ID: 1105853253

View in Genome Browser
Species Human (GRCh38)
Location 13:24354415-24354437
Sequence TTGCTGTTCTTGGGGAGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105853253 Original CRISPR TTGCTGTTCTTGGGGAGCAA TGG (reversed) Intergenic
900216244 1:1483253-1483275 ATGCTGGTCTTGGGGTGCAGTGG - Intronic
903496145 1:23768715-23768737 TCGCTGTTGTTGGGGAGCTATGG + Intergenic
904680107 1:32223036-32223058 TTGCTTTTCTTGGAGTGCAGTGG - Intronic
906535950 1:46551054-46551076 CTGCTGTTCTGGGTGAGCAGGGG - Exonic
908181337 1:61609345-61609367 TTGCTCTTATTAGGGAGGAATGG - Intergenic
908530145 1:65026518-65026540 TTCCTGTTCTAGAGGAGGAAGGG - Intergenic
909889435 1:80985288-80985310 GTGCTGTGCTTGGGAAACAAAGG - Intergenic
909918071 1:81345346-81345368 TAGCTGTTCTTGAGATGCAATGG - Intronic
911028084 1:93456411-93456433 TTGTTGTTTTTAGGGAGTAAAGG + Intronic
912913716 1:113789777-113789799 TTGCTGTTGTTTGAGAGCAGAGG + Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
919667373 1:200304949-200304971 TGGTTGTTTTTGGGGGGCAAGGG - Intergenic
920345604 1:205303994-205304016 ATGCCCTTCTTGGGGAGCAGGGG + Exonic
920581563 1:207113156-207113178 CTGCTGTTCTTGGTGAGTAGTGG + Exonic
920699923 1:208210157-208210179 TTTATTTTCTTGGGGAACAAAGG - Intronic
921563083 1:216681802-216681824 TTGCTGCTGTGGGGGAGAAAAGG + Intronic
922970941 1:229737603-229737625 TGCCTGTTCTTTGGGAGAAATGG + Intergenic
923751945 1:236754494-236754516 TGGCTGTTCTTGGTGATCAAAGG - Intronic
924820008 1:247479959-247479981 TTGTTCTTGTTGGGGAGCAACGG + Intergenic
1063787013 10:9396157-9396179 TTACTGTGCCTGGGTAGCAAGGG + Intergenic
1064199702 10:13274108-13274130 TTGCTGGACTTGGGGAGGGAGGG + Intergenic
1067751450 10:48974417-48974439 TTGCTGTACCTGGGAAGCAAAGG + Intronic
1069325040 10:67223187-67223209 TTGATGTCCTTTGGGAGAAATGG - Intronic
1069997895 10:72354306-72354328 TTTCTGTTCTTCGGGCGCCAGGG - Intronic
1070027897 10:72649636-72649658 TTACTTTTTTTGGGGAGCAGGGG - Intergenic
1072083484 10:92056370-92056392 TTCCTGTTCTTGTGGGGCATGGG - Intronic
1075073779 10:119336725-119336747 TTGCTGTCCTTGGGGTGATAAGG + Intronic
1076413209 10:130266115-130266137 TTGCTGTTCTGGGGGAGGGGAGG - Intergenic
1080232290 11:30030869-30030891 TTGCTGCTTTCTGGGAGCAAAGG + Intergenic
1081814112 11:45929106-45929128 TTCCTGGTTTGGGGGAGCAAGGG + Intergenic
1083020087 11:59497724-59497746 GTGCTGTTCTTGGCGATCAGAGG - Intergenic
1084322152 11:68379314-68379336 TTGCTGTTCTTGTGGAGCCATGG + Intronic
1086700106 11:89892075-89892097 TTGCTGTTGTTGGAGAGACAGGG + Intergenic
1086700273 11:89893942-89893964 TTGCTGTTGTTGGAGAGAGAGGG - Intergenic
1086705897 11:89950584-89950606 TTGCTGTTGTTGGAGAGAGAGGG + Intergenic
1086706064 11:89952441-89952463 TTGCTGTTGTTGGAGAGACAGGG - Intergenic
1087144851 11:94801069-94801091 GTGCTGTTCTAGGAGAGAAATGG + Intronic
1088304443 11:108393174-108393196 TTGCTATTCTTGGGGAACAAGGG - Intronic
1088838785 11:113604447-113604469 TTTCTTTTCTTGGAGAACAAAGG - Intergenic
1089256631 11:117197691-117197713 CTGCTGTTCCTGGGGAGGTAAGG - Intergenic
1089644695 11:119871081-119871103 TTTCTGTGTTTGAGGAGCAAAGG + Intergenic
1090548989 11:127797997-127798019 TTGCTATTCTGTGGGAGCACAGG + Intergenic
1090844468 11:130519290-130519312 TTGTTGTTCTTGGCTAGGAAAGG - Intergenic
1093393841 12:18656121-18656143 TTGCTGTTTTTGTGGAAGAATGG - Intergenic
1095411272 12:41927079-41927101 TTGCTTTTTTGGGAGAGCAAGGG - Intergenic
1095444961 12:42273955-42273977 CTGCTGGTCCTGGGCAGCAAGGG - Intronic
1101564023 12:105888324-105888346 TGGCTGTTTTTGGGCTGCAATGG - Intergenic
1102027998 12:109724381-109724403 TTGCATTTCTTGGGTAGGAAGGG - Intronic
1102549800 12:113683604-113683626 TTCCTGTTCCTGGGAGGCAAGGG + Intergenic
1102725473 12:115060548-115060570 TTGCTGGACTTGGGAAGCAGAGG + Intergenic
1102792567 12:115659584-115659606 TAGCTGTTCTCTGGGAGGAAAGG - Intergenic
1104960375 12:132485867-132485889 TTCCTTTTCTAGGGGAGCATGGG + Intergenic
1105700485 13:22932366-22932388 TTACTGTTCTTGGTGAGGAATGG - Intergenic
1105723145 13:23135623-23135645 ATGCTCTTCTTGGGGAGGAGGGG + Intergenic
1105853253 13:24354415-24354437 TTGCTGTTCTTGGGGAGCAATGG - Intergenic
1108953687 13:56122838-56122860 TTGCTATTCTTAGAGACCAAAGG + Intergenic
1108975254 13:56434383-56434405 TTAATGTTATTGGAGAGCAAAGG - Intergenic
1110745167 13:79044068-79044090 TTTCTGTTCTTCAGGAGCACAGG + Intergenic
1112782355 13:102914859-102914881 TTGCTGTTCTGCGGGTGCACAGG + Intergenic
1113312413 13:109144052-109144074 TTGCTCTTGTTGGAGGGCAATGG + Intronic
1113443129 13:110345428-110345450 CTGCTGTTCCTGGGAAGCAGTGG + Intronic
1113972928 13:114204018-114204040 TTATTGTTGCTGGGGAGCAATGG + Intergenic
1115358434 14:32474416-32474438 TTGCTGTTTTTGTGGGTCAAAGG + Intronic
1115665144 14:35536500-35536522 TTGCTGCTTTTGGGGTGCATGGG + Exonic
1115993288 14:39171092-39171114 TTCCTGTTAGTGGGGTGCAAGGG + Intergenic
1115998204 14:39215287-39215309 ATGCTGGTTTTGGAGAGCAATGG - Intergenic
1117484211 14:56177374-56177396 TTGGTGTTCTGGGGGAGCCTTGG + Intronic
1118743223 14:68756213-68756235 TTGCAGTCCTTGGGGGGCAGAGG - Intergenic
1120219695 14:81718432-81718454 TGGCTGTCTTTGGGGAGAAAGGG + Intergenic
1122842009 14:104470310-104470332 TTACTGTTCTTGGTGAGGAATGG - Intergenic
1122961723 14:105096956-105096978 TTGCAGGTACTGGGGAGCAATGG - Intergenic
1125815459 15:42580426-42580448 TTGTTGTGCTTGGGAAGAAATGG - Intronic
1126643559 15:50852801-50852823 TTACTGTTATTGGAGTGCAATGG + Intergenic
1127475110 15:59325740-59325762 CTGCTGTGCTTGGTGAGCACAGG + Intronic
1127837065 15:62798356-62798378 TGACTGTCCTTGAGGAGCAATGG - Intronic
1128308243 15:66614031-66614053 TTGCTGTTCTAGGGGACAATGGG - Intronic
1129103910 15:73292057-73292079 GTGCTGCTCTTGGGGACCAGAGG - Intronic
1131678750 15:94699744-94699766 CTGTTGTTTTTGGGGAGTAAAGG + Intergenic
1133859030 16:9576662-9576684 TTGCTGTTGTTCGGGTGAAAGGG + Intergenic
1138296917 16:55894604-55894626 TTACTGTTTTTGTGGAGAAATGG - Intronic
1139547400 16:67656137-67656159 TTGCTCTCCTTGGGGAGGAAGGG + Intronic
1139735688 16:68986039-68986061 TTGCTCTTCCAGGGAAGCAAAGG - Intronic
1140045902 16:71440651-71440673 TGGCTCTTCTAGGGGAGCAAAGG - Intergenic
1140490302 16:75329879-75329901 TTCCTGTTCTTGGGGAGCTATGG + Intronic
1140878585 16:79176427-79176449 TTGCTCTTCTTCCTGAGCAAAGG - Intronic
1141205951 16:81933299-81933321 GAGCTGGTGTTGGGGAGCAAAGG + Intronic
1141355149 16:83338624-83338646 TAGCTGTTCTGGAGGAGTAAGGG + Intronic
1141952972 16:87350973-87350995 TCGCTGTACTTTGGAAGCAACGG + Intronic
1142260498 16:89040514-89040536 TGGCTGGCCTGGGGGAGCAAGGG + Intergenic
1142275475 16:89116486-89116508 TTGCTGGGCCTGGGGAGCCATGG + Intronic
1142883098 17:2896303-2896325 TTTGAGTTCTTGGGGACCAAGGG - Intronic
1146441186 17:32896588-32896610 TTGCTTATCTTGGGAAACAAAGG + Intergenic
1146987451 17:37233872-37233894 TAGCTATTCTAGGGTAGCAAAGG + Intronic
1147302068 17:39537600-39537622 TTGCTCTTCTTGGAGTGCAGTGG + Intronic
1147418838 17:40312020-40312042 TCCCTGGTTTTGGGGAGCAAGGG + Intronic
1147422147 17:40327197-40327219 TTTCTCTTCTCTGGGAGCAAGGG + Intronic
1148050622 17:44768338-44768360 TCGGTGTCCTTGGGGCGCAAAGG + Intronic
1151767730 17:76140798-76140820 TTCCTGCTCTTCGGGAGAAAAGG - Intronic
1152626768 17:81391272-81391294 CTGCTGCTCTTGGGGAGCGTGGG + Intergenic
1156197919 18:34796906-34796928 ATGCTATTCTTGGGGAGCTATGG - Intronic
1156212863 18:34965676-34965698 TGGATGTTCTTGGAGAACAAAGG + Intergenic
1157827020 18:50821629-50821651 TTTCTGTTCATGGGGAGGAGGGG - Intronic
1158063405 18:53375859-53375881 TTGCTGTAATTGGTGACCAAAGG + Intronic
1158279862 18:55812725-55812747 TTCCTGTTCTTGAGTGGCAAAGG + Intergenic
1158318618 18:56238972-56238994 TTTCTGTTACTGGGGACCAAGGG + Intergenic
1159565358 18:70041933-70041955 TTGCTGTCCAAGGGGACCAATGG - Intronic
1159949680 18:74473834-74473856 TTGCTGTTCTTTGGCAGCACTGG + Intergenic
1160191838 18:76721341-76721363 GTGCTGTTTGTGGGGAGGAAAGG - Intergenic
1161628172 19:5338896-5338918 CTGCTGTCCTTGGGGTGCAGAGG - Intronic
1164990269 19:32677570-32677592 TAGCTGCTCTTGGGGACGAATGG - Exonic
1166781438 19:45345520-45345542 TTGCTGCTCCTGGGGAGCAATGG - Exonic
1166976314 19:46607139-46607161 TTGTTGTTCTTGGGGAGGGCAGG - Intronic
1167674571 19:50876458-50876480 TGGCTATTCCTGGGGAGGAAGGG - Exonic
1168351597 19:55679294-55679316 TTGCTGCTCTTGGGGTCCAGGGG + Intronic
925086443 2:1111533-1111555 TGGCTGAACTTGAGGAGCAATGG - Intronic
927104586 2:19812342-19812364 CTGCTGTTCTTGGCAGGCAAGGG + Intergenic
928405833 2:31014262-31014284 TTGCCTTTTTTGGGGAGGAAGGG - Intronic
933898647 2:86833658-86833680 TTCCTTTTCTTGGGGGGCAGTGG + Intronic
934581025 2:95438388-95438410 TTGCTGTTGTTGGAGAGACAGGG + Intergenic
934598425 2:95638326-95638348 TTGCTGTTGTTGGAGAGACAGGG - Intergenic
935252516 2:101276292-101276314 TTGCTGTTCTTTTGGGTCAAAGG - Exonic
937570515 2:123352612-123352634 TTTCTTTTGTTGTGGAGCAATGG + Intergenic
938289322 2:130141127-130141149 TGGGTGTTCCTGGGGTGCAAGGG - Intronic
938467205 2:131531811-131531833 TGGGTGTTCCTGGGGTGCAAGGG + Intronic
941040678 2:160619483-160619505 TTGGTGTTATTGGGAAGAAAAGG + Intergenic
942134347 2:172910281-172910303 TTTGTGTTCATGGGGTGCAATGG - Intronic
944198689 2:197082630-197082652 TTGCTTCTCTTGTAGAGCAATGG - Intronic
944236044 2:197442203-197442225 TTGAAGTACTTGGGTAGCAAGGG + Intergenic
945396215 2:209321963-209321985 TGGCTGCTTTTGGGTAGCAAGGG + Intergenic
947017657 2:225639117-225639139 AACCTGTTCTGGGGGAGCAAAGG - Intronic
947595073 2:231406009-231406031 TTCCAGTCCTTGGGGAGAAAGGG - Intergenic
947785112 2:232810527-232810549 TTGCTGTTCTTGTGGTGCAGAGG + Intronic
1168895691 20:1321855-1321877 TTCCTGTTTTTTGGGAGCAGTGG - Intronic
1169144551 20:3243858-3243880 TCGCTGTTCCTGGGGAGGAGAGG + Intergenic
1172093821 20:32451055-32451077 TCACTGTTCCTGGGCAGCAAGGG - Intronic
1175936930 20:62518251-62518273 CAGCTGTACTTGGGGAGCCATGG + Intergenic
1176229501 20:64024792-64024814 GTGCTGTTGTTGGGGTGCACTGG + Intronic
1177563602 21:22788902-22788924 TTTCTGTACTTCAGGAGCAAGGG + Intergenic
1178899725 21:36589232-36589254 GTGCTGTCCTTGGGGACCAAGGG - Intergenic
1180197178 21:46204253-46204275 TTGCTGAGGTTGGGGAGCAGTGG - Intronic
1180560521 22:16611273-16611295 TTTCTTTTTTTGGGGGGCAAGGG + Intergenic
1180990647 22:19933744-19933766 ATGCTGTTCTGTGGGAGGAAGGG + Intronic
1181931450 22:26404972-26404994 TTGGTGTTCATGGTGAGCACTGG - Intergenic
1182161852 22:28130298-28130320 CTGCTTTTCCTTGGGAGCAAAGG - Intronic
1182441528 22:30367273-30367295 TTGCTCTTCTTGGAGTGCAGTGG + Intronic
1183031522 22:35110064-35110086 TAGATGTTCTTGGGCAGCCAGGG + Intergenic
1184606507 22:45577495-45577517 TTGTTATTCTTGGGGTGCAATGG + Intronic
1185258478 22:49849213-49849235 GCGCTGTTCTGGGGGAGCAGGGG + Intergenic
949742720 3:7254552-7254574 TTGCTGTTTTTGAGCTGCAATGG - Intronic
961502549 3:127347596-127347618 GTGCTGTCCATGAGGAGCAAAGG + Intergenic
963252828 3:143118811-143118833 TTAGTGTTCTTGGGGAGGGAGGG + Intergenic
964826695 3:160836206-160836228 TTGCTTTTCTTTGGAAGGAAAGG + Intronic
966764396 3:183447333-183447355 TTGCGGTTCTTGGGCGGAAACGG + Intergenic
966903668 3:184506349-184506371 TTGCTGCTATTGGAGGGCAAAGG + Intronic
968189955 3:196660439-196660461 TTGCTGTACTGGGGCAGCAGCGG - Exonic
969707527 4:8820082-8820104 TTCCTCTTCTTGAGGAGCAGTGG + Intergenic
970550952 4:17180614-17180636 TTGCTAATCTTGGGGAGAAGAGG + Intergenic
971146890 4:23987268-23987290 TTGCTGTTCTTCAGGTGCAGAGG - Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
975248812 4:72153070-72153092 TTGCTGTCATTTGGGGGCAAGGG + Intergenic
975992111 4:80267960-80267982 TAACTGTTCTTGGGGACCAAAGG - Intronic
977302457 4:95282943-95282965 TGGCTGGTCTTGGGGAAGAATGG + Intronic
980387171 4:132101358-132101380 CTGCTGTACTTGGGGAGCTGAGG - Intergenic
980973986 4:139593147-139593169 TTGCTGTTCTGAGGCAGCTATGG + Intronic
982096081 4:151924724-151924746 TAGCTTTTCTTGGGGACCACTGG - Intergenic
982117592 4:152110538-152110560 TTGCTTTTCTTGGGGTGCGGTGG - Intergenic
984514840 4:180725363-180725385 ATGCTGTTCTTGGGGTGAAGAGG + Intergenic
985147166 4:186905483-186905505 TTGCTGAGCTTGGAGTGCAATGG + Intergenic
985810886 5:2083806-2083828 TTGATGGTTTTGGGGAGCACTGG - Intergenic
985849278 5:2376706-2376728 TGGCTGTTCTTGGGCACCAAGGG - Intergenic
986574676 5:9199359-9199381 TTGCTGTGCTCTGGGGGCAAAGG + Intronic
988419526 5:30988520-30988542 TTTGTGGTTTTGGGGAGCAATGG + Intergenic
989552456 5:42751722-42751744 TTGATGTTCTCTGGGAGCAATGG + Intergenic
990056562 5:51587853-51587875 CTGCTGTCCTTGGGGAGTGATGG + Intergenic
994057249 5:95431847-95431869 ATTGTGTTCTTGGGGAGGAAGGG - Intronic
994674701 5:102805629-102805651 TTGCTGTCCTTGAGAATCAAAGG + Intronic
996201468 5:120679995-120680017 CTGCTCTTGTTGGGGAGAAATGG + Intronic
997935572 5:138107787-138107809 TTTGTGATGTTGGGGAGCAAGGG + Intergenic
1002431120 5:179204585-179204607 TTGGTGGTCTTGGGGAGGAGGGG - Intronic
1003116136 6:3284952-3284974 CTGCAGTTCTTGGAGGGCAACGG + Intronic
1006838548 6:37013947-37013969 TCGCTGCTCTTGGGGAGGGATGG - Exonic
1007146722 6:39642188-39642210 TTATTGTTCTTGTGGAGTAATGG - Intronic
1007947757 6:45841208-45841230 TTGCTGTCCTGGGGCAGTAATGG + Intergenic
1008182826 6:48354223-48354245 TTGATGTTTTTGAGGAACAATGG + Intergenic
1013375259 6:109508670-109508692 TGGCTGTGCTGGAGGAGCAAAGG + Intronic
1014045055 6:116876258-116876280 TTGCTTTTGTTGGAGAGCACTGG + Intergenic
1014268699 6:119312111-119312133 CTGCTGTTCTTGGGGACACAAGG + Intronic
1014749013 6:125234182-125234204 TTGCCTTTCTTTGGCAGCAATGG - Intronic
1014963117 6:127711786-127711808 CTGCTTTTCTTAGGGAGCAGGGG + Intronic
1016083662 6:139885845-139885867 TTGATGCTCTTGTGGAGCATAGG + Intergenic
1016143497 6:140642929-140642951 ATGCTTATCTTGGGGAGCATTGG - Intergenic
1016317286 6:142804971-142804993 TTGTTTATTTTGGGGAGCAAAGG - Intronic
1016362605 6:143284553-143284575 TTGCTTTTGTTGGGGGGCAGGGG + Intronic
1016760582 6:147731815-147731837 TTTCTGTATTTGTGGAGCAAAGG + Intronic
1019025703 6:168961160-168961182 GGGCTGGTCTTGGGGAGCAGAGG - Intergenic
1020793294 7:12652763-12652785 TTGCTGTTTTGGGAGAGGAACGG + Exonic
1021234995 7:18132127-18132149 TTGCTGTGACTTGGGAGCAAAGG - Intronic
1022886202 7:34647369-34647391 TTAGTGTTCTTGGGGTGCAGAGG + Intergenic
1026329369 7:69338434-69338456 GTGTTGTTCTTGGGGAGACAGGG + Intergenic
1026528323 7:71174901-71174923 TTTCTGTCTTTGGGGAGCGATGG + Intronic
1029480753 7:100811467-100811489 TTTCTCCTCTTGGGGAGCAGAGG - Intronic
1030012576 7:105185448-105185470 CTGCTGTTCATGGAGTGCAAGGG + Intronic
1033519012 7:142141081-142141103 GTGTGGATCTTGGGGAGCAATGG + Exonic
1034213811 7:149387776-149387798 TTGCTATCCTTAGGGAGAAAAGG - Intergenic
1034989198 7:155537042-155537064 TTGCTCTTCTTTGAGAGGAAAGG + Intergenic
1036024769 8:4893858-4893880 TTTCTGTTTTTGGGGAAAAAAGG - Intronic
1038875413 8:31543151-31543173 TTGCTGGTCTGAGGGAGCAACGG - Intergenic
1038930401 8:32187681-32187703 TGGCTTTTCTGGGGGAGCAGAGG + Intronic
1047595731 8:126375925-126375947 TTGCTACTCTTGGGGGGCAATGG - Intergenic
1050594953 9:7195704-7195726 TTGCTGTGCTTGGGAAGCCTGGG + Intergenic
1050764629 9:9116676-9116698 TTGTTTTTCTTGGGGGGGAAGGG + Intronic
1051726216 9:20089866-20089888 TTGCGCTTGTTGGGGAGCAGGGG - Intergenic
1053206378 9:36190047-36190069 CTGCTGTCCTTAGGGAGGAAAGG + Intergenic
1053239058 9:36481690-36481712 ATGCTGTTCTGGGGGCTCAAGGG - Intronic
1055301676 9:74889128-74889150 TTGCTGTTGTTGTTGAGCCAGGG + Intergenic
1059723260 9:116982407-116982429 TTATTGTTCTTGGGTAGGAAAGG + Intronic
1059863892 9:118491828-118491850 TTTATGTTCTTTGAGAGCAAAGG + Intergenic
1060753005 9:126186461-126186483 TTTCTGTTCTTGGGGCGTTAAGG - Intergenic
1062448427 9:136605344-136605366 TTCCTGTTCTTGGGGCTCACAGG + Intergenic
1186470825 X:9820997-9821019 TTGCTGTCCTTGGTAAGCAGTGG + Intronic
1188145674 X:26609382-26609404 TTGCTTTACTTGGGGAGTAAGGG - Intergenic
1188959688 X:36475701-36475723 TTGCTGATGTTGTGGAGAAAAGG + Intergenic
1190087588 X:47409287-47409309 GTGCTGTTCTGTGGGAGAAAGGG - Intronic
1191587404 X:62843870-62843892 TGGCTGTTCCTGTGGAGCAGGGG - Intergenic
1192982569 X:76361866-76361888 TTGCATTTCTTTGGGATCAATGG + Intergenic
1193252449 X:79308132-79308154 TTGGTGTCCTTGTGGAGAAAGGG - Intergenic
1196097083 X:111811869-111811891 TTGCTGTTCTGGGCCATCAAAGG - Intronic
1197776505 X:130121685-130121707 GTGCTGTTCTAGGGGTGCACAGG + Intergenic
1199893048 X:152107326-152107348 GTGCTGTACTGGGGGAGCAGAGG + Intergenic
1199915353 X:152334280-152334302 TTCCTGATCTTAGGGAGAAAGGG - Intronic