ID: 1105855138

View in Genome Browser
Species Human (GRCh38)
Location 13:24365682-24365704
Sequence GATCCCTGCCACAGTGATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 2, 1: 0, 2: 2, 3: 8, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105855134_1105855138 -6 Left 1105855134 13:24365665-24365687 CCTGGGCAACCCCTGAGGATCCC 0: 1
1: 0
2: 13
3: 24
4: 257
Right 1105855138 13:24365682-24365704 GATCCCTGCCACAGTGATTCAGG 0: 2
1: 0
2: 2
3: 8
4: 138
1105855128_1105855138 28 Left 1105855128 13:24365631-24365653 CCACTACAGATGGGTTCGAGATT 0: 1
1: 1
2: 2
3: 1
4: 38
Right 1105855138 13:24365682-24365704 GATCCCTGCCACAGTGATTCAGG 0: 2
1: 0
2: 2
3: 8
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105855138 Original CRISPR GATCCCTGCCACAGTGATTC AGG Intergenic
901734214 1:11302055-11302077 GCCCCCTGCCCCAGTGTTTCTGG + Intergenic
903122887 1:21227822-21227844 GATCTTTGCCCCAGTGCTTCAGG - Intronic
910654042 1:89601857-89601879 GATCACAGCCCCAGTGATTTAGG + Intergenic
911027403 1:93448906-93448928 TCTCCCTGCCTCAGTGCTTCGGG + Intronic
914912842 1:151801142-151801164 GATCCCTGGCACGGTGATGTTGG + Exonic
918936181 1:190924889-190924911 GATCCCGACCTCAGTGGTTCTGG + Intergenic
919925103 1:202188112-202188134 GGTCCCAGCCACAGGAATTCTGG + Intergenic
923718588 1:236448169-236448191 GGCCCCTGCCCCAGAGATTCTGG + Intronic
1063148741 10:3318779-3318801 AATCCCTGCCACACTGTGTCTGG + Intergenic
1067064452 10:43095905-43095927 GACCCCCGCCACCGTGGTTCTGG - Intronic
1074575297 10:114663233-114663255 GATTCTAGCCAGAGTGATTCTGG - Intronic
1074755850 10:116623673-116623695 GGTCCCTCCCTCAGAGATTCTGG - Intronic
1075141348 10:119839360-119839382 CATCCCTGCCACATTGTTTGAGG - Intronic
1075794039 10:125106362-125106384 GCTCACTACCACAGTGTTTCCGG + Intronic
1075795330 10:125116105-125116127 GGTCCCTGCCCCAGGGACTCAGG + Intronic
1079187939 11:18254063-18254085 GACCCCTGCCACAGTCTTTGGGG + Intergenic
1080304544 11:30822168-30822190 GTACCCTCCCACAGTGAATCAGG + Intergenic
1083581288 11:63827093-63827115 CTTCCCTGCCACAGTGGTGCTGG - Exonic
1084772064 11:71349731-71349753 GTTCACTCCCACAGTGAGTCAGG + Intergenic
1087536259 11:99449870-99449892 GACCCTTCCCACACTGATTCTGG - Intronic
1088733743 11:112707903-112707925 GTGCCCAGCAACAGTGATTCTGG + Intergenic
1091646617 12:2276870-2276892 GGTCCCTGCCCCAGTGATTCAGG - Intronic
1092156151 12:6282702-6282724 CACCCCAGCCAGAGTGATTCTGG + Intergenic
1094325427 12:29232759-29232781 AAATCCTGCCACACTGATTCAGG + Intronic
1099808875 12:87555298-87555320 TCTCTCTGCCCCAGTGATTCAGG - Intergenic
1101300149 12:103471168-103471190 GATCCAATCCACAGAGATTCTGG - Intronic
1102215934 12:111161282-111161304 GAGCCCTGCTGCTGTGATTCTGG - Intronic
1104367172 12:128188335-128188357 GATCCCTTCCACAGAGACTTTGG - Intergenic
1104778212 12:131403630-131403652 GACCCCTGACACAGAGATTTGGG - Intergenic
1105702510 13:22943901-22943923 GATCCCTGCCACAGTGATTCAGG + Intergenic
1105855138 13:24365682-24365704 GATCCCTGCCACAGTGATTCAGG + Intergenic
1108829176 13:54455398-54455420 GATCCCTGCCACAGGGGTTTGGG - Intergenic
1110527768 13:76559104-76559126 GATCCCAGCTAGAATGATTCTGG - Intergenic
1113596855 13:111539758-111539780 GATTCCTGCCTCTGAGATTCAGG + Intergenic
1113601226 13:111569568-111569590 GACCCCTCCCACATTGAATCTGG - Intergenic
1113770223 13:112903529-112903551 GTTCCCTGGCCCAGTGGTTCTGG + Intronic
1118322604 14:64762134-64762156 CACCCCTGCCACACTGACTCAGG + Intronic
1118357196 14:65024271-65024293 GGTCCCACCCATAGTGATTCCGG + Intronic
1122285449 14:100649077-100649099 GATCCCCACCCCAGTGAGTCTGG + Intergenic
1122844022 14:104480959-104480981 GACCCCTGCCATAGTGATTCAGG + Intronic
1124001474 15:25764113-25764135 GATCCTTGCCTCAGTGGATCTGG + Intronic
1124198968 15:27660243-27660265 GTTCCCTCCCCCGGTGATTCTGG - Intergenic
1129676573 15:77634996-77635018 GCTCCCTGCCTCAGTGATCTCGG + Intronic
1134909552 16:18012218-18012240 GATCCCTGGCACAGTGCTGGTGG - Intergenic
1135760527 16:25134455-25134477 GATCCCTGCCCCAGAGCCTCTGG - Intronic
1136176469 16:28520472-28520494 GGTCCCAGCTACAGTGACTCAGG + Intergenic
1136687205 16:32002618-32002640 GGTCCCTGCCCCAGTGAGCCCGG + Intergenic
1136787818 16:32946169-32946191 GGTCCCTGCCCCAGTGAGCCCGG + Intergenic
1138048015 16:53746259-53746281 TTTCCCTGCCACAGTGACTTTGG + Intronic
1141684707 16:85563645-85563667 GCTCCCTCCCACAGTGAGACAGG + Intergenic
1141871874 16:86792319-86792341 GATGTCTGCCACAGTGAAACAGG + Intergenic
1143335600 17:6169499-6169521 GATTCCTGGCACAGGCATTCCGG - Intergenic
1143457370 17:7076911-7076933 GATCTCCGCCACAGTGTTTGAGG + Exonic
1145916657 17:28577880-28577902 GAAGCCTGCAATAGTGATTCAGG + Intronic
1146569252 17:33938813-33938835 TCTCCCTGCCTCAGTGACTCTGG + Intronic
1147148183 17:38498287-38498309 GGTCCCTGCCCCAGTGAGCCCGG + Intronic
1148070046 17:44903462-44903484 GATCTCTGCCTCAGTGCTCCAGG - Exonic
1149296008 17:55263700-55263722 GTTCCCTGGCAGGGTGATTCCGG - Intergenic
1151009857 17:70482092-70482114 GAGTCCTGACACAGGGATTCTGG + Intergenic
1151569337 17:74918269-74918291 CATCCCTGCCCCAGCCATTCAGG + Intronic
1151802199 17:76385058-76385080 GATCCCTGCCCCAGCCATCCAGG - Exonic
1154171551 18:12056572-12056594 CCTCCCTGCCCCAGTGCTTCTGG + Intergenic
1154259075 18:12813276-12813298 GATCACTGCCAAAGTGACCCTGG + Intronic
1154464448 18:14630363-14630385 GATCCCAGCAACAGCGATTCAGG - Intergenic
1155917741 18:31572725-31572747 GACCCCTGGCACAGTTGTTCTGG - Intergenic
1157728192 18:49981127-49981149 GATTGCTGCCACAGTGGTTCTGG - Intronic
1166539246 19:43594712-43594734 GATCCCTCCCCCAGTGAGTTTGG - Intronic
925145547 2:1581020-1581042 GATCCTTCCCACAGTGAAGCGGG + Intergenic
925145605 2:1581282-1581304 GATCCTTCCCACAGTGAAGCGGG + Intergenic
925145615 2:1581335-1581357 GATCCTTCCCACAGTGAAGCGGG + Intergenic
926584725 2:14673547-14673569 GGTGCCTGCCCCAGTGATTGGGG - Intergenic
931175229 2:59847710-59847732 GAATCCTCCCACAGTGTTTCAGG - Intergenic
937312842 2:120912611-120912633 GCTCCCTGCCCGTGTGATTCTGG - Intronic
939957348 2:148538131-148538153 GCTCCCTGCCACAGGGACTTTGG - Intergenic
940813570 2:158273661-158273683 TTTCTGTGCCACAGTGATTCTGG + Intronic
944904947 2:204252833-204252855 CATCCCTGCTTCAGGGATTCTGG + Intergenic
946625533 2:221608503-221608525 GCTACCTGGCACAATGATTCAGG + Intergenic
1171180711 20:23088618-23088640 GATCCCTGCCTCTGTGATCCTGG + Intergenic
1171459877 20:25292392-25292414 GCTCCCCTCCACAGTGATCCCGG + Exonic
1171908382 20:30920042-30920064 GGTCCGAGCCACAGTCATTCGGG - Intergenic
1172047267 20:32089224-32089246 GTCCCCTCCCACACTGATTCTGG - Intronic
1172319711 20:33986766-33986788 GTCCCCTCCCACATTGATTCTGG - Intergenic
1174997392 20:55585751-55585773 GACCCCTCCCATACTGATTCTGG - Intergenic
1175448629 20:59043423-59043445 GACCCCTGGCACCGTGCTTCCGG - Intergenic
1176810089 21:13528026-13528048 GATCCCAGCAACAGCGATTCAGG + Intergenic
1184003285 22:41690711-41690733 GGTCCCTGCAGCTGTGATTCTGG - Exonic
949960599 3:9308973-9308995 GTTCTCTCCCACACTGATTCTGG + Intronic
951610276 3:24484087-24484109 GCTCTGTTCCACAGTGATTCAGG - Intronic
952508022 3:34025176-34025198 GTGCCCTGCCATACTGATTCTGG - Intergenic
954360748 3:50121615-50121637 GATCCCAGCCACCCCGATTCCGG + Intergenic
954588044 3:51753949-51753971 GATGCCTACCACAGTGCTTGGGG + Intergenic
956500086 3:69873278-69873300 CATTCCTTCCAAAGTGATTCAGG - Intronic
957496194 3:80994136-80994158 GATCCATGTCACAGTGATCTTGG + Intergenic
959175652 3:102906189-102906211 AATCCCTGCCACAGTGTTAGAGG + Intergenic
961126056 3:124418877-124418899 GGTCCCAGCCGCAGAGATTCTGG + Intronic
968990065 4:3904624-3904646 CATACTTGACACAGTGATTCTGG + Intergenic
972386125 4:38567599-38567621 AAGCCCTACCAGAGTGATTCAGG + Intergenic
973156374 4:46959232-46959254 GATCCCTGCCAGAGTGCAGCTGG - Intronic
978107809 4:104925746-104925768 GCTCCCTGCCACTGGGATTTAGG - Intergenic
980092545 4:128457459-128457481 TTCCCCTGCCACAGTGATCCCGG - Intergenic
981549898 4:145933359-145933381 GGTCCCTGCCACAGTTAGTCAGG + Intronic
982383788 4:154778447-154778469 TATCACTGCCACAGTGATAAAGG + Intergenic
982579262 4:157157233-157157255 GATCCCTGCCATAGTGTCTGTGG - Intronic
986150252 5:5121674-5121696 TATGCCAGCCACAGTGTTTCTGG + Intergenic
987091269 5:14509717-14509739 GAATGCTGCCACAGTGACTCGGG - Exonic
989777611 5:45227675-45227697 GATCCCTCTCCCAGAGATTCTGG - Intergenic
990168880 5:53025474-53025496 AATCCCTGATACAGTGATTTTGG + Intronic
998047901 5:139004357-139004379 AATCCCATGCACAGTGATTCAGG - Intronic
998515582 5:142750848-142750870 CATCCCTTCCCCAGTGACTCAGG + Intergenic
998761784 5:145440207-145440229 GATTCCAGCCACAGTGACCCAGG + Intergenic
1002343061 5:178529327-178529349 GTTCCCTCCCACACTGACTCTGG - Intronic
1002343068 5:178529367-178529389 GTTCCCTCCCACACTGACTCTGG - Intronic
1002810337 6:622052-622074 GATCCCTCACACAGTGCTCCAGG - Intronic
1003461141 6:6329638-6329660 GTCCCCTTCCACAGTGAATCTGG + Intergenic
1004287442 6:14335008-14335030 GATCCCCCCCACAGTATTTCAGG - Intergenic
1004351794 6:14896615-14896637 GATCCCTCCCACACTGACTCTGG + Intergenic
1011694185 6:89897337-89897359 CATCCCACCCACAGAGATTCTGG - Intergenic
1013068911 6:106710493-106710515 GATCCCTGCCTCAGTGTGCCTGG + Intergenic
1013458657 6:110355854-110355876 GGAGGCTGCCACAGTGATTCAGG - Intronic
1013666488 6:112354656-112354678 CATCCCTGCCACAGTCACCCAGG + Intergenic
1016231698 6:141813811-141813833 GTCCCCTTCCACATTGATTCTGG - Intergenic
1018623183 6:165751299-165751321 ACTCCCTGCCACACTGACTCTGG - Intronic
1018713084 6:166511289-166511311 GATCCCTGCCTGAATCATTCAGG + Intronic
1018825659 6:167406327-167406349 GACCCTTGCCACTGTGTTTCAGG + Intergenic
1018953939 6:168395526-168395548 GGGACCTGCCACTGTGATTCAGG + Intergenic
1021670824 7:23033228-23033250 GACCCCAGCCACAGTGGATCTGG + Intergenic
1022320836 7:29286292-29286314 GAGGCCTGCCACAGTCATTTAGG - Intronic
1029625364 7:101717532-101717554 CACCCCTTCCACAGTGATTGTGG + Intergenic
1029996603 7:105013501-105013523 CCTCCCTGCCACCGTGCTTCGGG - Intergenic
1034131809 7:148725492-148725514 GTTCCCTGCCAGGGTGATGCTGG + Intronic
1036539079 8:9686065-9686087 GCCCCCTGCCACACTGACTCTGG + Intronic
1038151672 8:24946850-24946872 GATCTCTCCCACACTGAATCAGG + Intergenic
1039155696 8:34554223-34554245 GATCACTGCCCCAGTGTGTCTGG + Intergenic
1043246461 8:78009116-78009138 GATGCCTGCCACATTTAGTCAGG + Intergenic
1044347195 8:91119218-91119240 TATCCTTGCTACAGTGTTTCTGG + Intronic
1044785573 8:95788848-95788870 GTTCCCTCCCTCATTGATTCTGG - Intergenic
1048510645 8:135059159-135059181 GATCCCAGCCACATACATTCTGG + Intergenic
1048643878 8:136395945-136395967 GAACCCTGCCAGACTGATTCCGG + Intergenic
1048801284 8:138196459-138196481 GATCCCTGCCACACTCTCTCCGG - Intronic
1053415539 9:37944853-37944875 AGTCCCTGCCACAGAGAGTCAGG - Intronic
1055293178 9:74805666-74805688 CATCCCTGCCACAGTCACCCAGG - Intronic
1057316061 9:93969244-93969266 GATTCCTGCCAAAGAGACTCTGG - Intergenic
1059396665 9:114038451-114038473 AATCCCAGCCACACTGAATCGGG + Intronic
1060287965 9:122271367-122271389 GATCCCTGCTACAAGCATTCTGG - Intronic
1188024567 X:25194895-25194917 GTTCCCAGACACACTGATTCTGG - Intergenic
1188201094 X:27293551-27293573 GCTCCCTGCCAGACTGAATCAGG - Intergenic
1195710983 X:107773753-107773775 CAGCCCAGCCCCAGTGATTCTGG - Intronic
1197180078 X:123525511-123525533 GTTCCCTCCCACATTGACTCTGG + Intergenic
1198528198 X:137523462-137523484 AAGCCCAGCCACAGTGAATCAGG - Intergenic
1199232350 X:145451261-145451283 TATCCCTACCATATTGATTCTGG + Intergenic