ID: 1105856059

View in Genome Browser
Species Human (GRCh38)
Location 13:24373237-24373259
Sequence CTCCTCAGGTACACTTTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 121}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105856059_1105856066 6 Left 1105856059 13:24373237-24373259 CCTGATAAAGTGTACCTGAGGAG 0: 1
1: 0
2: 4
3: 17
4: 121
Right 1105856066 13:24373266-24373288 TTATAGTTTGGTTTTATGTTGGG 0: 1
1: 1
2: 3
3: 74
4: 909
1105856059_1105856067 12 Left 1105856059 13:24373237-24373259 CCTGATAAAGTGTACCTGAGGAG 0: 1
1: 0
2: 4
3: 17
4: 121
Right 1105856067 13:24373272-24373294 TTTGGTTTTATGTTGGGAACAGG 0: 1
1: 0
2: 1
3: 23
4: 300
1105856059_1105856065 5 Left 1105856059 13:24373237-24373259 CCTGATAAAGTGTACCTGAGGAG 0: 1
1: 0
2: 4
3: 17
4: 121
Right 1105856065 13:24373265-24373287 GTTATAGTTTGGTTTTATGTTGG 0: 1
1: 0
2: 2
3: 29
4: 329
1105856059_1105856068 25 Left 1105856059 13:24373237-24373259 CCTGATAAAGTGTACCTGAGGAG 0: 1
1: 0
2: 4
3: 17
4: 121
Right 1105856068 13:24373285-24373307 TGGGAACAGGCCCCCAGATCTGG 0: 1
1: 99
2: 91
3: 73
4: 220
1105856059_1105856064 -6 Left 1105856059 13:24373237-24373259 CCTGATAAAGTGTACCTGAGGAG 0: 1
1: 0
2: 4
3: 17
4: 121
Right 1105856064 13:24373254-24373276 GAGGAGGTTGGGTTATAGTTTGG 0: 1
1: 1
2: 8
3: 43
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105856059 Original CRISPR CTCCTCAGGTACACTTTATC AGG (reversed) Intergenic
902801697 1:18834281-18834303 CGCCTCAGACACACTTTCTCAGG - Intergenic
906205877 1:43986032-43986054 CTGCTCAGGTCCCCTTTGTCAGG - Intronic
920529184 1:206689403-206689425 CTCCACAGGTACACAGTATGAGG - Intronic
921740781 1:218682108-218682130 ATCCTAAGACACACTTTATCTGG - Intergenic
924829258 1:247575221-247575243 CACCTCAGGCACACTTTCTCAGG + Exonic
1064104170 10:12487272-12487294 CTCCTCAAGGTCTCTTTATCGGG + Intronic
1065241132 10:23706408-23706430 TTCCACAAATACACTTTATCAGG + Intronic
1065696469 10:28385117-28385139 TGCCTCAGGTGCACTTTCTCAGG - Intergenic
1066958185 10:42192911-42192933 CTCCGCTGTTACACTTTATAAGG - Intergenic
1067739608 10:48884768-48884790 CTCCTCAGGAACCGTTTCTCTGG + Intronic
1068066158 10:52134714-52134736 CTCCTCAGGTTCATTCTATGTGG - Intronic
1070441501 10:76450558-76450580 TTCCTCAGTAACACTTCATCTGG + Intronic
1071187868 10:83064330-83064352 TGCCTCAGGCACACTTTCTCAGG - Intergenic
1076459690 10:130633201-130633223 CACCTCAGGCACACATTTTCAGG - Intergenic
1077352953 11:2101193-2101215 CTCCTCTGGTACACTGTGTCTGG - Intergenic
1080068546 11:28049640-28049662 CTCCTCACGTACATATTAACAGG - Intronic
1080407255 11:31990546-31990568 CTCCCCAGCTACACTTTAATTGG + Intronic
1085507531 11:77068742-77068764 CTGCTCTGGGAAACTTTATCAGG - Intronic
1087184341 11:95171504-95171526 CTCCTCTGGTACAATATATTGGG - Exonic
1088340454 11:108759824-108759846 CTCCCCAGGTATATTTTATCAGG + Intronic
1090173742 11:124628484-124628506 CTCTACAGGAGCACTTTATCTGG - Intronic
1090956660 11:131519128-131519150 CTCCTCAGGGCCACTTCATGAGG + Intronic
1092690688 12:11106856-11106878 CTCTTCAGGTAGTCTTTATGAGG + Intronic
1093188615 12:16050037-16050059 CACCTCAGGCACACTTTCGCAGG + Intergenic
1093753454 12:22827503-22827525 CACCTCAGGCACACGTTCTCAGG + Intergenic
1093864715 12:24211242-24211264 CTCCTCAGATACACTGTCTAGGG - Intergenic
1094597554 12:31879006-31879028 CACCTCAGGCACACTTTCTCAGG - Intergenic
1097219435 12:57438899-57438921 CTCCTCTGGTACATTTCTTCAGG + Intronic
1098638898 12:72816666-72816688 TGCCTCAGGCACACTTTCTCAGG + Intergenic
1098712243 12:73777314-73777336 TGCCTCTGGTACACTTTTTCAGG + Intergenic
1101855769 12:108441491-108441513 CTCCTTGGGCACACTTTCTCAGG + Intergenic
1103422765 12:120801676-120801698 CTCCCCAAGTAAACTTGATCTGG + Intronic
1104795537 12:131514597-131514619 CACCTCAAGTTCACTTTTTCCGG - Intergenic
1104810120 12:131615332-131615354 CTCCTCGGGTACATGTTCTCAGG + Intergenic
1105587138 13:21755970-21755992 TACCTCAGGCACACTTTCTCAGG + Intergenic
1105703418 13:22951087-22951109 CACCTCAGGTACACTTTCTCAGG - Intergenic
1105856059 13:24373237-24373259 CTCCTCAGGTACACTTTATCAGG - Intergenic
1106390216 13:29328306-29328328 TGCTTCAGGCACACTTTATCAGG - Intronic
1106944386 13:34810523-34810545 CACCTCAGGTACCCATTCTCAGG + Intergenic
1107129119 13:36876400-36876422 GTCCTCAGACACACTTTACCTGG - Intronic
1107484312 13:40811715-40811737 CTGCTTAGGAACACTTTATTGGG - Intergenic
1111691377 13:91567469-91567491 CAACTCAGGTACACTGAATCAGG + Intronic
1113918738 13:113891581-113891603 CACCTCAGACACACTTTCTCAGG + Intergenic
1115640507 14:35332792-35332814 CTCTTGAAGTACACTTTCTCAGG - Intergenic
1116911997 14:50477610-50477632 TTTCACAGGTACGCTTTATCAGG + Intronic
1117945784 14:61018744-61018766 GTCCTCAGGCACATTTTATATGG + Intronic
1118000628 14:61519677-61519699 CTCCTCACAGACACTTAATCTGG - Intronic
1122844964 14:104488646-104488668 CACCTCAGGCACACTTTCTCAGG - Intronic
1126945826 15:53818935-53818957 CACCTCAGGCACCCTTTCTCAGG - Intergenic
1127806043 15:62521428-62521450 TGCCTCAGGCACACTTTCTCAGG - Intronic
1128081142 15:64857615-64857637 CTCCTAAGGAACCCTGTATCTGG - Intronic
1128607692 15:69048951-69048973 CTCCGTAGGTGGACTTTATCTGG + Exonic
1130427237 15:83813635-83813657 CTCCTCAGGTTCACTCTGTCAGG + Intronic
1139117834 16:63978704-63978726 TACCTCAGGCACACTTTCTCAGG + Intergenic
1148821875 17:50364589-50364611 CTCCTCAGATCCAGTTTCTCAGG + Intergenic
1151093195 17:71466094-71466116 CTCCTCAGGGAGACCTTCTCTGG - Intergenic
1153573998 18:6502571-6502593 TGCCTCAGGCACACTTTCTCAGG + Intergenic
1159735549 18:72093196-72093218 TTTCTTAGGTACCCTTTATCAGG + Intergenic
1160344193 18:78118128-78118150 TTCCACAGGTACACTTTATCAGG + Intergenic
1163187446 19:15649032-15649054 CTCCCCAGGGACCCTTTACCCGG - Intronic
1167441041 19:49509048-49509070 CTCCTGAGGGACACTGTAACAGG + Intronic
925129378 2:1483557-1483579 CACCTCAGGTGCAATTTATGTGG - Intronic
927950713 2:27166867-27166889 CTCCTCAGGCACACTTTCTCAGG + Intergenic
930430168 2:51265487-51265509 CACCTCAGGCACACTTTCTCAGG - Intergenic
932375854 2:71235359-71235381 ATTCTCAGATACCCTTTATCAGG + Intergenic
933144621 2:78836475-78836497 CTCCTCTGCTACACTAGATCTGG - Intergenic
935850522 2:107214102-107214124 CACCTCAGGCACACTTTCTCAGG - Intergenic
938957288 2:136310239-136310261 AACCTCAGGCACACTTTTTCAGG + Intergenic
940819584 2:158337324-158337346 CTTCACAGCTACAGTTTATCAGG + Intronic
943285096 2:185988475-185988497 CTTCTCAGGCAGACTTTTTCAGG + Intergenic
943309635 2:186310206-186310228 CTCCCCAAGTCCACTGTATCTGG - Intergenic
947446420 2:230167060-230167082 CTCCTCAGGTATGGTTTATTGGG - Intergenic
948820357 2:240540291-240540313 TGCCTCAGGCACACTTTCTCAGG + Intronic
1170839432 20:19912146-19912168 CTCCTCAAGTACACGTCAACTGG + Intronic
1171238007 20:23543673-23543695 CACCTCAGCCACACTTTCTCAGG - Intergenic
1175856317 20:62122675-62122697 CTCCTCAGGCACCCCGTATCTGG + Exonic
1176284191 21:5010524-5010546 CGCCTCAGGTGCACTTCCTCGGG - Intergenic
1178201770 21:30415055-30415077 ATCCTAAGGTACACCTTATTAGG - Intronic
1179872990 21:44252951-44252973 CGCCTCAGGTGCACTTCCTCGGG + Intronic
1179956960 21:44746453-44746475 CACGTCAGGCACACTTTCTCAGG - Intergenic
1185331046 22:50252159-50252181 CTCATCAGGTCCACTTTGGCTGG + Intronic
949241714 3:1880527-1880549 CTCCTCATGTATAATATATCAGG + Intergenic
949764483 3:7511163-7511185 CTCCTCAGGCTCACTTTTTCTGG - Intronic
952581443 3:34838038-34838060 TGCCTCAGGTGCACTTTCTCAGG + Intergenic
953034390 3:39199498-39199520 TTCATCAGAAACACTTTATCTGG + Intergenic
953463522 3:43100454-43100476 CTCCTCAGGGAGACTTGTTCCGG - Intronic
964081194 3:152760087-152760109 TCCCTCAGCTACACTTTCTCAGG + Intergenic
967654702 3:192033077-192033099 CTCTTCCGGTACAATATATCAGG - Intergenic
971245631 4:24925054-24925076 CTCCTTAGGTACAGTTTTTTGGG + Intronic
976314838 4:83648324-83648346 CACCTCAGGCACACTTTCTCAGG - Intergenic
980999356 4:139813611-139813633 CTTCTCATGTACCCTTTCTCAGG + Intronic
983836702 4:172395868-172395890 CTCCTCAGGGAGGCTGTATCAGG - Intronic
984011910 4:174381598-174381620 TTCCTCAGGTCCATTTTGTCAGG + Intergenic
984671365 4:182491924-182491946 CTCAGCAGGTGCACTTTACCTGG - Intronic
985354499 4:189103246-189103268 CTCCTCAGCTCCCCCTTATCTGG - Intergenic
986354440 5:6909863-6909885 CACGTCAGGTGCACTTTTTCAGG + Intergenic
987580508 5:19785078-19785100 CACCTCAGGCACACATTCTCAGG + Intronic
991030161 5:62074188-62074210 CACCTCAGGCACACTTTCTCAGG - Intergenic
991464683 5:66898045-66898067 CACCTCAGGTACCTTTTATGCGG + Intronic
992560571 5:77948685-77948707 CTCCACATGCACACCTTATCAGG - Intergenic
992754849 5:79894721-79894743 CACCTCAAGCACACTTTTTCAGG - Intergenic
993742845 5:91561994-91562016 CTCCTCAGCTATGCTTGATCTGG + Intergenic
994992826 5:107019033-107019055 CTGCTTTGGTAAACTTTATCTGG - Intergenic
996973012 5:129395679-129395701 TGCCTCAGGCACACTTTCTCAGG + Intergenic
999984975 5:156994624-156994646 GTCCTCAGGCACACGTTCTCAGG - Intergenic
1000502962 5:162075822-162075844 CTCTTCAGACACACTTGATCAGG + Intronic
1002407939 5:179051072-179051094 CTCCTCAGGGTCACTTTACAGGG + Intergenic
1003392759 6:5727676-5727698 CTCCTCAGACCCACTTTATCTGG - Intronic
1007180232 6:39924172-39924194 CTCCTCAGGTCAACCTTATAAGG + Intronic
1010127376 6:72448671-72448693 TTCCTTAGGTACATTTTCTCAGG + Intergenic
1010866235 6:80979478-80979500 CTGGTCAGGTATACTTTATCAGG - Intergenic
1011585085 6:88916106-88916128 ATCCTCAGGAACACTTGATACGG - Intronic
1014793017 6:125696176-125696198 TTTCACAGATACACTTTATCAGG - Intergenic
1016134941 6:140529009-140529031 CTCCTGAGGTACATTTGATGAGG + Intergenic
1017063727 6:150509416-150509438 CTCCTCAGGCACACTTTCTCAGG + Intergenic
1018550801 6:164996694-164996716 CTCCCCAGTTATACTTTATTTGG + Intergenic
1019269936 7:141228-141250 CTCCTCAGGCACACGTTCTCAGG + Intergenic
1020402527 7:7795177-7795199 CGTCTCAGGCACACTTTCTCAGG + Intronic
1022323129 7:29305648-29305670 CTACACAAGTAAACTTTATCAGG - Intronic
1024013241 7:45288397-45288419 CACCTCAGGCACATTTTCTCAGG - Intergenic
1025169771 7:56745897-56745919 CTTCTCAAGTACACATTCTCAGG - Intergenic
1025702120 7:63829814-63829836 CTTCTCAAGTACACATTCTCAGG + Intergenic
1027476546 7:78638990-78639012 CTCCTCATGTAAAATTAATCTGG + Intronic
1028707942 7:93872709-93872731 TTCCTCAGGTAAATTTTATATGG - Intronic
1029157814 7:98529649-98529671 GCCCTCAGGTACACTTTCTCAGG - Intergenic
1029176632 7:98669387-98669409 CCTCTCAGGGACACTTCATCTGG - Intergenic
1029192485 7:98781579-98781601 CTCCTTGGGCACACTTTCTCAGG - Intergenic
1030186337 7:106765777-106765799 CTACTCAGGTCCTGTTTATCTGG + Intergenic
1032590208 7:133185152-133185174 CCTCACAGGTACACTGTATCAGG + Intergenic
1035174633 7:157041580-157041602 ATCCTCAGGCAAACTTGATCTGG - Intergenic
1036921338 8:12858332-12858354 CTCCAGAGGTACAAGTTATCTGG - Intergenic
1037088420 8:14881716-14881738 CCTATCAGGTACACTTGATCTGG - Intronic
1039895124 8:41711783-41711805 CGCCTCAGACACACTTTCTCAGG + Intronic
1042748071 8:72128941-72128963 TGCCTCAGGCACACTTTCTCAGG + Intergenic
1050464372 9:5905822-5905844 CACCTCAGGCACACTTTCTCAGG + Intronic
1187583688 X:20636652-20636674 CTCTTCATATACAATTTATCAGG + Intergenic
1190557963 X:51656131-51656153 ATCCTCAGGAACACTTGATGTGG + Intergenic
1190992784 X:55569159-55569181 CTTATCAGGTTCACTTGATCCGG - Intergenic
1193581936 X:83275957-83275979 ATCCTCATTTACACTTTATGGGG + Intergenic
1194822255 X:98524031-98524053 CACCTCAGGCACACGTTCTCTGG + Intergenic
1196223012 X:113134451-113134473 CACCTCAGGCACACTTTCTCAGG - Intergenic
1199174308 X:144766770-144766792 CTTCTCATGTACCCTTTCTCAGG - Intergenic
1199848505 X:151708666-151708688 TTCCTCAGGAAGACTTTCTCTGG - Intergenic