ID: 1105849264

View in Genome Browser
Species Human (GRCh38)
Location 13:24319873-24319895
Sequence GTTCCCTCACATATGGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105849264_1105849269 25 Left 1105849264 13:24319873-24319895 CCTAGTTCCATATGTGAGGGAAC 0: 1
1: 0
2: 2
3: 4
4: 117
Right 1105849269 13:24319921-24319943 CTGACGTCCTGTGTGCATATGGG 0: 2
1: 0
2: 0
3: 4
4: 71
1105849264_1105849270 26 Left 1105849264 13:24319873-24319895 CCTAGTTCCATATGTGAGGGAAC 0: 1
1: 0
2: 2
3: 4
4: 117
Right 1105849270 13:24319922-24319944 TGACGTCCTGTGTGCATATGGGG 0: 2
1: 0
2: 0
3: 8
4: 107
1105849264_1105849268 24 Left 1105849264 13:24319873-24319895 CCTAGTTCCATATGTGAGGGAAC 0: 1
1: 0
2: 2
3: 4
4: 117
Right 1105849268 13:24319920-24319942 TCTGACGTCCTGTGTGCATATGG 0: 2
1: 0
2: 0
3: 3
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105849264 Original CRISPR GTTCCCTCACATATGGAACT AGG (reversed) Intronic
901160132 1:7170897-7170919 GTTCCAGCAAATATGGAACATGG + Intronic
905197815 1:36294895-36294917 GTTTCCTAACAGAGGGAACTGGG - Intronic
905499802 1:38427416-38427438 GGTCCCACACAGATGGAACACGG - Intergenic
906519052 1:46456624-46456646 CCTCGCTCCCATATGGAACTTGG - Intergenic
907899191 1:58721827-58721849 GTACCATCACATTGGGAACTGGG + Intergenic
911071095 1:93832395-93832417 GGTCCCGCACAGATGGAACATGG - Intronic
916941813 1:169685202-169685224 GGTCCCACACAGATGGAACATGG - Intronic
920901507 1:210114188-210114210 GGTCCCTCACAGATGGGACATGG + Intronic
924729805 1:246700765-246700787 GTCACCTCACTTATGGAATTTGG + Intergenic
1063319733 10:5041457-5041479 GTTCCCTCCCACATGGAAACAGG - Intronic
1064367230 10:14718943-14718965 GTTTCCTCATCTATAGAACTGGG - Intronic
1066102562 10:32130863-32130885 CTTCCCTCACCTCTGGACCTGGG - Intergenic
1071509450 10:86252029-86252051 GTTTCCTCATGTATGGAACGGGG - Intronic
1072550853 10:96476160-96476182 CTTCCCACACATTTGGAAGTAGG + Intronic
1078338633 11:10483461-10483483 CTTCCCTCAGATAGGGAAATAGG - Intronic
1078970344 11:16402976-16402998 GTTCCCTCACAGATGGAAGTTGG + Intronic
1079690672 11:23413066-23413088 GTTTCCTCATATATTGAATTAGG + Intergenic
1080047450 11:27823917-27823939 GTTCTCTCACCTATAAAACTGGG - Intergenic
1085809921 11:79670660-79670682 GTTCCCTCATATCTGGAGCAGGG + Intergenic
1087109065 11:94443519-94443541 GTTCCCTCACATATAAAACAGGG + Intronic
1099295996 12:80828632-80828654 GTTTCCTCATATATGAAATTGGG - Intronic
1099689696 12:85937296-85937318 GGTTCTTCAGATATGGAACTTGG + Intergenic
1100883368 12:99042429-99042451 GCTCCCTCACATCTGGCAGTTGG - Intronic
1105799782 13:23893159-23893181 GTTCCCTCACCTACGGAACTGGG + Intronic
1105849264 13:24319873-24319895 GTTCCCTCACATATGGAACTAGG - Intronic
1116721431 14:48501304-48501326 ATTTCCTCACATATGTAATTAGG - Intergenic
1120438030 14:84503582-84503604 GTTCCCGCACAGATGGGACGCGG + Intergenic
1125165370 15:36697764-36697786 TTTGTCTCATATATGGAACTGGG + Intronic
1128593485 15:68923809-68923831 GTTTTCTCACCTGTGGAACTGGG + Intronic
1128846092 15:70896596-70896618 GTTCCTTCACATTTGAATCTTGG + Intronic
1129647237 15:77447614-77447636 GTACCATCACATAAGGAATTTGG + Intronic
1130060741 15:80568131-80568153 GTTCCATCAAATATGGAATGAGG + Intronic
1133117301 16:3584709-3584731 TTTCCCTCCCATAAGTAACTGGG - Intronic
1134041849 16:11075161-11075183 CTTCCCACACATTTGGAAATGGG + Intronic
1140758231 16:78088187-78088209 GTTTCCTCATCTATGAAACTTGG + Intergenic
1147955336 17:44130513-44130535 GTTCCCTAACACAAGGAACAGGG + Intergenic
1149220527 17:54411793-54411815 GGTCCCTCACAGATGGGACATGG - Intergenic
1151424594 17:74022698-74022720 GGTCCCTCACATATAAAAGTAGG + Intergenic
1155473059 18:26210470-26210492 ATTCACTCTCATCTGGAACTGGG + Intergenic
1156444144 18:37222260-37222282 GTTTCCTCACATACTGATCTAGG + Exonic
1157906367 18:51573412-51573434 GGTCCCACACAGATGGAACGCGG + Intergenic
1158066615 18:53418098-53418120 ATTCTGTCACATATGTAACTTGG + Intronic
1158783893 18:60685489-60685511 GTCCCCTGACATCTGGAACCTGG + Intergenic
1163300234 19:16440897-16440919 GTTTCCGCAGATATGGGACTTGG - Exonic
1163405780 19:17121394-17121416 GTTCCCTCACTTATGGTAGTGGG - Intronic
1165522274 19:36323974-36323996 GTTCCCTCACATCTGATACCTGG - Intergenic
1168148346 19:54431635-54431657 GTTCCCTCACTTATAAACCTGGG + Intronic
925237651 2:2293493-2293515 GTTCCCACACAGGTGGAGCTGGG + Intronic
925544574 2:5003316-5003338 GTTCCCACACAGATGGGACACGG - Intergenic
925828797 2:7876035-7876057 GGTCCCACACAGATGGGACTCGG + Intergenic
932012171 2:67989444-67989466 GTACCATCACATTTGGAATTGGG + Intergenic
933137956 2:78760234-78760256 GGTCCCTCACAGATGGGACATGG - Intergenic
933191504 2:79338904-79338926 ATTCCCTGAGATATGGACCTTGG + Intronic
939725770 2:145719618-145719640 GAACCCTCACAGATGGAATTAGG - Intergenic
940726418 2:157341478-157341500 GTTCCCACACAGATGGGACATGG + Intergenic
943520799 2:188946588-188946610 ATTTCCTCACTTATGAAACTGGG + Intergenic
947472315 2:230411207-230411229 GTCACCTGACATATGGAACCAGG - Intergenic
1170278960 20:14624690-14624712 GGTCCCTCACATGTGGAAAGGGG - Intronic
1171796904 20:29573420-29573442 GTCCCCTCATATCTTGAACTTGG + Intergenic
1172009814 20:31840026-31840048 GTTCCCACACTTCTGGTACTAGG - Intergenic
1172037475 20:32019836-32019858 GTTACTTCACCTATGGATCTCGG - Intronic
1185370921 22:50460521-50460543 CTTCCCTCAGGTATGGATCTGGG - Exonic
949588951 3:5473271-5473293 GTGCCCTCATAGATAGAACTGGG + Intergenic
951800547 3:26590856-26590878 GTTCCCTCCCATATTATACTAGG + Intergenic
955600908 3:60644070-60644092 TTTCCCTCACATATCTAACTAGG + Intronic
958732870 3:97977502-97977524 GTTTCCTCACATGTAAAACTTGG - Intergenic
958867974 3:99523469-99523491 ATTCCCTAACATATGGAAGAGGG + Intergenic
959352324 3:105281464-105281486 GGCCCCTGAAATATGGAACTTGG + Intergenic
959956161 3:112240319-112240341 GTTTCCTCATATATCAAACTGGG - Intronic
961893694 3:130150513-130150535 GGTCCCACACATATGGGACATGG + Intergenic
967544341 3:190706772-190706794 GATGCCTCACCTATGGTACTTGG + Intergenic
970689695 4:18608354-18608376 GTTCCTTCACACATGGAAACTGG - Intergenic
971003918 4:22352428-22352450 GTTTCCTCACAGTTGCAACTGGG - Intronic
972357327 4:38292328-38292350 GTCTCCTCACATTAGGAACTAGG + Intergenic
974091535 4:57316383-57316405 GTTCCCTCATCTATAGAACGGGG - Intergenic
977511865 4:97972145-97972167 TTTCCTTAACATATGGAACATGG + Intronic
979230478 4:118343437-118343459 TTTCCTTCACATATGGAATATGG - Intronic
981137945 4:141234782-141234804 GTTTTCACACATATGGAAATAGG + Intergenic
983431287 4:167654882-167654904 GTATCCTCACATATTGAACATGG - Intergenic
983495167 4:168435265-168435287 GTTCCCTGACCTGTGGAACGAGG + Intronic
986710656 5:10486013-10486035 GTTCCATCTCAGATGGAGCTGGG + Intergenic
987034210 5:14003983-14004005 GTTTCCTGACCTATGGAAATCGG + Intergenic
988501037 5:31783980-31784002 GTTCCCTCATCTGTGGCACTGGG + Intronic
989695732 5:44198701-44198723 GTTTCCTCACGTATAAAACTGGG + Intergenic
990140618 5:52698998-52699020 GTTCCCACACATATGAAACCAGG - Intergenic
990770855 5:59243286-59243308 TTTGTCTCTCATATGGAACTGGG + Intronic
992109998 5:73483986-73484008 GTTCCCTGACCTATAGAACGGGG - Intergenic
993414723 5:87612346-87612368 TTTACCTCCCATATGCAACTGGG + Intergenic
994324895 5:98436899-98436921 GGTCCTGCACAGATGGAACTTGG - Intergenic
995077888 5:108008961-108008983 CTTTCCTCACATATGGCTCTAGG - Intronic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
996311644 5:122112950-122112972 TGTCCCTCACATGGGGAACTTGG + Intergenic
1001410582 5:171508766-171508788 GTTTCCTCACCTATACAACTGGG - Intergenic
1001446779 5:171791325-171791347 GTTTCCTCACATATAAAAATCGG + Intronic
1004283501 6:14300329-14300351 GTTCCCACACAGATGGGACGCGG + Intergenic
1004575241 6:16888289-16888311 GGTCCCGCACAGATGGGACTTGG - Intergenic
1005622475 6:27632724-27632746 GTTCCCTGACCTATGGAATGAGG - Intergenic
1006756498 6:36420540-36420562 GTTGCCTAAGATAGGGAACTGGG + Intronic
1007489932 6:42212331-42212353 GTTTCCTCACATATGAAAGAGGG + Intronic
1008246441 6:49179705-49179727 TTTTCCTCATATATGGAACATGG - Intergenic
1013905946 6:115219951-115219973 GTTTCCTCACATTTGAAAATGGG - Intergenic
1017985251 6:159437807-159437829 GCTCACTCACAAATGGACCTCGG - Intergenic
1020532694 7:9356797-9356819 GGTCCCGCACAGATGGAACGCGG + Intergenic
1021651182 7:22835294-22835316 GTTCCCTCACCTGTGACACTGGG + Intergenic
1025887275 7:65608807-65608829 TTTCCATCACAGTTGGAACTTGG + Intergenic
1026016943 7:66679062-66679084 GTTCCCTCCCATATTGACGTTGG + Intronic
1031777365 7:125919946-125919968 GGTCCCACACAGATGGGACTTGG - Intergenic
1031855134 7:126913124-126913146 TTTCCATCACAGTTGGAACTTGG - Intronic
1038165591 8:25082467-25082489 TCTCCCTCACATTTTGAACTAGG - Intergenic
1043911015 8:85864145-85864167 GTTCTCTCACATATTTAAATTGG - Intergenic
1045309251 8:100986331-100986353 GATCCCTCCCTCATGGAACTTGG + Intergenic
1047993802 8:130314423-130314445 GTTCCCTCTCATCTGTAACATGG - Intronic
1048516533 8:135116569-135116591 GTTGCTTCACATTTGGAAATGGG + Intergenic
1056757016 9:89388210-89388232 CTTCCCTCACATGGGGAAATGGG - Intronic
1057694380 9:97312841-97312863 GTTTCCTCACATGTGAAACGAGG + Intronic
1057899293 9:98935601-98935623 GTGCCCACACATAAGCAACTTGG - Intergenic
1058171376 9:101685186-101685208 TTTCCCTTACATATGGCATTTGG + Intronic
1059570260 9:115426713-115426735 GTTACCTCACATGTGAAAATGGG + Intergenic
1186444154 X:9611830-9611852 GTTCCCTCACATATAAAATGGGG - Intronic
1188902421 X:35750395-35750417 GTTCCCTGACATGTGGAATAAGG - Intergenic
1190809816 X:53872304-53872326 GTTCCCTGATATGTGGAGCTAGG + Intergenic
1196855104 X:119975353-119975375 GTTTCCTCCCATATTGAATTAGG + Intergenic
1198036778 X:132808742-132808764 CGTCCCACACATATGGAATTGGG - Intronic
1200289347 X:154857063-154857085 GTTCCCTGACCTATGGAGCAGGG + Intronic