCAGG + Intergenic
1056507978 9:87275406-87275428 CACTAGAGCAGGAGGGAGGCAGG + Intergenic
1056960353 9:91117566-91117588 CCCGCGAGCACAAGGGAGCCGGG + Intergenic
1059832272 9:118110495-118110517 GAGGCTAGCAAGAGGGAGTCAGG - Intergenic
1060661565 9:125408063-125408085 ACCGGGAGCCAGAGGGAGCCGGG + Intergenic
1060934140 9:127506045-127506067 CAGGCGGGCAGGAGGGAGGCAGG + Exonic
1193739903 X:85204204-85204226 CCTGGGAGCAACAGGGAGCCAGG - Intergenic
1193905042 X:87231974-87231996 CACGGGAGAAAGATGGAGGCCGG + Intergenic
1195959574 X:110371673-110371695 CACTCCATAAAGAGGGAGCCAGG - Intronic
1198380489 X:136078662-136078684 CACGAGAGGAAGAGAGAGACTGG + Intergenic
1198420874 X:136470003-136470025 CCTGCTAGCAAGAGGGACCCTGG + Intergenic
1198750494 X:139932779-139932801 CACGCCCGGAAGAGGGAGTCTGG - Intronic
1198869054 X:141156569-141156591 CACGGGAGAAAGATGGAGGCTGG - Intergenic
1199375167 X:147099619-147099641 CACTCGTGCAAGACTGAGCCAGG + Intergenic