ID: 1105848293

View in Genome Browser
Species Human (GRCh38)
Location 13:24311875-24311897
Sequence CCCTTTCCCGCTTCCTGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 2, 2: 1, 3: 10, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105848293_1105848298 -3 Left 1105848293 13:24311875-24311897 CCCCCACAGGAAGCGGGAAAGGG 0: 1
1: 2
2: 1
3: 10
4: 200
Right 1105848298 13:24311895-24311917 GGGCACCCCCTTACCCTTTAAGG 0: 2
1: 0
2: 2
3: 9
4: 67
1105848293_1105848299 1 Left 1105848293 13:24311875-24311897 CCCCCACAGGAAGCGGGAAAGGG 0: 1
1: 2
2: 1
3: 10
4: 200
Right 1105848299 13:24311899-24311921 ACCCCCTTACCCTTTAAGGCCGG 0: 2
1: 0
2: 0
3: 5
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105848293 Original CRISPR CCCTTTCCCGCTTCCTGTGG GGG (reversed) Intronic
902596765 1:17514972-17514994 CCCTTTCCAGCTTCTTTTTGCGG + Intergenic
904453560 1:30632477-30632499 CCCTTTGCCTCTCCCTTTGGGGG + Intergenic
905891447 1:41521003-41521025 GCCTTTCCCACTCCATGTGGAGG + Intronic
905971220 1:42143991-42144013 CCCTCTCCCACCTCCTGTGGAGG + Intergenic
911087793 1:93993644-93993666 CCCTTGACCACTTCCTGTAGGGG + Intronic
915664077 1:157429077-157429099 CCCTTTCCTACATGCTGTGGAGG + Intergenic
916426409 1:164685432-164685454 CACCTTCATGCTTCCTGTGGTGG + Intronic
917516028 1:175709175-175709197 CCATCTCTTGCTTCCTGTGGAGG + Intronic
922279917 1:224114087-224114109 CCCTGTTCCCCTTGCTGTGGGGG + Exonic
922767380 1:228163078-228163100 GCCTTTCCTGCTGCCTGTGCAGG + Intergenic
924807680 1:247374036-247374058 CCCTTTCCCGCGCCCTCTGGTGG + Intergenic
1062812446 10:477137-477159 CCTTTTCCTTCTTCCTGTGCTGG - Intronic
1064140390 10:12785292-12785314 CCCTTTCCTGCTTTGTCTGGAGG + Intronic
1066443193 10:35458277-35458299 CCCTTTCCCTCTTCCAAGGGTGG + Intronic
1068946690 10:62736519-62736541 CCCTGACTCCCTTCCTGTGGGGG - Intergenic
1071281867 10:84110833-84110855 CCCTTTCCCTCTCCTTTTGGGGG - Intergenic
1071531050 10:86390522-86390544 ACCTCTCCCGCTTCCTGAAGCGG - Intergenic
1072195669 10:93115717-93115739 ACCTCTCCCGCTCACTGTGGTGG + Intergenic
1072953221 10:99866791-99866813 ACCTTTCCAGCTTCCTGATGGGG + Intergenic
1074394189 10:113084059-113084081 TCCATTCCCTCTTGCTGTGGAGG + Intronic
1076902760 10:133347917-133347939 CCCTCTCCCCGCTCCTGTGGAGG + Intronic
1077150774 11:1072190-1072212 CCCTCTCCCTCTTCCTCCGGTGG + Intergenic
1077163181 11:1122795-1122817 CCCCATCCAGCTGCCTGTGGGGG - Intergenic
1079111624 11:17608207-17608229 CCCTGCCCCCCATCCTGTGGAGG - Intronic
1081673597 11:44955455-44955477 CCCTTTCCTGCTTCCTGTGGGGG + Intergenic
1081878716 11:46429296-46429318 CCCCTGCCCGCATCCTGGGGAGG + Intronic
1081963521 11:47155358-47155380 CTCTTCCCCACTTCCTTTGGGGG + Intronic
1082769019 11:57191427-57191449 CCTTTTGCCTCTTCCTGGGGTGG - Exonic
1083426920 11:62592903-62592925 CCCATTCCCCTTTCCTATGGAGG + Intergenic
1083616143 11:64027599-64027621 CCCTTCCCAGCTTCCTGCAGAGG - Intronic
1084357532 11:68650113-68650135 CCCTTTCCCGCCTGCTCTGCTGG + Intergenic
1084487884 11:69461671-69461693 CCCATTCCCTTTTCCAGTGGGGG - Intergenic
1088887897 11:114021866-114021888 CCCTTACTCTCTTTCTGTGGAGG + Intergenic
1089752084 11:120659245-120659267 CCCTCTCCTCCTTCCTGAGGTGG - Intronic
1090211885 11:124926666-124926688 CCCCTTGCCGCTTCCTTTGATGG + Intronic
1091118672 11:133039031-133039053 CCCATTCCCACTTCCTATGCTGG + Intronic
1091134277 11:133174200-133174222 CCATTTCCTTCTTCCTGTCGTGG - Intronic
1093416338 12:18925171-18925193 CTCTTTCTCTCTTCCTGTTGTGG - Intergenic
1094361989 12:29640459-29640481 CCCTTTCCCACTTCCACTGTTGG - Intronic
1096649781 12:53056495-53056517 CTCTTTCTAGCTTCCAGTGGTGG + Intronic
1102821130 12:115910051-115910073 CCCTTCCCAGCTGCATGTGGTGG - Intergenic
1102873777 12:116434275-116434297 CCCTGTCCCTCTGCCTCTGGTGG + Intergenic
1103316703 12:120062091-120062113 CCCTTTCCCACCTCCTGTTTGGG - Intronic
1105800739 13:23901221-23901243 CCCTTTCCCGCTTCCTGTGTGGG + Intronic
1105848293 13:24311875-24311897 CCCTTTCCCGCTTCCTGTGGGGG - Intronic
1106603925 13:31209974-31209996 CTCTTTCCCTGTTCCTGTGAGGG - Intronic
1107672861 13:42764361-42764383 CCCTTTCACCTTTCCTGTGCAGG - Intergenic
1107686836 13:42909319-42909341 CCCTTACACGCTGCTTGTGGGGG + Intronic
1109802646 13:67399575-67399597 CCCTTTCCCTCTCCTTTTGGGGG - Intergenic
1110267864 13:73558810-73558832 GACTTTCCAGCTTCCTGTAGTGG + Intergenic
1112783695 13:102929072-102929094 CCCTCTCCAGCTTCCTTAGGGGG + Intergenic
1113107395 13:106786369-106786391 TCCTGTCCCGCTTCCTGTTTTGG - Intergenic
1113735074 13:112672618-112672640 CACGTTCCCTCTGCCTGTGGAGG - Intronic
1114199905 14:20510445-20510467 CCATTTCCCGCTTCCTCTCCAGG + Exonic
1114529816 14:23388661-23388683 CCCTGACCCACTTCCTGTGACGG - Intronic
1117333976 14:54741012-54741034 CCCTTTACCCTTCCCTGTGGAGG + Intronic
1119482091 14:74964280-74964302 CCCTTTCCTGCTCCCTCTGTGGG - Intergenic
1122689466 14:103524901-103524923 CCCTTTCCCCTTTCCTGAAGGGG + Intergenic
1124141626 15:27082102-27082124 CCCTTGCCTGCTTCTGGTGGAGG + Intronic
1124531980 15:30516570-30516592 CCCTTTCCAGCTTCCTTTTAAGG - Intergenic
1124766673 15:32491075-32491097 CCCTTTCCAGCTTCCTTTTAAGG + Intergenic
1127627547 15:60795138-60795160 CTTTTTCCCGGTTCCTGAGGTGG - Intronic
1128511010 15:68313910-68313932 ACCCTTCCCGCTGCCTGTGCTGG - Intronic
1128565003 15:68695296-68695318 CCCCTCCCTGCTTCCTTTGGAGG + Intronic
1131399033 15:92109962-92109984 CTCTTTCCCGTTTCCTGTAAGGG + Intronic
1133689640 16:8200943-8200965 AACTTTCCTGCTTCCTGTAGTGG + Intergenic
1136223603 16:28844437-28844459 GCCTTTCCTGCTGCCTGTGGAGG - Exonic
1136585456 16:31181283-31181305 CTCTTTCCCTTTTCCTGCGGGGG + Intronic
1137741950 16:50786154-50786176 CCCTTTCCCATTTCCCTTGGTGG + Intronic
1138434179 16:56988160-56988182 CCCTGACCCGCTCCCTGTGCAGG - Intergenic
1140096601 16:71881353-71881375 TCCTTTGCCACTTCCTGTGGAGG - Intronic
1141894056 16:86947209-86947231 CCCCTTCCCTCATCCTGAGGTGG - Intergenic
1142170529 16:88619791-88619813 CCCGTTCCCTCTCCCTGTGTTGG + Intronic
1142420526 16:89966855-89966877 CTCTGTCCTGCTCCCTGTGGAGG + Exonic
1143882777 17:10042505-10042527 CCCTTTCCTGAATCCTGTGTGGG + Intronic
1144956086 17:19019637-19019659 CTCTTCCCTGCTGCCTGTGGGGG + Intronic
1145011805 17:19372552-19372574 CCCTTCCCGACTTCCTGTGCTGG + Intronic
1146468272 17:33104355-33104377 CCCTCTCCCTTTTCCTGGGGTGG - Intronic
1148960286 17:51386697-51386719 CCTTCTCCCATTTCCTGTGGGGG + Intergenic
1148982686 17:51592265-51592287 CCCTTCCCCGCTTCTAGAGGTGG - Intergenic
1151171917 17:72253805-72253827 CACTTTCCCTCTTCCTGTCTTGG - Intergenic
1151336296 17:73441606-73441628 CCCTTCCTGGCTTCCGGTGGTGG - Intronic
1152278399 17:79371413-79371435 CCCTTTCCTGCTCCCTGTGGGGG + Intronic
1152911305 17:83006456-83006478 CCCTTCACCACTTCCTCTGGTGG + Intronic
1157234892 18:45955076-45955098 GCCTCTCCCCCTTCCTTTGGGGG + Exonic
1159632282 18:70762901-70762923 CCCTTTGCCTCGCCCTGTGGCGG + Intergenic
1160281764 18:77497955-77497977 CCCTTTCTTGCTTCCTGGGGAGG + Intergenic
1160709349 19:544002-544024 CCCACACGCGCTTCCTGTGGGGG - Intergenic
1161586616 19:5109188-5109210 CCCTTTCCCCCTTCCTCTTGAGG + Intronic
1161673757 19:5630292-5630314 CCCTTTGCCGATTTCTGTGCTGG + Intronic
1162139518 19:8577456-8577478 CCCCTTCTCACTTCCTTTGGCGG + Exonic
1162284561 19:9728496-9728518 CCCTTTCCCTCTCCTTTTGGGGG + Intergenic
1162320128 19:9966677-9966699 CCCAGTCCCGCTTCCAGTCGTGG - Exonic
1162925855 19:13930233-13930255 TCCTTTGCAGCATCCTGTGGGGG - Exonic
1163789253 19:19296957-19296979 CCCTCTCCCCCTCCCTGTGTTGG - Intronic
1163943565 19:20516178-20516200 CCCTTTCCCTCTCCTTTTGGGGG + Intergenic
1165213750 19:34254778-34254800 CCCTTGCCCGCCCGCTGTGGAGG + Intronic
1165900405 19:39166978-39167000 CCCTTGCCCCCTTCCCTTGGGGG + Intronic
1167151381 19:47712211-47712233 CCCTGTCCCCCTTCCTCAGGCGG - Intergenic
1167253451 19:48413969-48413991 CCCTTTCCCTCCTCCTGGGCAGG + Exonic
1168042879 19:53772766-53772788 CCGTTTACCTCTTGCTGTGGTGG - Intergenic
1168267106 19:55229077-55229099 CCCTCTCCCGCTTCCCATGATGG - Exonic
925938401 2:8790274-8790296 CCCTCTCCTGCTTCACGTGGAGG + Intronic
926872863 2:17441816-17441838 CCCTTTCCCGCTTCCGCAGTTGG + Intergenic
927854252 2:26517987-26518009 CCCTTCTCCCCTTGCTGTGGTGG + Intronic
928025567 2:27736098-27736120 ACCTTTCCCCCTCCCTGTTGGGG + Intergenic
931480680 2:62636300-62636322 ATCTTTCCCGCTTTCTCTGGTGG - Intergenic
934729274 2:96646491-96646513 CCCTTGCCCCCTTGCTGTTGGGG - Intergenic
934768487 2:96893860-96893882 CCTTTCCCTGCTACCTGTGGTGG + Intronic
937835595 2:126467545-126467567 CCCCCTGCCCCTTCCTGTGGTGG - Intergenic
938312017 2:130298896-130298918 CCATTTCCTGCCTCTTGTGGTGG + Intergenic
938789570 2:134664709-134664731 CCCCTTCCAGCTTCTGGTGGTGG - Intronic
942261715 2:174171928-174171950 CCCTGTGCCGCTGCCCGTGGTGG - Intronic
945626468 2:212213231-212213253 CCCTTTCCCACTTTCTGATGGGG - Intronic
948928271 2:241114169-241114191 CTCTCTCCCTCTTCCTGTGTTGG - Intronic
1168853213 20:990578-990600 CCCTCTCTCTCTTCCTGGGGTGG + Intronic
1169076997 20:2767425-2767447 CCCTTACCCGCTTCTCCTGGAGG + Intergenic
1170065470 20:12305358-12305380 CCCTTGCCCTTTTGCTGTGGTGG - Intergenic
1170626842 20:18036673-18036695 CCCTTTCTTGCTTCCTCTGTGGG + Intronic
1172969586 20:38863539-38863561 CCCTTTCCAGGTTCCTGTTCTGG + Intronic
1174195899 20:48772571-48772593 TCCTTTCCAGCTTGATGTGGTGG - Intronic
1174337408 20:49872956-49872978 CCCTTTCCTGCTCCCTATGCAGG + Intronic
1174766185 20:53255906-53255928 CCATTTCCAGCTTCATGGGGGGG - Exonic
1176013115 20:62911090-62911112 CCTGTTCCCGCTTCCTGCGAAGG + Exonic
1177852490 21:26365222-26365244 TCCTTTCTCACTTCCTGTGATGG + Intergenic
1179412175 21:41170150-41170172 CCCTTTCCCCTTTGCTCTGGAGG - Intronic
1179724094 21:43332104-43332126 CCCTGTCCTGCTGTCTGTGGTGG + Intergenic
1184624123 22:45709529-45709551 ACATTTCCTGCTTCCTGTGTTGG + Intronic
1184691435 22:46119150-46119172 CCCTTTCTTCCTTCCTCTGGAGG - Intergenic
950233223 3:11294775-11294797 CTCACTCCCACTTCCTGTGGAGG - Intronic
950245934 3:11418624-11418646 CCCTCTCCCAGTTTCTGTGGAGG + Intronic
951924527 3:27893365-27893387 CCCTTTAGCACTTCCTGTGTAGG - Intergenic
954370803 3:50168733-50168755 CCCCTTCCTGGATCCTGTGGGGG + Intronic
955126554 3:56117971-56117993 CCCATTCCCTCTCCCTGGGGTGG - Intronic
957725655 3:84063443-84063465 CCCTTTTTAGCTTCCTGTGTAGG + Intergenic
958712682 3:97737158-97737180 TCCTTTACTGCTTCCTGTGCTGG - Intronic
964522773 3:157585594-157585616 CCCTTTCCCTCTCCTTCTGGGGG + Intronic
965622390 3:170654641-170654663 CCCCTTCCCCATTCCTGGGGTGG - Intronic
967493633 3:190120387-190120409 CCCTTTTCCGCTCCTTGTTGGGG - Exonic
968802058 4:2749597-2749619 GCCTCTTCAGCTTCCTGTGGGGG - Intronic
968957056 4:3724934-3724956 GCCTGGCCCTCTTCCTGTGGAGG + Intergenic
969626667 4:8309136-8309158 CACTGTCCCTCTTCCTCTGGAGG - Intergenic
971275827 4:25195596-25195618 GCCTTTTCCTCTTCCTGTGTAGG - Intronic
973322105 4:48820434-48820456 ACCTTTCCAGCTTTCTGTTGTGG - Intronic
973530740 4:51834741-51834763 CCCTTTCCAGCTTCCTGTCCCGG - Intergenic
973922684 4:55704777-55704799 CCCTTTGCCACTTTCTTTGGGGG + Intergenic
974949301 4:68569291-68569313 CCCTTTCCCACTTCCATTGTTGG - Intronic
974958334 4:68671485-68671507 CCCTTTCCCACTTCCATTGTTGG - Intergenic
979704730 4:123708687-123708709 CCCTTTCCCACTTCCACAGGTGG - Intergenic
979999031 4:127467119-127467141 CCCTTTCTCTCTCTCTGTGGTGG - Intergenic
981054365 4:140345030-140345052 CACTTTCACACTTCCAGTGGAGG + Intronic
981743620 4:148030091-148030113 ACATTTCCCCCTTTCTGTGGAGG + Intronic
982343234 4:154327193-154327215 CCACTTCCCGCTCCCTGGGGAGG + Intronic
984685516 4:182663884-182663906 CCTTTTCCCGGTTTCTGTGTAGG + Intronic
985043293 4:185914771-185914793 CCCTTGCCCTCTTCCTGTCTCGG + Intronic
990687385 5:58321080-58321102 CACATTCCAGCTTCCTGTGTGGG - Intergenic
992880614 5:81105631-81105653 TACTTTCCCACTTCCTGTGTTGG + Intronic
993916931 5:93755561-93755583 CCCTTTCCCGCTTCCGCAGTTGG - Intronic
998797407 5:145834993-145835015 CCTTTTCCCGCTCCCTGTAAAGG + Intronic
1002192419 5:177485271-177485293 CCCCTTCCCACCTCCTGCGGAGG - Intronic
1003188065 6:3849859-3849881 GCCTTTCGCGCTTCTTGAGGAGG - Exonic
1003421277 6:5960563-5960585 CCCTTGCCCCCGTCCTGTTGGGG - Intergenic
1004955388 6:20723087-20723109 CCCTTTGCCCTTTCCAGTGGAGG + Intronic
1005925254 6:30439203-30439225 CCATATTCCGCTTCCTGTGCTGG - Intergenic
1006289912 6:33126771-33126793 CCCTTTTCTGCCTTCTGTGGAGG + Intergenic
1007577150 6:42932586-42932608 CCCTTTCCCCACTCCTGGGGAGG + Intronic
1008236810 6:49060668-49060690 ACCTTTCCTGCTTTCTGTTGTGG - Intergenic
1008789454 6:55212561-55212583 CTCTTTCCCTCTTCCTGGCGTGG + Intronic
1009422223 6:63475916-63475938 CCTTTTCCCTCTTCCTCTGAAGG - Intergenic
1010329195 6:74602377-74602399 CCAATTCCTGCTTGCTGTGGTGG + Intergenic
1011754861 6:90488044-90488066 CTCTTTCCTGATTCCTGGGGAGG - Intergenic
1012474441 6:99604648-99604670 CCCCTTCCCGCTTGCAGTGCTGG + Intergenic
1013060541 6:106629640-106629662 CCCTTGCCTGGCTCCTGTGGTGG + Exonic
1018420280 6:163634968-163634990 CCCTCTCCTGCCCCCTGTGGTGG + Intergenic
1018796195 6:167187216-167187238 CCCATGCCCCCTTGCTGTGGAGG + Intronic
1018820123 6:167367841-167367863 CCCATGCCCCCTTGCTGTGGAGG - Intronic
1023013937 7:35947699-35947721 CCATTTACCTCTTGCTGTGGTGG + Intergenic
1024067052 7:45747287-45747309 CCATTTACCTCTTGCTGTGGTGG - Intergenic
1029008222 7:97232128-97232150 CCCTGTCACACCTCCTGTGGCGG - Intergenic
1029350845 7:100011847-100011869 CCCCTTCCCTCTCCCTGGGGTGG - Intergenic
1029642305 7:101828910-101828932 CCCCTTCCCCCTGCCTGGGGTGG - Intronic
1029896367 7:103989212-103989234 CCCCTTCCAGCTCCCCGTGGTGG + Exonic
1029957661 7:104656569-104656591 CCCTTTCATGCTTCCTGAAGAGG + Intronic
1030892391 7:115014968-115014990 TGCTTTCCCACTTCCTTTGGTGG - Intronic
1033428522 7:141267049-141267071 CCCTTTCCTGCTACCTGAAGAGG + Intronic
1034412081 7:150947105-150947127 CCCTTCCCCACTCCCGGTGGAGG - Intronic
1034970305 7:155414893-155414915 CCCTTTCCTGCTTCCTGTCTTGG - Intergenic
1035968669 8:4223389-4223411 CCCTTTCCTGCTTACCTTGGCGG - Intronic
1036389308 8:8310748-8310770 CCCTTGTCTGCTTCCTGTGCTGG + Intergenic
1037239086 8:16757193-16757215 GGCATTCCCGCTTCCTGTAGCGG - Intergenic
1040706381 8:50133617-50133639 CCCTTCCCAGCTTCCTCTGGTGG + Intronic
1041636990 8:60155895-60155917 CCCTTTCCCACTTCCTCAGTTGG - Intergenic
1042122992 8:65508027-65508049 CCCTTTCCCACTTCCTCAGTTGG + Intergenic
1045245117 8:100435889-100435911 CCCTTTCCAGCTTCTAGAGGCGG + Intergenic
1045345249 8:101288076-101288098 CCTTTTCAGGCTTGCTGTGGTGG + Intergenic
1046712692 8:117529347-117529369 CTCTTACCAGCTTCCTTTGGTGG - Intronic
1047234139 8:123024306-123024328 CCCTTTCCCCCCTCCTTTGAGGG - Intronic
1048394087 8:133996786-133996808 CCCCTTCACGCTTCCAGTAGAGG - Intergenic
1050689366 9:8207970-8207992 CCATGTCCCGCCTTCTGTGGAGG + Intergenic
1055874751 9:80928441-80928463 CCTTTTCCCACTTCCAGTGTAGG + Intergenic
1062138025 9:134939953-134939975 CCCTGTCCATCCTCCTGTGGTGG - Intergenic
1062657227 9:137610361-137610383 CCCTTTCCGGCATCCTCTGTGGG + Intronic
1185909592 X:3969806-3969828 CCCTTTCCCACTCCCTTCGGGGG - Intergenic
1186515693 X:10164848-10164870 CTCTTTCCCGCTTCTTGTCGTGG + Intronic
1188122642 X:26328085-26328107 CCCTTACCCCTTTCCTGTTGTGG + Intergenic
1189455803 X:41188336-41188358 CCTTTTGCTGCTTCTTGTGGGGG + Intronic
1189954152 X:46261282-46261304 CCTTTGCCCCCTGCCTGTGGTGG + Intergenic
1190448802 X:50557435-50557457 CCCTTTCCCACTTCCCCTGTTGG - Intergenic
1190739559 X:53280249-53280271 CCCTTCCTCCCTTCCTGTGAGGG - Intronic
1194927031 X:99837166-99837188 CCCTTTCCCACTTCCAGAGTTGG + Intergenic
1196149987 X:112363032-112363054 CCCTTTCTCTCTTCCCATGGAGG + Intergenic
1196367529 X:114940356-114940378 ACCTTTCCTGCTTTCTGTTGTGG + Intergenic
1201554786 Y:15256674-15256696 CCTTTTCCCTCTTCTTTTGGGGG - Intergenic
1202034477 Y:20617954-20617976 GCCTTTCCTGCTTTCTGTTGTGG + Intergenic