ID: 1105855674

View in Genome Browser
Species Human (GRCh38)
Location 13:24370004-24370026
Sequence ATGCAATAGTCAACACCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105855674_1105855675 -10 Left 1105855674 13:24370004-24370026 CCAATTGGTGTTGACTATTGCAT 0: 1
1: 0
2: 1
3: 6
4: 121
Right 1105855675 13:24370017-24370039 ACTATTGCATAGCCGTGCTGTGG 0: 1
1: 0
2: 1
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105855674 Original CRISPR ATGCAATAGTCAACACCAAT TGG (reversed) Intergenic
903072605 1:20734194-20734216 ATGAAATAGTCAAAACCAGAGGG + Intergenic
913031230 1:114905031-114905053 GTACAATACTCAACACCAAATGG - Intronic
916284167 1:163086157-163086179 TTTCAATAATCAACACCAAATGG + Intergenic
918516016 1:185364243-185364265 ATGCAAAAATCAACTCCAAATGG + Intergenic
920990488 1:210934020-210934042 ATGCAAAAATCAACACGAAATGG + Intronic
924932234 1:248742060-248742082 ATGGAATATACAACACCAAGGGG + Intronic
1062778263 10:174536-174558 ATACATTAGTCAAAACCCATGGG + Intronic
1062778272 10:174636-174658 ATACATTAGTCAAAACCCATGGG + Intronic
1063053765 10:2481096-2481118 ATGGAAAAGTCAACACTATTTGG - Intergenic
1063636256 10:7785987-7786009 ATGCATTTGTCAAAACCCATAGG + Intronic
1063939125 10:11108712-11108734 ATGAGAAAGTCAACACCAAGTGG - Intronic
1074547518 10:114412798-114412820 CTGAAATAGTCTACACCCATGGG - Intergenic
1075774119 10:124968614-124968636 ATACAATAGACAACACAACTAGG - Intronic
1075961918 10:126574625-126574647 ATGCAATATACAACATTAATAGG + Intronic
1080251732 11:30241295-30241317 ATGAAATACTCAACACAAAAAGG + Intergenic
1082648509 11:55757798-55757820 ATGAAAAAGTCAAAAACAATAGG - Intergenic
1083374475 11:62208553-62208575 ACACAATAGTGTACACCAATGGG - Intergenic
1085241141 11:75057015-75057037 ATGCATTAGGCAACATCATTAGG - Intergenic
1088657271 11:112012540-112012562 ATGCAAAAATCAACTCCAAATGG + Intronic
1091211893 11:133868345-133868367 ATGCATTCTTGAACACCAATAGG - Intergenic
1096606519 12:52770185-52770207 AGGGAATGGTCAACACCAGTGGG - Intronic
1097649825 12:62283489-62283511 AGGCAATAGACAAGAACAATAGG + Intronic
1098498863 12:71167021-71167043 ATGCAATGGTGAACACAAACAGG - Intronic
1105702917 13:22947217-22947239 ATGCACTAGCCAACACTAACAGG - Intergenic
1105855674 13:24370004-24370026 ATGCAATAGTCAACACCAATTGG - Intergenic
1107957848 13:45533805-45533827 ATGAAAGAGACAACACCAAATGG - Intronic
1111610447 13:90599760-90599782 ATGCCAAGGTCAAGACCAATGGG + Intergenic
1113245142 13:108386859-108386881 ATGAAAAAGTCAAGATCAATAGG - Intergenic
1116063128 14:39949063-39949085 GTGCATTAATCAATACCAATTGG - Intergenic
1121815874 14:96928353-96928375 AAGCAATAATCAACAGAAATTGG - Intronic
1122844553 14:104485455-104485477 ATGCAATAGCCAACACTAATTGG - Intronic
1123508074 15:20965832-20965854 ATGGAATAGTCAAAATGAATGGG + Intergenic
1123565293 15:21539573-21539595 ATGGAATAGTCAAAATGAATGGG + Intergenic
1123601556 15:21976857-21976879 ATGGAATAGTCAAAATGAATGGG + Intergenic
1124782842 15:32652161-32652183 ATGAAATAGTAAAAACCACTGGG + Intronic
1125700603 15:41679594-41679616 ATGCAATACAAAACAGCAATGGG - Intronic
1202973664 15_KI270727v1_random:266680-266702 ATGGAATAGTCAAAATGAATGGG + Intergenic
1135195428 16:20390220-20390242 TTGCAATGGTCAAAACAAATTGG - Intronic
1139108990 16:63865383-63865405 ATGTAAGACTCAACACCAAATGG - Intergenic
1139680931 16:68562208-68562230 ATGCATTTGTCAAAACCAACTGG - Intronic
1141236570 16:82223333-82223355 ATACAAAAGTCAACTCCAAATGG - Intergenic
1144492840 17:15729572-15729594 ATGAAACAGACAACACTAATTGG + Intergenic
1144566487 17:16363640-16363662 ATGCAACACTCAACTCCAAAGGG + Intergenic
1144907413 17:18647087-18647109 ATGAAACAGACAACACTAATTGG - Intronic
1146563243 17:33889828-33889850 ATGCAAAAGTCAGAACCATTAGG + Intronic
1147338337 17:39739898-39739920 GTGGAATCGTCAAGACCAATGGG - Intronic
1148802702 17:50241758-50241780 ATGTAATTGTCAACATCATTGGG + Intergenic
1149517934 17:57294495-57294517 ATGCAAGAATCAACTCCAAGGGG + Intronic
1155099171 18:22591621-22591643 GGGCAATAGTCAACAACATTAGG + Intergenic
1162228463 19:9244535-9244557 ATGCAAAAGTTAACACAAAATGG + Intergenic
1166967449 19:46538088-46538110 AGCCAATAGTCAACATCAACTGG + Intronic
927001215 2:18795841-18795863 ATGCAAAAGACAACCCCACTTGG - Intergenic
930174540 2:48288416-48288438 TTGCAATAGATAATACCAATAGG - Intergenic
933328901 2:80872250-80872272 ATTCAATAGTCAAAACACATAGG + Intergenic
941289150 2:163653269-163653291 ATGCAATAGTAAATAAGAATAGG + Intronic
944348310 2:198695822-198695844 ATGCACAAGTAAACCCCAATTGG + Intergenic
947387202 2:229603155-229603177 ATGCAAAAATAAACACCAATTGG + Intronic
948111461 2:235459548-235459570 AAGAAATAGTCAACAGCTATAGG + Intergenic
1169558548 20:6774160-6774182 AAGCAAAAGTCAAAACCATTAGG - Intronic
1171096906 20:22341040-22341062 ATGCATTTGTCAAAACCCATAGG + Intergenic
1176801482 21:13434931-13434953 ATTGTATAGTCAACAACAATTGG + Intergenic
1176879839 21:14178708-14178730 AGTCAATAGACAACACCCATAGG - Intronic
1178427316 21:32489246-32489268 ATGCAAAAATCAACACAAAATGG - Intronic
1178769764 21:35492226-35492248 GTGCAATAGCCATCACCAATTGG + Intronic
1182026712 22:27124785-27124807 TGGCAATAGTCAACACCAGCTGG + Intergenic
951953084 3:28223503-28223525 ATGAAAGAGACAAAACCAATAGG + Intergenic
952288113 3:31987828-31987850 ATGCAAAAGTCACCTCCAAGTGG + Intronic
952584706 3:34877336-34877358 ATGCAATTCTGAAAACCAATAGG - Intergenic
957773980 3:84731605-84731627 ATGCAATAGTTAACCCCAGGAGG - Intergenic
957783010 3:84844118-84844140 ATCCAAATGTCAACATCAATAGG + Intergenic
958492079 3:94788974-94788996 CTGGAATATTCAACACCATTAGG - Intergenic
959493106 3:107015987-107016009 TTACAATAGCCAACATCAATAGG - Intergenic
960087306 3:113605098-113605120 AAGCAATAGTGAATTCCAATTGG - Intronic
960165681 3:114398589-114398611 TTGCATTAGTTAACACCAAATGG + Intronic
961089902 3:124101893-124101915 ATGCAATAGTTAACAAGAACAGG - Intronic
962183166 3:133230014-133230036 ATGTAAAAGCCAAAACCAATTGG + Intronic
962347847 3:134633514-134633536 ATGCATTTTTCTACACCAATAGG - Intronic
963004742 3:140716551-140716573 ATGCTATGCCCAACACCAATGGG - Intergenic
969121856 4:4916704-4916726 ATGCAAGTGTGAACTCCAATAGG + Intergenic
970268094 4:14312056-14312078 GTGCATTTGTCAACACCACTGGG - Intergenic
970733098 4:19132094-19132116 ATTCAATAGTCAACCTCACTAGG - Intergenic
971941564 4:33222576-33222598 ATGGAATACTCAAAGCCAATTGG - Intergenic
976902077 4:90190935-90190957 ATGTAATAGCTAACACAAATTGG + Intronic
983743499 4:171165294-171165316 TTGCAATAGTCAACAGGCATTGG - Intergenic
984258937 4:177420645-177420667 ATGCATTTGTCAAAACCCATAGG - Intergenic
989024091 5:37045456-37045478 ATTAAAAAGTCAACACCAAGAGG + Exonic
989325136 5:40183862-40183884 ATGCTATACTCAACTCCAGTTGG + Intergenic
989329245 5:40236403-40236425 ATGCAATAGTAAACATAAAAAGG - Intergenic
989730965 5:44648144-44648166 ATGGAAGAGTCAAAACCATTAGG - Intergenic
993775437 5:91989223-91989245 ATGCATTTGTCAAAACCCATTGG + Intergenic
996545084 5:124669480-124669502 ATACAATACTCAAAACAAATGGG + Intronic
998748426 5:145289187-145289209 ATGCAATTGTTAAAACCCATAGG - Intergenic
998974289 5:147627188-147627210 ATGCAATTGTCAAAAGCCATGGG + Intronic
1001053831 5:168433474-168433496 ATGCAGTAGTTAATACCAGTAGG + Intronic
1005007559 6:21304357-21304379 ATGCAAAAATCAACTCCAAATGG + Intergenic
1008922183 6:56853793-56853815 CTGCACCAGTCAACACCCATGGG - Intronic
1010923550 6:81714879-81714901 ATGCAATTGTCATTATCAATGGG + Intronic
1014996662 6:128154608-128154630 ATACAACAGTCAAAACCAATGGG + Intronic
1020958458 7:14772715-14772737 ATGCCATAGACAGCAACAATGGG - Intronic
1025725856 7:64058924-64058946 ATGCAATAGCCATAAGCAATAGG - Intronic
1027613395 7:80390830-80390852 ATTCAATAGTTAATACCAAGTGG + Intronic
1031307454 7:120149266-120149288 ATGCAAAAGTTAACTCAAATGGG - Intergenic
1031326034 7:120399137-120399159 ATACAATAGCCAACACTAAAGGG - Intronic
1037355760 8:18017887-18017909 AGACAATAATCAACACCAATGGG + Intronic
1039254210 8:35701258-35701280 ATGCAGTATTCAAAACCAGTGGG + Intronic
1039619988 8:38987956-38987978 ATGTAATTGTCAACATAAATGGG + Exonic
1039689017 8:39841987-39842009 ATGAAATATTCAACACTAAAAGG - Intergenic
1041498651 8:58515353-58515375 ATGCATTTGTCAAAACCCATAGG - Intergenic
1041769678 8:61459235-61459257 ATGCAATGGTCTTCACCACTTGG - Intronic
1047809029 8:128387689-128387711 ATGCAATAAACAAGACAAATAGG - Intergenic
1048771661 8:137902031-137902053 ATACATTAGTCAAAACCATTTGG + Intergenic
1053563430 9:39220949-39220971 ATGCAAAAATCAACACAAAATGG - Intronic
1053829215 9:42058870-42058892 ATGCAAAAATCAACACAAAATGG - Intronic
1054133717 9:61398117-61398139 ATGCAAAAATCAACACAAAATGG + Intergenic
1054601344 9:67128577-67128599 ATGCAAAAATCAACACAAAATGG + Intergenic
1055015682 9:71615405-71615427 ATGCAACAGGCAACAGCAATGGG + Intergenic
1056921793 9:90797386-90797408 ATACAATATACAACACCAAGAGG + Intergenic
1056921948 9:90798991-90799013 ATACAATATACAACACCAAGAGG - Intergenic
1058907549 9:109494159-109494181 CTGCATTAGTGAACACCAAGAGG + Intronic
1059987045 9:119830560-119830582 AGGCAAAAGGCAACACAAATTGG - Intergenic
1061000891 9:127901953-127901975 AAGCAAAAGTCAAGAACAATGGG + Intronic
1062054536 9:134464009-134464031 ATTCCAGAGTCAACACCAATAGG + Intergenic
1192018243 X:67355488-67355510 GTGCAATTGTCAAGACCAAATGG + Intergenic
1192280042 X:69675369-69675391 ATACAATATTGAACACTAATGGG - Intronic
1194103694 X:89739502-89739524 ATGCAATATTCAACTTTAATTGG - Intergenic
1195472724 X:105250319-105250341 ATTCATTTGTCAAAACCAATTGG + Intronic
1195631645 X:107061962-107061984 ATGCATTTGTCAAAACCCATAGG - Intergenic
1197950633 X:131892174-131892196 ATGCAAAAGTCAACTCGAAATGG + Intergenic
1198717606 X:139576422-139576444 ATGCAACTGTCAACAGCATTAGG - Intergenic