ID: 1105849715

View in Genome Browser
Species Human (GRCh38)
Location 13:24323182-24323204
Sequence TCTTGGCAGGCACTGTGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 283}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105849715_1105849726 18 Left 1105849715 13:24323182-24323204 CCCCACCACAGTGCCTGCCAAGA 0: 1
1: 0
2: 3
3: 41
4: 283
Right 1105849726 13:24323223-24323245 CAACCACAGCCACCTGAAGCTGG 0: 1
1: 0
2: 0
3: 34
4: 281
1105849715_1105849729 27 Left 1105849715 13:24323182-24323204 CCCCACCACAGTGCCTGCCAAGA 0: 1
1: 0
2: 3
3: 41
4: 283
Right 1105849729 13:24323232-24323254 CCACCTGAAGCTGGTCCCCACGG 0: 1
1: 0
2: 0
3: 20
4: 202
1105849715_1105849730 28 Left 1105849715 13:24323182-24323204 CCCCACCACAGTGCCTGCCAAGA 0: 1
1: 0
2: 3
3: 41
4: 283
Right 1105849730 13:24323233-24323255 CACCTGAAGCTGGTCCCCACGGG 0: 1
1: 0
2: 1
3: 7
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105849715 Original CRISPR TCTTGGCAGGCACTGTGGTG GGG (reversed) Intergenic
900630900 1:3634635-3634657 TCGTGCCAGGCACTGTGCTCTGG - Intronic
901217044 1:7560798-7560820 TCGGGGCAGGCACTCAGGTGGGG + Intronic
902192795 1:14775311-14775333 TCTAGGCAGTCACTGTGCTAAGG + Intronic
903140755 1:21337897-21337919 TCTGAGCAGGCAGTGTGGGGAGG - Intronic
903834406 1:26193602-26193624 GCGTGCCAGGCACTGTGCTGGGG - Intronic
904523294 1:31112768-31112790 CCTTGTCAGGCAGTGGGGTGGGG + Intergenic
904623971 1:31791783-31791805 CCTTGAGAGGCAGTGTGGTGTGG + Intronic
905924134 1:41737919-41737941 ACTTGCCAGGCCCTGTGCTGGGG + Intronic
906114948 1:43350201-43350223 TTTTGGCAGGCACTGTGCTAAGG - Intronic
907372739 1:54013785-54013807 TGAAGGCAGGCACTGTGTTGGGG + Intronic
909489261 1:76208136-76208158 TCTTGGTAGGCCCTGAGATGAGG - Intronic
910239276 1:85069008-85069030 TCATGCTATGCACTGTGGTGTGG - Intronic
910399296 1:86822611-86822633 TCCTAACAGGCACTGTGGTCCGG + Intergenic
910445399 1:87294698-87294720 ACCAGGCAGGGACTGTGGTGGGG + Intergenic
911088049 1:93995968-93995990 ACTTGGTAGGGACCGTGGTGTGG + Intronic
912626845 1:111212594-111212616 ACTTAGCAGGAACAGTGGTGGGG - Intronic
912798061 1:112704853-112704875 TCTTCTCAGTCACTGTGCTGTGG - Intronic
914841803 1:151254787-151254809 TGTTGGAAAGCACTATGGTGTGG + Exonic
915443543 1:155961748-155961770 CCTTGCCAGGCACTGGGGTTTGG + Exonic
915553623 1:156649017-156649039 TCTGGGCATGCCCTCTGGTGTGG + Intronic
916647277 1:166797953-166797975 ACTTGGCAGGGCTTGTGGTGGGG - Intergenic
919642187 1:200056496-200056518 GATTGGCAGGGACTGGGGTGGGG - Intronic
920092627 1:203465141-203465163 TCTTGGGAGGCACTCTGGGGTGG - Intergenic
920516340 1:206587175-206587197 CCTTGGCAGAATCTGTGGTGGGG - Exonic
923078674 1:230633238-230633260 TCTTGACAACCACTGTGGAGAGG + Intergenic
923085821 1:230703108-230703130 CCTTGCCAGGCACTGTGTTCTGG + Exonic
923646849 1:235831236-235831258 TCTCAGCAGGGACTGTGGGGAGG - Intronic
1064935807 10:20677968-20677990 TATTGACAGGCACTGTGGATAGG - Intergenic
1066307023 10:34155322-34155344 TCTTTGCTGGCATTTTGGTGGGG - Intronic
1067412133 10:46074368-46074390 ACTTGGCCAGCACTGTGGTTCGG - Intergenic
1067832908 10:49620668-49620690 TCTTTGCTGGCACTGGGGTAAGG - Intronic
1068570296 10:58620720-58620742 TATTAGCAGGCACTGAGCTGTGG + Intronic
1069708898 10:70476748-70476770 ACGTGCCAGGCACTGTGCTGTGG + Intergenic
1070405914 10:76094828-76094850 TCTGGGCGGGCACTGGGGGGTGG - Intronic
1070645699 10:78200770-78200792 TCTTGGCTGGCACAGAGCTGTGG + Intergenic
1072296675 10:94015114-94015136 TCTTCACAGGAACTGCGGTGAGG - Intronic
1073354838 10:102845531-102845553 TCAGGGCATGCACTGTGGTCGGG + Intergenic
1074450598 10:113556375-113556397 TCTTGGCTGGCACCATGGAGAGG + Intronic
1075344582 10:121672919-121672941 CCATGGGAGGCGCTGTGGTGGGG + Intergenic
1076157668 10:128216055-128216077 TCTTGGCACACACAGTGGAGGGG + Intergenic
1076271042 10:129152445-129152467 TCGTGGCATGCTCTGTGGTGGGG + Intergenic
1076778679 10:132711835-132711857 GATTGGCAGGCACTGAGGTCTGG + Intronic
1077093100 11:788393-788415 TCTTGGCAGGTGCCGTGGTGGGG + Exonic
1077443368 11:2578910-2578932 GCTGGGCAGTCACTGTGCTGAGG - Intronic
1077554142 11:3217911-3217933 TCCTGGCAGGCCCTGTGGGCGGG + Intergenic
1077720066 11:4619269-4619291 TCTATGAAGGCACTGTGGTCAGG + Intergenic
1078742189 11:14077261-14077283 TCTCCCCAGGCACTGTGGTGTGG - Intronic
1081232706 11:40605782-40605804 TAGTGGCAGGAACTATGGTGAGG - Intronic
1083581216 11:63826793-63826815 TCATGCCAGGCACTGGGCTGTGG + Intronic
1084388309 11:68858345-68858367 TTTCGGCAGGCACTCTGGTCAGG - Intergenic
1087076595 11:94131580-94131602 GGTTGGCAGGCACTTGGGTGAGG + Intronic
1088662245 11:112059371-112059393 TCTTGGCAGGCGGTGGGGTCAGG + Intronic
1089268707 11:117286081-117286103 TCCAGACAGGCACTGGGGTGAGG + Exonic
1089577906 11:119459794-119459816 TCATGGCAGTCTTTGTGGTGCGG + Intergenic
1090419991 11:126568080-126568102 TAATGGCAGGCAGTTTGGTGTGG + Intronic
1091845104 12:3649712-3649734 CCATGCCAGGCACTGTGTTGAGG - Intronic
1095947665 12:47763023-47763045 TCATGCCAGACACTGTGCTGGGG - Intronic
1096069352 12:48766377-48766399 GCATGGCTGGCACTGTGGTACGG + Exonic
1098634002 12:72758180-72758202 CCTTGTCAGGCAGTGTGTTGTGG - Intergenic
1099058625 12:77877772-77877794 TATTGGAAGTGACTGTGGTGTGG + Intronic
1099195514 12:79610083-79610105 CCTAGCCAGGCACTTTGGTGTGG - Intronic
1099503889 12:83448241-83448263 TCTTGCCAGGCACTGTTCTAGGG + Intergenic
1101004469 12:100388247-100388269 TGTTGGATGGCAGTGTGGTGGGG - Intronic
1102389057 12:112535051-112535073 TGCTGGCAGGCACTGTTGTCAGG + Intergenic
1102762582 12:115401354-115401376 CTCTGGCAGGCACTGTGCTGGGG - Intergenic
1102811475 12:115827855-115827877 TCTTGGCAGGGACTGTTAAGAGG - Intergenic
1103845632 12:123900365-123900387 TCATGGCAGCCACCGTGGTAGGG + Intronic
1104573236 12:129943857-129943879 TCTTGGTAGGAACTGTTTTGAGG - Intergenic
1105849715 13:24323182-24323204 TCTTGGCAGGCACTGTGGTGGGG - Intergenic
1106628125 13:31441944-31441966 CCTTGGCAGGCACTGTGTGCAGG + Intergenic
1107708270 13:43128156-43128178 ACTTCTCAGGCACTGTGGTGAGG - Intergenic
1107823353 13:44305946-44305968 TCTTTCCAGGGGCTGTGGTGAGG - Intergenic
1108046676 13:46389971-46389993 TCTTGGAGGGCACTGTGATCTGG - Intronic
1108268917 13:48739345-48739367 ACTTGGCAGACATTATGGTGTGG - Intergenic
1112005806 13:95252750-95252772 TTTAGGCAGCCACTGAGGTGAGG + Intronic
1112275360 13:98012925-98012947 TCTTGCCAGGCACAGTGCTCAGG - Intronic
1112716981 13:102198211-102198233 TCTTGCCTAGCACTGTGCTGTGG - Intronic
1114137563 14:19869021-19869043 TCTATGCAGCCACTGTGCTGGGG - Intergenic
1115483838 14:33889091-33889113 TCTGGGCAGGCTCTATGGTGGGG - Intergenic
1115607065 14:35013898-35013920 TCTTGGTATGTACAGTGGTGGGG + Exonic
1115790241 14:36869910-36869932 TCTTAGCAGATAATGTGGTGGGG - Intronic
1117000164 14:51364029-51364051 TCCTGGCAGCAAGTGTGGTGAGG + Intergenic
1118478083 14:66137263-66137285 TCTTGGCTGGCACTGATGTGTGG - Intergenic
1118979879 14:70707672-70707694 TCTCAGGAGGCAGTGTGGTGTGG - Intergenic
1119442826 14:74640086-74640108 TCTTGCCAGGCACTGGGTTACGG - Intergenic
1119903666 14:78282577-78282599 CCCTGGCAGGCACTGTGGGAGGG + Intronic
1120646870 14:87084838-87084860 TATTGGAAGGCAGTGTAGTGAGG + Intergenic
1121176945 14:91897576-91897598 ACTTGGCAGGCACAGTTGTGTGG - Intronic
1121436980 14:93926781-93926803 TCCTGGCAGGGAGGGTGGTGGGG + Intronic
1122352367 14:101103542-101103564 GCTGGACAGGCTCTGTGGTGAGG - Intergenic
1122839671 14:104451137-104451159 TCTTGGCAGGCGCCATGGTGGGG - Intergenic
1123088652 14:105731620-105731642 GCGTGGCAGGCATTGTTGTGTGG + Intergenic
1123125353 14:105941953-105941975 TCTTGAGAGGGCCTGTGGTGTGG + Intergenic
1123920848 15:25068691-25068713 TCTTGGCATGCATTGTTGGGTGG + Intergenic
1129328612 15:74815400-74815422 TCTTGGCAGGAACTGGGGGCAGG - Intronic
1130135546 15:81178878-81178900 TCTCGGCAGCCCATGTGGTGAGG - Intronic
1130387426 15:83423879-83423901 TCTTGGCAGCCTCAGGGGTGAGG + Intergenic
1130925060 15:88379160-88379182 ACTTGCCAGGCACTGTGCTATGG - Intergenic
1130938823 15:88491203-88491225 GCATGGCAGTCACTGTGCTGGGG + Intergenic
1131403770 15:92147004-92147026 TCTCAGCAGGGACGGTGGTGAGG - Exonic
1131519849 15:93106026-93106048 GCTTGGCTGGCCCTGTGATGTGG - Intergenic
1132481063 16:166305-166327 TCCTGGCAGGCGCTCAGGTGCGG - Exonic
1132579325 16:677865-677887 ACCTGGCAGGCGCGGTGGTGGGG + Exonic
1132872952 16:2123781-2123803 TCATAGCAGGAACTGGGGTGAGG - Intronic
1132931452 16:2461048-2461070 CCTTGGCAGGCACCGTGGTCTGG - Exonic
1136651850 16:31679684-31679706 TCTTTGCAGGCTCTGAGCTGGGG + Intergenic
1137522628 16:49208085-49208107 TTGTGCCAGGCACTGTGCTGAGG + Intergenic
1137584843 16:49658271-49658293 TCTGGCCAGGCACGGTGCTGGGG - Intronic
1138344890 16:56314594-56314616 TCTTGGCATGCATGGTGGTAGGG + Intronic
1141517278 16:84553997-84554019 TCTTGGCAGGCAAGGTTGTGCGG - Intronic
1142042663 16:87905093-87905115 TCTGGGCAGGCGCTGGGCTGGGG - Intronic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1142931248 17:3285638-3285660 ATTTGTCAGGCACAGTGGTGCGG + Intergenic
1143028341 17:3953795-3953817 TCTGGGCGGGCACGGTGGGGAGG - Intronic
1145116263 17:20213336-20213358 CTTTGGGAGGCACTGAGGTGTGG - Intronic
1145302179 17:21648404-21648426 GCTTTGGAGGCAGTGTGGTGGGG + Intergenic
1145348134 17:22054912-22054934 GCTTTGGAGGCAGTGTGGTGGGG - Intergenic
1145889979 17:28407478-28407500 ACGTGCCAGGCACTGTGCTGGGG + Intergenic
1145902386 17:28497217-28497239 GCTTGGCAGGCACTGGGCTGTGG - Exonic
1145923884 17:28631665-28631687 TCTCAGCAGGCACAGTGATGCGG - Exonic
1146894502 17:36531847-36531869 TGTTGCCAGGCACTGGGCTGAGG - Intronic
1147128893 17:38394185-38394207 TATTAGCAGGCTCTGTGCTGGGG - Intronic
1147213755 17:38887259-38887281 TATGGGCAGGGGCTGTGGTGAGG - Intronic
1147689320 17:42305797-42305819 TCTGGGCTGGCCCTGGGGTGAGG - Intronic
1148031956 17:44627917-44627939 TCTGGGCAGGCTCTGTGGGTGGG - Intergenic
1148075402 17:44932702-44932724 TCCTGGGAGGTCCTGTGGTGGGG + Exonic
1148402121 17:47373578-47373600 TCTGGGCAGGCTGTTTGGTGTGG + Intronic
1148506304 17:48130162-48130184 TAGTGGCAGGCAGTGAGGTGGGG + Intergenic
1148847509 17:50538008-50538030 TCCTGGCAGGCAGAGGGGTGTGG + Intronic
1149318556 17:55461462-55461484 GATTGCCAGGGACTGTGGTGGGG + Intergenic
1149553898 17:57559598-57559620 ACCAGGCAGGCACTGGGGTGAGG + Intronic
1150603509 17:66671288-66671310 TCTTGGCTGCCTCTGTCGTGTGG - Intronic
1151267413 17:72967480-72967502 CCTGGGCGGGCACTCTGGTGTGG - Intronic
1151363953 17:73605161-73605183 TGTGGGCAGGCAATGAGGTGGGG + Intronic
1151701088 17:75742942-75742964 ACCAGGCAGGCACTGTGGCGAGG - Intronic
1151769018 17:76147595-76147617 TCTTGGTATGCTCTGTGGTGAGG + Intronic
1152774074 17:82188933-82188955 TTTTGCCAGGCAAAGTGGTGTGG - Intronic
1153263425 18:3246000-3246022 CATTGCCAAGCACTGTGGTGGGG - Intergenic
1154437296 18:14356931-14356953 ACTTGGCAGGGCGTGTGGTGGGG + Intergenic
1156868653 18:41917557-41917579 TATTGACAGGCTCTGTGGTGGGG + Intergenic
1157490384 18:48119762-48119784 GCCTGGCAGACACTTTGGTGAGG + Intronic
1157902112 18:51528393-51528415 TCTTGGAAGGCACTGAGGCATGG + Intergenic
1158428977 18:57366561-57366583 CCTTTGCAGGCACTGTTTTGTGG - Exonic
1160794531 19:938779-938801 GCCTGGCAGGCACCGTGGTGAGG - Intronic
1161588698 19:5118931-5118953 CCCTGGCAGGCCCTGGGGTGTGG + Intronic
1161673176 19:5625663-5625685 TGATGCCAGGCACTGTGCTGAGG + Intronic
1161818688 19:6516137-6516159 TATTGGGAGGAACTGTGGCGTGG + Intergenic
1161963671 19:7536041-7536063 TCTTGGGAGGCTGTATGGTGGGG + Intronic
1162478746 19:10915902-10915924 CCTAGGCAGTCCCTGTGGTGTGG + Intronic
1163786100 19:19275666-19275688 TCTTGGCACACACTGTGGCCTGG + Intergenic
1164708233 19:30335993-30336015 TCTTGGCAAAGACTGGGGTGAGG + Intronic
1166756632 19:45196475-45196497 CCTTGGCAGGCTCAGTGCTGTGG - Intronic
1167732013 19:51265357-51265379 GCTTAGCAGGTACTGTGGGGAGG - Exonic
1167945001 19:52981094-52981116 TCTTGGCATGATCTCTGGTGTGG - Intergenic
925092234 2:1164786-1164808 TGTTGGCAGGCTCTGTGTAGAGG + Intronic
926119439 2:10234281-10234303 GCCTGGCAAGCACAGTGGTGGGG + Intergenic
926928392 2:18011637-18011659 TCCTGGAAGGCAATGTAGTGTGG + Intronic
927271625 2:21216345-21216367 TTTTGCCAGGCACTGTGCTAAGG + Intergenic
927962847 2:27251260-27251282 TTGTGCAAGGCACTGTGGTGCGG - Intergenic
928613803 2:33016661-33016683 TCCTGGCCAGCACTGTGCTGTGG - Intronic
932978111 2:76629329-76629351 TCTGGGAAGCCAGTGTGGTGTGG + Intergenic
933123431 2:78572051-78572073 TCTTGGCATCCATTCTGGTGTGG - Intergenic
933892884 2:86787791-86787813 TCTAGTCAGGCACTGTGATAGGG - Intronic
935336505 2:102021789-102021811 TTGTGGCAGGCACTTTGGAGAGG + Intronic
937301786 2:120847210-120847232 GCTCAGCAGGCACTGTGCTGAGG + Intronic
937331577 2:121033806-121033828 TCTTGGCTGGCAGTGTGCTCTGG - Intergenic
937750567 2:125472160-125472182 CCAGGGCAGCCACTGTGGTGAGG - Intergenic
938139271 2:128783041-128783063 TCATGACAGGCAGTGTGGAGAGG - Intergenic
938195882 2:129327458-129327480 TCTCGGCAGCCACTGTGCTGGGG - Intergenic
939326466 2:140696347-140696369 TCTTGGCAGGAGGTGGGGTGTGG + Intronic
939774915 2:146372940-146372962 TCTTGGCTAGCTCTATGGTGAGG + Intergenic
942351539 2:175058042-175058064 TTTGGGCAGGCACTGCGTTGGGG + Intergenic
943491621 2:188561324-188561346 CCTAAGCAGGCACTGTGGTATGG + Intronic
943569458 2:189556038-189556060 TCTGGGCAGGGGTTGTGGTGGGG + Intergenic
944949648 2:204732965-204732987 TCATGGCAGGCACTCTGCTAGGG - Intronic
945406167 2:209451472-209451494 TCCTGGCAGTAGCTGTGGTGGGG + Intronic
946227526 2:218272127-218272149 GCTTGGGAGGCACTTTGGTATGG - Intronic
947652779 2:231801364-231801386 TCTGAGGAAGCACTGTGGTGGGG + Intronic
948462967 2:238139088-238139110 CCTGGGCAGGCACTGGGGTGAGG + Intronic
1168832624 20:855029-855051 TATTAGCAGACACTGAGGTGGGG - Intronic
1169197335 20:3690253-3690275 TCTTGGGAGGGTCTGTGGGGAGG + Exonic
1169383460 20:5127784-5127806 TCTTGGCGGGGACAGTGGCGGGG + Intronic
1170225761 20:13990601-13990623 TCTTCTCAGGGACTGTGGTGGGG + Exonic
1170703740 20:18727075-18727097 CCTTGGCAGGTGCTGTGGTGAGG + Intronic
1170903379 20:20488023-20488045 TTTTGGCATGCACAGGGGTGGGG - Intronic
1171518766 20:25759831-25759853 GCTTTGGAGGCACTATGGTGGGG + Intergenic
1171558090 20:26096379-26096401 GCTTTGGAGGCACTGTGGTGGGG - Intergenic
1172148374 20:32773431-32773453 TCTTGATTGGCCCTGTGGTGTGG + Intronic
1172789167 20:37490679-37490701 CCTTGGCAGGAACTGTTTTGGGG - Intergenic
1175414072 20:58789991-58790013 CCGTGGTAGGCACTGTGGGGGGG + Intergenic
1179158410 21:38872272-38872294 TACAGGCATGCACTGTGGTGTGG + Intergenic
1179564733 21:42240161-42240183 GCGTGGCAGGCACCGTGGTCTGG - Intronic
1180211122 21:46295915-46295937 TCTGGGCCAGCACTGTGCTGGGG - Intronic
1183251979 22:36736844-36736866 TGGTGCCAGGCACTGTGCTGGGG - Intergenic
1183605251 22:38864052-38864074 GCATCGCAGGCACTGTGGAGAGG - Exonic
1184105019 22:42362430-42362452 TCTTGGGTGGCACTGTGGAGGGG + Intergenic
1184130662 22:42514832-42514854 GCCTGGCAGGCCCTGGGGTGGGG - Intronic
1184140841 22:42576662-42576684 GCCTGGCAGGCCCTGGGGTGGGG - Intergenic
1184683811 22:46086928-46086950 TCTGTGCAGGCACAGTCGTGGGG - Intronic
1184813298 22:46852031-46852053 GCTTCGTGGGCACTGTGGTGGGG + Intronic
1184817254 22:46881638-46881660 TCTTGGCAGGCTCTTGGGAGGGG + Intronic
949800501 3:7898463-7898485 TATTGGCAGTGGCTGTGGTGTGG - Intergenic
953464228 3:43105494-43105516 TCGTGGCAGGCACTGGCGTCGGG - Intronic
954934339 3:54313081-54313103 TATGTGCAGGCACTGTGCTGAGG + Intronic
956931169 3:74044881-74044903 TCATAGGAGGAACTGTGGTGGGG + Intergenic
958268083 3:91463554-91463576 TTTTGGAAGGCACTGTGGTGTGG - Intergenic
961635503 3:128330354-128330376 ATGTGGCAGGCACTGTGCTGAGG + Intronic
961651761 3:128420471-128420493 CCTTGGCTGGCACAGAGGTGTGG + Intergenic
961871494 3:129991868-129991890 TCCTGGCAGGCAGAATGGTGGGG - Intergenic
962255569 3:133867916-133867938 TCTTAGCGGGCTCTGAGGTGGGG - Intronic
962256841 3:133876847-133876869 TCTGGGCAGGCAGTGTTGCGTGG - Intronic
962844762 3:139264386-139264408 TTGTGGCAGGCATTGTGCTGGGG + Intronic
962943348 3:140145563-140145585 TCTCGGCAGACACTGGTGTGTGG + Intronic
963882456 3:150544258-150544280 TTTTGCAAGGCACTGTGGTATGG + Exonic
968282691 3:197489288-197489310 CCTGGGCAGGAACTGTGCTGGGG - Intergenic
970372164 4:15418847-15418869 TCTGGGCAGACTCTGTGCTGAGG - Intronic
970713539 4:18893286-18893308 ACTGGCCAGGCATTGTGGTGTGG + Intergenic
970756231 4:19429705-19429727 TCTTGGAAGGCCCTGGGGTTGGG + Intergenic
971242389 4:24900360-24900382 TCATGGCAGGCACAAAGGTGGGG - Intronic
971550065 4:27942334-27942356 TGTTAGCAGTAACTGTGGTGAGG - Intergenic
973141352 4:46772274-46772296 TGTTGTCACGCACTGGGGTGTGG + Intronic
973177763 4:47228989-47229011 TATTGCCAGGCACTGTGCTGGGG + Intronic
973645038 4:52941755-52941777 TCTTAGCATGCACTGTGCAGTGG - Intronic
974198753 4:58611535-58611557 TCCTGGCAGTCATTGGGGTGTGG + Intergenic
975101786 4:70522023-70522045 TCCTGGAAGGCACAGGGGTGTGG - Intronic
975355446 4:73397179-73397201 TCTGGGCAATGACTGTGGTGTGG + Intronic
978338093 4:107691272-107691294 ACATGCCAGGCACTGTGCTGAGG + Intronic
978442736 4:108750802-108750824 GGTTGGCAGGCACTCAGGTGTGG + Intronic
978756837 4:112311833-112311855 TCGGGGCAGGCAGAGTGGTGAGG + Intronic
980958592 4:139453395-139453417 TCTTGGCAGGCGCATTGCTGTGG - Intronic
983534129 4:168839381-168839403 TCTTGGCTGGCACACTGTTGTGG + Intronic
985421032 4:189785417-189785439 TGCTGGCAGGCTCTGCGGTGGGG - Intergenic
986597776 5:9441501-9441523 TCTTGGTGGGCTCCGTGGTGGGG - Intronic
987510147 5:18826794-18826816 ACTTTGCAGGCACTGTGGCAGGG - Intergenic
988609128 5:32709320-32709342 GGTTGCCAGGCACTGTGCTGGGG - Intronic
989617999 5:43356613-43356635 ACTTGGCAGGTAGTGGGGTGGGG - Intergenic
991619923 5:68534612-68534634 GCTTGGCTGGCCCTGTGGTTAGG - Intergenic
992000266 5:72429509-72429531 ACATGGCAGGCACTGTGTTGGGG - Intergenic
992235479 5:74704593-74704615 TCTTGGCTGCCACTGTGTTTGGG - Intronic
996628521 5:125599968-125599990 TCTTGGCAGGCAGTGGGGTAAGG - Intergenic
997530485 5:134578732-134578754 TCTTGGCAGGCAGGCGGGTGCGG - Exonic
998350644 5:141498405-141498427 TCTTTGCTGGCACTGGAGTGAGG + Intronic
1001881312 5:175246622-175246644 TCTTGAGAGGCAGTGTGATGTGG - Intergenic
1001905098 5:175465374-175465396 TCTTGGCAGCCACTGGAGTGGGG - Intergenic
1002029098 5:176415336-176415358 ACTTGGTAGGCAGTGTGGTCAGG + Intronic
1004178455 6:13360877-13360899 TCCTGGGAGGCAGTGTGGTCTGG + Exonic
1004775055 6:18834787-18834809 GCCTGGCAGGCACTGTGGAGGGG + Intergenic
1005164885 6:22908466-22908488 GCATCCCAGGCACTGTGGTGTGG + Intergenic
1007083702 6:39127710-39127732 ACATGGAAGGCTCTGTGGTGAGG + Intergenic
1007732330 6:43954713-43954735 GCTCGGCAGGCACTGTGGGGTGG - Intergenic
1008328299 6:50214006-50214028 TCATGCCAGGCACTGTTGTAAGG - Intergenic
1008987120 6:57558010-57558032 TTTTGGAAGGCACTGTGGTGTGG + Intronic
1009175078 6:60450578-60450600 TTTTGGAAGGCACTGTGGTGTGG + Intergenic
1009688324 6:66991979-66992001 CCTTGGCTAGCTCTGTGGTGTGG + Intergenic
1010029848 6:71262315-71262337 TCTTGGGAGGCACTGGGCAGAGG - Intergenic
1011177573 6:84581752-84581774 TCTGGGGAGGCCCAGTGGTGTGG - Intergenic
1011755085 6:90490469-90490491 TCTTGTTAGGTCCTGTGGTGGGG + Intergenic
1012273496 6:97243865-97243887 TCTGGGCTGGTACTGGGGTGGGG + Intronic
1013454962 6:110322292-110322314 GCTTTGCAGGCAGTGTGCTGAGG - Intronic
1015865784 6:137725076-137725098 ACTTGGCAGGCACCGCTGTGTGG + Intergenic
1016974243 6:149791221-149791243 TCTGGGCAGGGACAGTGGAGAGG - Intronic
1016997611 6:149971170-149971192 CCTGGGCTGGCTCTGTGGTGTGG + Intronic
1017720287 6:157238992-157239014 TATCGGCAGGCCCTGTGGAGGGG + Intergenic
1018973622 6:168546712-168546734 GCTTGGCAGGGACTGGGGTGGGG - Intronic
1019486768 7:1293026-1293048 GCTTGGAAGGCACTGGGGGGCGG + Intergenic
1020472503 7:8555031-8555053 CCTTGGAAGGCAGTGTGGTTTGG + Intronic
1021838713 7:24705545-24705567 TCGTGACAGGCACTGTGGCATGG + Intronic
1023028666 7:36074450-36074472 TGTTGGCAGTCACTCTGGAGGGG + Intergenic
1025279255 7:57614961-57614983 GCTTTGGAGGCAGTGTGGTGGGG + Intergenic
1025305476 7:57850539-57850561 GCTTTGGAGGCAGTGTGGTGGGG - Intergenic
1026846544 7:73701982-73702004 CCTTGGCAGGCAGTGTGCTGGGG - Intronic
1026965977 7:74440441-74440463 TCTAGGCAGATACTGTAGTGGGG + Intergenic
1029616802 7:101664462-101664484 TGTTTGCAGGCAGGGTGGTGAGG - Intergenic
1031907348 7:127475335-127475357 TCTTGGAATGCAGGGTGGTGGGG - Intergenic
1032541296 7:132705304-132705326 TCTTGGCAGGCAGAGTCTTGAGG + Intronic
1033192843 7:139297948-139297970 TCGTCCCAAGCACTGTGGTGAGG + Exonic
1033579118 7:142715604-142715626 TCTTTCCAGTCACTGTGATGAGG - Intergenic
1035344925 7:158191676-158191698 TCTTGGGTGGCTCTGTGATGCGG + Intronic
1037825737 8:22159717-22159739 TCTTAGCAGGCACTGTGGGTGGG - Intronic
1037968253 8:23150356-23150378 TCTGGGCAGGCCATGTGGTGTGG - Intronic
1038627067 8:29204428-29204450 TCTAGCCAGGTACAGTGGTGTGG + Intronic
1039437233 8:37568038-37568060 GCATGCCAGGCACTGTGCTGGGG + Intergenic
1042130002 8:65579000-65579022 CCTGGGCAGGCAGTGTGGTGGGG + Intergenic
1042339924 8:67667797-67667819 TCTTGGCAGCCACTGGGGCGGGG - Intronic
1043427426 8:80161616-80161638 TATTTGGAGGCATTGTGGTGTGG - Intronic
1049170417 8:141157241-141157263 GCTTGGCAGGGACTTTGGTCAGG + Intronic
1049347261 8:142145639-142145661 TCTCTGTGGGCACTGTGGTGGGG + Intergenic
1049361488 8:142214282-142214304 TCCAGGGAGGCCCTGTGGTGTGG - Intronic
1049363883 8:142227138-142227160 TCCTGGCTGTCACTGGGGTGTGG - Intronic
1049363914 8:142227280-142227302 TCCTGGCTGTCACTGTTGTGTGG - Intronic
1049445143 8:142626671-142626693 AAGTGGCAAGCACTGTGGTGTGG - Intergenic
1050566564 9:6890098-6890120 TCATGACAGGCCCTGTGTTGAGG - Intronic
1051546271 9:18279776-18279798 TCTTGGCAGGCCATCTTGTGGGG + Intergenic
1052115947 9:24648795-24648817 TCTTGGCACCTACTCTGGTGTGG + Intergenic
1052234171 9:26189429-26189451 TCTGGGCAGGCCATCTGGTGTGG - Intergenic
1053195724 9:36116930-36116952 TGTAGGGAGGGACTGTGGTGGGG - Intronic
1056540275 9:87565058-87565080 TGCTGGCAGGCAGTGTGCTGTGG + Intronic
1058417052 9:104800174-104800196 TGTGGGCAGGCGCTGTGGTGAGG + Intronic
1058507931 9:105685617-105685639 TCTTGGGAGGCAGTGTAGTATGG - Intergenic
1060008049 9:120017930-120017952 TTTTGCAAGGCAGTGTGGTGAGG - Intergenic
1060093010 9:120761334-120761356 TCTTGGGTGACACTGTGGTGTGG - Exonic
1060376008 9:123115581-123115603 TCTTACCAGGCTCTGTGATGGGG - Intronic
1060913244 9:127367903-127367925 TCATGTCAGGCAATGTGTTGTGG - Intronic
1061749661 9:132769086-132769108 GCTGGGCGGGCACTGTGGGGAGG + Intronic
1061878098 9:133554830-133554852 TCTGGGCAGGCACAGGGTTGAGG + Intronic
1186561577 X:10619003-10619025 CCTTGGTAGGGACTGTGGGGAGG - Intronic
1187532717 X:20111359-20111381 GCTTTGCAGGCCCTGTGGAGTGG + Intronic
1187973040 X:24677371-24677393 TCTTTGCAGGAAAGGTGGTGGGG - Intergenic
1189085699 X:38021303-38021325 GCTTGTCAGGCCCTGTGGTGAGG + Intronic
1189906270 X:45763212-45763234 TCTGGACAGGCACTGTTGTAAGG - Intergenic
1193076113 X:77357796-77357818 TTATGTCAGGCACTTTGGTGTGG - Intergenic
1193800716 X:85932784-85932806 TCTTTCCATGCATTGTGGTGGGG - Intronic
1194192983 X:90859968-90859990 TCTTCGTAGCCACTGTGGTGTGG + Intergenic
1194872332 X:99147318-99147340 CCTGGGCAGACAGTGTGGTGTGG - Intergenic
1195564434 X:106324187-106324209 TCTGGGCAGGCCATCTGGTGTGG - Intergenic
1196255577 X:113514459-113514481 TGTTGCCAAGCACTGTGGCGGGG - Intergenic
1196793178 X:119482361-119482383 ACTTGCCTGGCACTGTAGTGAGG + Intergenic
1197256418 X:124268279-124268301 TCTTGGCAGACTCTGTTCTGTGG - Intronic
1197725056 X:129770825-129770847 TCTGGGGAGGCACTATGGTGTGG - Intergenic
1198299134 X:135317517-135317539 CCTGGGCAGTCAGTGTGGTGAGG + Intronic
1199293232 X:146128789-146128811 TTTTGGCAAGCAGTTTGGTGTGG - Intergenic
1199771959 X:150980902-150980924 AGTTGGCAGGCACCTTGGTGGGG - Intronic
1200323562 X:155215239-155215261 TTTTGGAAGGCACTGAGGTGGGG + Intronic
1200539607 Y:4442418-4442440 TCTTTGTAGCCACTGTGGTGTGG + Intergenic
1200567726 Y:4787429-4787451 TCTTTGCTGGCACTGAGTTGGGG - Intergenic
1201764852 Y:17566882-17566904 TCCTGGCAGCCCCTGTGTTGGGG - Intergenic
1201836700 Y:18339107-18339129 TCCTGGCAGCCCCTGTGTTGGGG + Intergenic
1201893731 Y:18971421-18971443 TTTTGGGAGGCTGTGTGGTGGGG + Intergenic