ID: 1105855675

View in Genome Browser
Species Human (GRCh38)
Location 13:24370017-24370039
Sequence ACTATTGCATAGCCGTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 38}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105855674_1105855675 -10 Left 1105855674 13:24370004-24370026 CCAATTGGTGTTGACTATTGCAT 0: 1
1: 0
2: 1
3: 6
4: 121
Right 1105855675 13:24370017-24370039 ACTATTGCATAGCCGTGCTGTGG 0: 1
1: 0
2: 1
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105855675 Original CRISPR ACTATTGCATAGCCGTGCTG TGG Intergenic
917484661 1:175444771-175444793 ACCACTGCAGAGCCTTGCTGGGG + Intronic
918781015 1:188701248-188701270 ATTATGGCAAAGTCGTGCTGGGG + Intergenic
920801406 1:209191145-209191167 ACTATGGCAGAGCCATGTTGAGG + Intergenic
923470073 1:234282504-234282526 ACTTTTACTTAGCCTTGCTGGGG + Intronic
1063667169 10:8069755-8069777 TGTCTAGCATAGCCGTGCTGAGG + Intronic
1064493812 10:15886881-15886903 ACTATTTCATACACGTGCTGTGG - Intergenic
1068938070 10:62655559-62655581 ACACTTGCAGAGTCGTGCTGTGG + Intronic
1081177534 11:39947063-39947085 ACTATTCCATAGGGTTGCTGAGG - Intergenic
1082629168 11:55520760-55520782 ACCATTGCCTAGCCTTGCTTAGG - Intergenic
1098260836 12:68668923-68668945 CCTATTTCATAGCATTGCTGAGG - Exonic
1100313346 12:93418660-93418682 TCTGTTGGATAGCAGTGCTGTGG - Intronic
1105702918 13:22947230-22947252 GCTAGTGCATAGCAGTGCTGTGG + Intergenic
1105855675 13:24370017-24370039 ACTATTGCATAGCCGTGCTGTGG + Intergenic
1110352768 13:74528944-74528966 ACTATTGCATTGCTGTGGTTGGG + Intergenic
1115755040 14:36520842-36520864 ACTTTTGCATGGCTGAGCTGCGG - Intronic
1120157947 14:81114613-81114635 ACCATTGCACAGGCGTGCTTAGG + Intronic
1122844554 14:104485468-104485490 GCTATTGCATAGCCATGCTGTGG + Intronic
1138969524 16:62128088-62128110 AATATTGCCTAGCGATGCTGGGG + Intergenic
1152749915 17:82057904-82057926 ACTTTTGCACACGCGTGCTGAGG + Exonic
1157382001 18:47227009-47227031 ACTTATGCATAGCCCTGATGGGG - Intronic
1160372637 18:78387514-78387536 ACTTTTGCATTGCTGTGGTGAGG - Intergenic
930580347 2:53203677-53203699 ACTATTGCATAAGAGTTCTGAGG - Intergenic
936026443 2:109034459-109034481 AGTATTGCAGAGCCAAGCTGAGG + Intergenic
947493763 2:230618030-230618052 ACTATTCCAAAGCCCTGCTCAGG + Intergenic
960726305 3:120673850-120673872 CCTATTTCATAGCTGTGGTGAGG - Intronic
968694043 4:2012574-2012596 AGTATTGCATAACCTTGATGTGG + Intronic
976349286 4:84042630-84042652 GCTATAACATAGCCATGCTGTGG + Intergenic
1003535777 6:6974082-6974104 ACTTTTGAATAGCCGGGTTGGGG - Intergenic
1008570690 6:52813844-52813866 CCTATGGCATACCCATGCTGGGG - Intergenic
1013545154 6:111149345-111149367 ACAGTGGCATAGCCTTGCTGAGG - Intronic
1017536025 6:155348959-155348981 ACTTTTGCATAGGGCTGCTGTGG + Intergenic
1026186573 7:68086396-68086418 ACTCTTCCAGAGCTGTGCTGTGG - Intergenic
1026451080 7:70530201-70530223 GCAAATGCATATCCGTGCTGGGG + Intronic
1040915419 8:52563680-52563702 ATTGCTGCATGGCCGTGCTGCGG + Intronic
1057859755 9:98631026-98631048 TCTACTGCATAGCGCTGCTGGGG + Intronic
1060744930 9:126125075-126125097 GCTCTCGTATAGCCGTGCTGTGG + Intergenic
1062561059 9:137142092-137142114 TCTACCGCATACCCGTGCTGGGG + Exonic
1203774836 EBV:67096-67118 TCTACAGCATAGCCCTGCTGCGG + Intergenic
1203626382 Un_KI270750v1:29385-29407 ACTATTGAAAATCCGTCCTGAGG + Intergenic
1188003888 X:25004751-25004773 CCTCTAGCATAGCCGCGCTGAGG - Exonic
1194375598 X:93129037-93129059 ATTTTTACATAGCCTTGCTGAGG - Intergenic
1194725941 X:97397508-97397530 ACTCAGGCATAGCCCTGCTGAGG + Intronic