ID: 1105855675

View in Genome Browser
Species Human (GRCh38)
Location 13:24370017-24370039
Sequence ACTATTGCATAGCCGTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 38}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105855674_1105855675 -10 Left 1105855674 13:24370004-24370026 CCAATTGGTGTTGACTATTGCAT 0: 1
1: 0
2: 1
3: 6
4: 121
Right 1105855675 13:24370017-24370039 ACTATTGCATAGCCGTGCTGTGG 0: 1
1: 0
2: 1
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105855675 Original CRISPR ACTATTGCATAGCCGTGCTG TGG Intergenic