ID: 1105848831

View in Genome Browser
Species Human (GRCh38)
Location 13:24316697-24316719
Sequence TGCATCTATATGACCTAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105848829_1105848831 -5 Left 1105848829 13:24316679-24316701 CCATACAGCTGCTGCTTATGCAT 0: 1
1: 0
2: 1
3: 9
4: 178
Right 1105848831 13:24316697-24316719 TGCATCTATATGACCTAGGTTGG 0: 1
1: 0
2: 0
3: 4
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105848831 Original CRISPR TGCATCTATATGACCTAGGT TGG Intronic
904274563 1:29371933-29371955 GGCATCACTATGACCTAGGCAGG - Intergenic
907860117 1:58344979-58345001 TGCATCTATAGGTGCTAGGCTGG - Intronic
908047273 1:60184487-60184509 TGCATCAATGTGACCTGGATGGG - Intergenic
910936537 1:92487184-92487206 TTCATCTTTATGTCCTAGGCGGG + Intergenic
917138299 1:171808933-171808955 AGCATCTTCAAGACCTAGGTAGG - Intronic
917208584 1:172606181-172606203 TGCATCTATATGAATAAGATTGG + Intronic
918152823 1:181813055-181813077 TCCATCCATATGTCTTAGGTAGG + Intergenic
918169411 1:181982160-181982182 TGAATCATTATCACCTAGGTCGG + Intergenic
919182344 1:194103093-194103115 TGCCTCTCTAGGACATAGGTTGG - Intergenic
924494461 1:244573549-244573571 TGCAACTACATGACCTAAGATGG + Intronic
1063970665 10:11379322-11379344 AGAATCTAAATGACCTACGTTGG - Intergenic
1073666110 10:105535551-105535573 TGCATCTAAATGACTTAAGTGGG - Intergenic
1079643692 11:22836853-22836875 TACATCTATAAGACCTATGAGGG - Intergenic
1080790673 11:35519923-35519945 TCCAGCTATATGACCTGGGCAGG + Intronic
1082845809 11:57724531-57724553 TGCATCTGTAAGACCTATGAGGG - Intronic
1085306828 11:75491023-75491045 TGCCTCTATGTGATGTAGGTAGG - Intronic
1086166058 11:83779898-83779920 TGCTTCTATCTCACCTAAGTTGG + Intronic
1087647211 11:100822069-100822091 TCCTTCCATAAGACCTAGGTAGG + Intronic
1092563733 12:9642913-9642935 TCCATCTATATGACAAAGGACGG + Intergenic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1094671842 12:32578322-32578344 TGGATCTATAGGACTTAAGTAGG + Intronic
1101027263 12:100623101-100623123 TGTTTCTGTATGAGCTAGGTGGG - Intronic
1103198856 12:119069916-119069938 GGTATCTATATGACCCTGGTAGG - Intronic
1105848831 13:24316697-24316719 TGCATCTATATGACCTAGGTTGG + Intronic
1107925462 13:45257047-45257069 TTCATCTATTTGCCATAGGTGGG - Intronic
1117713053 14:58552252-58552274 TGTTTTTATTTGACCTAGGTAGG + Intergenic
1118026154 14:61771031-61771053 TGTATCCATATGAGCTGGGTGGG - Intronic
1119477325 14:74938717-74938739 TGCTTCTAGATGAACTATGTTGG + Intergenic
1119480733 14:74956003-74956025 TTCATCTATATAACCTGGCTAGG - Intergenic
1126267373 15:46770302-46770324 TGCATCTTTAAGACCTACGAGGG + Intergenic
1127365899 15:58289987-58290009 TGCATCTGTATGACCTTCTTTGG - Intronic
1129882676 15:79017516-79017538 TGCATCTGTATCACCTAGCAAGG - Intronic
1133291651 16:4726413-4726435 TACAACTGTATGACCCAGGTGGG + Intronic
1133703587 16:8332361-8332383 TGCATGTAAATGAGCTAGGCAGG + Intergenic
1139406425 16:66722472-66722494 TGCATGAATTTGCCCTAGGTGGG + Exonic
1141773867 16:86109330-86109352 TGATTCCATATTACCTAGGTGGG + Intergenic
1149495358 17:57114070-57114092 TGAATCTATAAGACCCAGGGAGG - Intronic
1153136478 18:1923313-1923335 TGCATCTGTAAGACCTATGAGGG + Intergenic
1155324546 18:24652597-24652619 GGGATCTATATTACCCAGGTTGG - Intergenic
1155446424 18:25917421-25917443 TGCACATATATTACCTAGGAAGG - Intergenic
1156060626 18:33070956-33070978 TTCATCTTTATGACCTCTGTTGG - Intronic
1157179030 18:45479056-45479078 AGCATCTACCTGCCCTAGGTTGG + Intronic
1168034854 19:53711240-53711262 TGAATCCAAAAGACCTAGGTTGG - Intergenic
925507302 2:4582879-4582901 TACATTTGTATGGCCTAGGTGGG - Intergenic
925686060 2:6475164-6475186 TGAATCTAAATGAAGTAGGTTGG - Intergenic
935162984 2:100545248-100545270 TGCATCTCTAAGAGGTAGGTAGG - Intergenic
939403544 2:141727409-141727431 TGCAGCAATATGACACAGGTTGG + Intronic
940690174 2:156907520-156907542 TACATATATATGAGATAGGTAGG - Intergenic
941807051 2:169720068-169720090 TACATATATAATACCTAGGTAGG - Intronic
943295787 2:186136763-186136785 TGCATCTATATAACATTTGTTGG - Intergenic
943310719 2:186321286-186321308 TGCATCTTTATGAACTAGAAAGG + Intergenic
944621414 2:201519228-201519250 TGCATCTCAGTGGCCTAGGTTGG - Intronic
1174073013 20:47912061-47912083 TGACTCTAGATGACCTGGGTGGG - Intergenic
1179101219 21:38357054-38357076 TGCCTCTATATGAGGTAGGATGG + Intergenic
950089069 3:10282075-10282097 TGCTTCTTTCTGACCTATGTAGG + Intronic
950541016 3:13613021-13613043 TGGAGCTAGATGACCTAGGATGG + Intronic
952726377 3:36590378-36590400 TGCTTGTATAAGACTTAGGTGGG - Intergenic
954521060 3:51226989-51227011 TGCATCTAAATCACCAAGGTAGG - Intronic
955576930 3:60375804-60375826 TGCATCTATAGGATCTGGGAAGG - Intronic
955767390 3:62359281-62359303 AGCACCTGTATGACCTAGCTTGG + Intergenic
958088586 3:88846248-88846270 TGCAACTATATAATCTAAGTAGG - Intergenic
960470486 3:118059033-118059055 TACATTTATATTACCTAGGGAGG - Intergenic
970176098 4:13340916-13340938 GCCATCTATATGACCCATGTGGG + Intergenic
970425950 4:15946556-15946578 TGCCTCTATATGAGCTTTGTTGG + Intergenic
970879473 4:20911622-20911644 GACATCTTGATGACCTAGGTTGG + Intronic
972209294 4:36817742-36817764 TGAATCTAAATGGACTAGGTGGG + Intergenic
976691677 4:87874821-87874843 TGCTTCAAAATAACCTAGGTGGG + Intergenic
979770349 4:124516751-124516773 TGAGACTATATGGCCTAGGTAGG - Intergenic
984121867 4:175755784-175755806 TTCATTCATTTGACCTAGGTAGG - Intronic
987851525 5:23361665-23361687 TGCATCAGCATGACCTAGATGGG - Intergenic
988017045 5:25572499-25572521 TGCATCTGTAAGACCTATGAAGG - Intergenic
990796531 5:59548458-59548480 TGAATCTTTAGAACCTAGGTGGG - Intronic
1001079978 5:168660595-168660617 TGCATTTATCTGAAATAGGTAGG - Intergenic
1009311933 6:62165728-62165750 AGGGTCTATATTACCTAGGTTGG + Intronic
1015704962 6:136077863-136077885 TGCATCTACATGAGCTGGATTGG - Intronic
1016649535 6:146448175-146448197 TGCATCAGTGTGACCTGGGTAGG - Intergenic
1017684586 6:156899147-156899169 GGCATCTATATGACTTAGGAAGG + Intronic
1019928773 7:4209964-4209986 TGTATGTATATGATCTATGTAGG + Intronic
1020890153 7:13868633-13868655 TGCATCTAGATGACAAAGATAGG + Intergenic
1022005010 7:26259656-26259678 TGCATCTGTAAGACCTATGAGGG + Intergenic
1027753991 7:82186667-82186689 TCCATCTATGTTACCTAGCTAGG - Intronic
1028193565 7:87878970-87878992 TCATTCTATATGGCCTAGGTTGG + Intronic
1028655929 7:93207070-93207092 TGCATCAAGATCACCTAGGGAGG - Intronic
1031865178 7:127030755-127030777 TGCATCTATTTAACCTATTTCGG + Intronic
1036653440 8:10660659-10660681 TGCATCGTTATGAGCCAGGTCGG - Intronic
1041528914 8:58840459-58840481 GGCATATATATGACCTAGAATGG + Intronic
1044012921 8:87017066-87017088 TGCATCTGTATGACCTATGGGGG - Intronic
1045347369 8:101305116-101305138 TGCACCTTCATGCCCTAGGTGGG + Intergenic
1046300866 8:112286850-112286872 TGCATATATATGACCAATGAGGG + Intronic
1050791112 9:9471129-9471151 TGCAACTATAGGACCAAGGAAGG - Intronic
1192025089 X:67441659-67441681 TGCTTCTCTGTGACCTTGGTGGG + Intergenic
1193709227 X:84859220-84859242 TGCATCTGTAAGACCTATGAGGG + Intergenic
1196822933 X:119717630-119717652 TGCATCTATCTTAGCTAGTTTGG - Intergenic
1202019875 Y:20453086-20453108 TGCACCTATGTGACCTGGATGGG + Intergenic