ID: 1105857202

View in Genome Browser
Species Human (GRCh38)
Location 13:24384920-24384942
Sequence CTGGCCCTCCTGATTCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 2, 1: 0, 2: 0, 3: 13, 4: 166}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105857202_1105857212 21 Left 1105857202 13:24384920-24384942 CCTCCATGAATCAGGAGGGCCAG 0: 2
1: 0
2: 0
3: 13
4: 166
Right 1105857212 13:24384964-24384986 CATGGTGCTAAGGTGGCTGGCGG 0: 2
1: 0
2: 1
3: 24
4: 195
1105857202_1105857210 18 Left 1105857202 13:24384920-24384942 CCTCCATGAATCAGGAGGGCCAG 0: 2
1: 0
2: 0
3: 13
4: 166
Right 1105857210 13:24384961-24384983 GACCATGGTGCTAAGGTGGCTGG 0: 2
1: 0
2: 1
3: 9
4: 105
1105857202_1105857208 11 Left 1105857202 13:24384920-24384942 CCTCCATGAATCAGGAGGGCCAG 0: 2
1: 0
2: 0
3: 13
4: 166
Right 1105857208 13:24384954-24384976 AATATGAGACCATGGTGCTAAGG 0: 2
1: 0
2: 0
3: 11
4: 118
1105857202_1105857213 22 Left 1105857202 13:24384920-24384942 CCTCCATGAATCAGGAGGGCCAG 0: 2
1: 0
2: 0
3: 13
4: 166
Right 1105857213 13:24384965-24384987 ATGGTGCTAAGGTGGCTGGCGGG 0: 2
1: 0
2: 1
3: 21
4: 226
1105857202_1105857209 14 Left 1105857202 13:24384920-24384942 CCTCCATGAATCAGGAGGGCCAG 0: 2
1: 0
2: 0
3: 13
4: 166
Right 1105857209 13:24384957-24384979 ATGAGACCATGGTGCTAAGGTGG 0: 2
1: 0
2: 0
3: 13
4: 125
1105857202_1105857214 23 Left 1105857202 13:24384920-24384942 CCTCCATGAATCAGGAGGGCCAG 0: 2
1: 0
2: 0
3: 13
4: 166
Right 1105857214 13:24384966-24384988 TGGTGCTAAGGTGGCTGGCGGGG 0: 2
1: 0
2: 0
3: 9
4: 171
1105857202_1105857206 3 Left 1105857202 13:24384920-24384942 CCTCCATGAATCAGGAGGGCCAG 0: 2
1: 0
2: 0
3: 13
4: 166
Right 1105857206 13:24384946-24384968 AGCCATGGAATATGAGACCATGG 0: 2
1: 0
2: 0
3: 12
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105857202 Original CRISPR CTGGCCCTCCTGATTCATGG AGG (reversed) Intergenic
902547517 1:17199234-17199256 CTGGACCTCCTGGTGAATGGGGG - Intergenic
904602389 1:31680777-31680799 CAGGCTCCCCTGGTTCATGGTGG + Intronic
904615648 1:31748160-31748182 CTGCCCCTCCTGTTACATTGTGG - Intronic
905262568 1:36729992-36730014 CTGGCCCTTCTGAGGCATTGGGG - Intergenic
905638556 1:39572948-39572970 CTGTCCCACCTGAGTCATGGTGG - Intronic
908428604 1:64033613-64033635 CTAGACATCCTGATTAATGGAGG + Intronic
908790118 1:67772773-67772795 CTGGCCATGCTGATTCAGGCAGG + Intronic
909875793 1:80800865-80800887 CTCCCCCACCTGATGCATGGGGG + Intergenic
910163387 1:84298399-84298421 CTGGCCTTCCCCATTCCTGGGGG + Exonic
910495184 1:87818721-87818743 TTGGCCCTCCTGCTTCAAAGAGG + Intergenic
910598531 1:89005590-89005612 CTGCCTCTCCTGAGTCATGCAGG + Intergenic
915145173 1:153792646-153792668 AGGGGCCTCCTGAGTCATGGCGG - Intergenic
916089372 1:161295392-161295414 CTGGCCTTCCTCCATCATGGAGG + Intergenic
917166511 1:172118737-172118759 CTGGCTCTCCTGATGCCTGCTGG - Intronic
919199360 1:194334208-194334230 CTGTCACTCATGATTCAAGGAGG - Intergenic
920249098 1:204610668-204610690 CTGGCCCTTTTGATTCATAAGGG + Intergenic
922874349 1:228928220-228928242 CTGGCCATTCTGCTTCATGAGGG - Intergenic
923074142 1:230594302-230594324 TTGGCCATCTTGATTCCTGGGGG - Intergenic
923329725 1:232911405-232911427 CTGGCCCTCCTGATCCACCTTGG + Intergenic
1066267285 10:33788648-33788670 CTGGCCACCCTGGATCATGGTGG - Intergenic
1067528757 10:47055328-47055350 CTTTCCTTCCTGATTCCTGGAGG + Intergenic
1069293296 10:66810722-66810744 CATGCCCTCCACATTCATGGTGG + Intronic
1072381771 10:94879666-94879688 CTGTCCCTGCTGAATCATGGGGG + Intergenic
1074379837 10:112970379-112970401 GTGGCCTTACTGATTCATGGTGG - Intronic
1075745289 10:124723389-124723411 CAGCACCTCCTGATTCACGGAGG + Intronic
1081823146 11:46020366-46020388 CAGGCGCTCCTGGTTCTTGGTGG - Intronic
1084554555 11:69868160-69868182 CTGGCCCACCCCACTCATGGGGG + Intergenic
1084654384 11:70506676-70506698 CCCTCCCTCCTGCTTCATGGAGG + Intronic
1084930776 11:72553943-72553965 CTGGCCCCCTTGACTCAAGGGGG - Intergenic
1085404798 11:76255380-76255402 CTGGCCTCCTAGATTCATGGTGG + Intergenic
1087107148 11:94422274-94422296 CTCCTCCTCCTCATTCATGGTGG + Intronic
1087139004 11:94747459-94747481 CTGGCCTTCCTCATTCAGGCAGG + Intronic
1088365457 11:109035713-109035735 CTGTACCTCCTGAATCATGTTGG - Intergenic
1090183969 11:124724149-124724171 CTGGTCCTCCTGAGTGAGGGTGG - Intergenic
1091290805 11:134438711-134438733 TTTGCCCTCCTGAATCATGGAGG + Intergenic
1091311288 11:134576968-134576990 CTGGGCCTCCTGTTCCCTGGAGG + Intergenic
1091645578 12:2270024-2270046 CTGGCCCTCCAGCTTCAGGTTGG - Intronic
1091652314 12:2319431-2319453 CTCTTCCTCCTGATGCATGGTGG - Intronic
1091871203 12:3892649-3892671 CTGGGCCACCTGCTTCAGGGAGG - Intergenic
1092145564 12:6212320-6212342 CTGCCCCTTCTGATTCTTAGTGG - Intronic
1096956839 12:55534748-55534770 CTGCCTCTCCTGAGTCATGCTGG - Intergenic
1097131013 12:56810674-56810696 CTGGGCCTCCTGCTGCATGGAGG - Intergenic
1098381352 12:69872994-69873016 ATAGACCTCCTTATTCATGGAGG + Intronic
1102651370 12:114444859-114444881 CTGGCCCTCCTTGTTGCTGGGGG - Intergenic
1103322790 12:120101666-120101688 CTGGGCCTCCTGCCTCATGAGGG + Intronic
1103980783 12:124735858-124735880 CTGGGGCTGCTGATCCATGGAGG - Intergenic
1104076307 12:125392893-125392915 CTGTTCCTCCTGAGTGATGGGGG + Intronic
1105704251 13:22959868-22959890 CTGGCCCTCCTGATTCATGGAGG - Intergenic
1105857202 13:24384920-24384942 CTGGCCCTCCTGATTCATGGAGG - Intergenic
1106375722 13:29185589-29185611 CTGGCCTTCATGATTTTTGGGGG - Intronic
1108064577 13:46564340-46564362 CTGGGCCTTCTTATTAATGGTGG + Intronic
1114473253 14:22978031-22978053 CTGGCCCTCCAGCTTCTTGGTGG - Intronic
1117705644 14:58464665-58464687 CAGTCCCCCCTTATTCATGGGGG + Intronic
1118332612 14:64825648-64825670 CTGGCTCTCCTGATTCGTCCTGG + Intronic
1120711151 14:87794354-87794376 CTGGCCCTACTCATGCATGTGGG + Intergenic
1122600226 14:102917675-102917697 CTGGCCCTCTGCATTTATGGTGG + Intergenic
1122857519 14:104567036-104567058 CTGGCCCGCCTGACTCGTGAGGG + Intronic
1123039903 14:105486244-105486266 TTGGCCCTCCTGAATCTGGGGGG + Intergenic
1124609810 15:31200798-31200820 CTGGTGCTCCTGAATCACGGAGG + Intergenic
1128646687 15:69383540-69383562 CGGGCCCTCTGTATTCATGGTGG + Intronic
1128646715 15:69383661-69383683 CGGGCCCTCTGTATTCATGGTGG + Intronic
1128646792 15:69383992-69384014 CGGGCCCTCTGTATTCATGGTGG + Intronic
1128646901 15:69384410-69384432 CGGGCCCTCCGTGTTCATGGTGG + Intronic
1128646910 15:69384441-69384463 CGGGCCCTCCGTGTTCATGGTGG + Intronic
1128646945 15:69384565-69384587 CGGGCCCTCCGTGTTCATGGTGG + Intronic
1128889580 15:71318650-71318672 CTGGCCCTTCTGATTGCTGATGG - Intronic
1134109579 16:11506786-11506808 CTGCCCCTCCCCATTGATGGTGG - Intronic
1134891944 16:17848648-17848670 CCAACCCTCCTGCTTCATGGAGG + Intergenic
1136236900 16:28919891-28919913 CTGTCGCTCCTGCTTCAGGGCGG + Exonic
1136360457 16:29776073-29776095 TTGGACCTCCTGATTCAGAGAGG + Intergenic
1137801564 16:51266542-51266564 CTGGCCCTCATGATCCAAGATGG - Intergenic
1139573493 16:67827465-67827487 CTGGCCCTCCTCATCCTGGGAGG - Exonic
1139605258 16:68013685-68013707 CTGGCCCTCCTGGTTTGTGCTGG + Intronic
1139751485 16:69111672-69111694 CAGGACCTCCTCAGTCATGGAGG + Intronic
1142608650 17:1096157-1096179 GGGGCCCTCCTGCTTCCTGGTGG - Intronic
1142627301 17:1200502-1200524 CTGTCCCTCCATTTTCATGGGGG - Intronic
1143405580 17:6675210-6675232 TTGGCCCTCCTGACTCCTGCTGG - Intergenic
1143471787 17:7179828-7179850 CTGGCCCTCATGCTGCTTGGAGG - Intergenic
1144936949 17:18907237-18907259 CAGCCACTCCTGATTCCTGGGGG - Intronic
1146461660 17:33050768-33050790 ATGGCCCTCCTGCTTGGTGGTGG + Intronic
1150221046 17:63496134-63496156 CAGGCCCTCCTGAGTTGTGGAGG + Intronic
1152719256 17:81914871-81914893 CAGGCCCTCTTGACTCCTGGTGG - Intronic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1158137680 18:54224449-54224471 CTGGCCCCCCTGCTCTATGGCGG + Exonic
1158831478 18:61284124-61284146 CTGGCCTTCCAGGATCATGGAGG + Intergenic
1164764004 19:30749314-30749336 CTGGCCAGGCTGCTTCATGGAGG - Intergenic
1168147073 19:54425660-54425682 TTGCACCTCCTGAATCATGGTGG + Intronic
925343294 2:3151406-3151428 CTGCCTCTGCTGAGTCATGGAGG - Intergenic
925811417 2:7704622-7704644 CTGTGCCTCCTGAATCAGGGAGG + Intergenic
927272591 2:21229037-21229059 CTGGCCTTCCTGATTCTTGTAGG + Intergenic
932144119 2:69304257-69304279 CTGGCCCTCCTGCATCTGGGAGG - Intergenic
932257558 2:70300912-70300934 CTGGTGCACCTGCTTCATGGAGG + Exonic
935223042 2:101031362-101031384 CTGCCCCTCCTTATTCCTAGAGG + Intronic
936750794 2:115639082-115639104 CTGGCCCTGCTGACTAATGGTGG - Intronic
937326015 2:120989903-120989925 GTAGCCCTCCTGGCTCATGGAGG - Exonic
937522745 2:122732176-122732198 CTAGCACTCCTGAATCATTGTGG + Intergenic
937705808 2:124919564-124919586 CTGCCACCACTGATTCATGGTGG - Intergenic
938387046 2:130873962-130873984 CTGGCTCTCCAGATTCAGGAGGG + Intronic
943349549 2:186781082-186781104 CTGCCCCTCCTGAATGAGGGAGG - Intergenic
943778010 2:191788506-191788528 CTGGCCCTGCTGATTTCTTGAGG - Intergenic
945189975 2:207177914-207177936 CTGGCCCACCTTACTCATTGAGG - Intergenic
945825632 2:214717088-214717110 CTGCCTCTCCTGAGTCATGCAGG - Intergenic
948093144 2:235312566-235312588 CTGAGCCTCCTGTTTCCTGGTGG - Intergenic
1169704719 20:8489634-8489656 TGGGCCCTCCTGATTTCTGGAGG - Intronic
1170423044 20:16211325-16211347 CTGGCCCTCTTGACTCATTTGGG + Intergenic
1171816811 20:29792889-29792911 CTGGCTCTGCAGATTCCTGGGGG + Intergenic
1173140456 20:40477257-40477279 CTGGACCTCTTGATCAATGGAGG - Intergenic
1174067452 20:47875550-47875572 AGGACCCTCCTGATTCATGCGGG + Intergenic
1174081577 20:47973884-47973906 ATGGCCCTCCTGACTGTTGGGGG - Intergenic
1174351808 20:49973955-49973977 CTGGACCTCATGGTTCATGCCGG - Intergenic
1175703788 20:61160585-61160607 CAGTCCCTCCTGATTCATCTTGG + Intergenic
1178429230 21:32504507-32504529 CTGGCTCTGCTAATTCATGAGGG - Intronic
1180179077 21:46109920-46109942 CTGGGCCTTCTGCTCCATGGAGG - Intronic
1183540628 22:38427434-38427456 CTCGCCCTCCTGGGTCATGTAGG + Exonic
953135691 3:40179868-40179890 GTGTCCCTCTTGATACATGGAGG + Intronic
953326959 3:42020043-42020065 CTGACGGTCCAGATTCATGGTGG + Intronic
954386209 3:50245489-50245511 TTTTCCCTTCTGATTCATGGCGG - Intronic
955840700 3:63109916-63109938 CTGGGGCTGCTGAGTCATGGAGG - Intergenic
964421516 3:156509043-156509065 CAGGCGATTCTGATTCATGGTGG + Intronic
965512070 3:169579486-169579508 CTAGCCCTCCTGTTTCCTGAAGG + Intronic
965711871 3:171563631-171563653 CTGGCCCTCCAGAGCCATAGTGG + Intergenic
970317958 4:14847276-14847298 CTAGCCCTGCTGCTTCCTGGAGG - Intergenic
977021945 4:91770616-91770638 GTGGCTCTCCTGATTGATGTGGG - Intergenic
978710821 4:111778705-111778727 CTGGACCACCTTCTTCATGGAGG - Intergenic
979752350 4:124294768-124294790 CTGGCCCACCTGAATCAGAGAGG - Intergenic
981042784 4:140238583-140238605 CTGGCCCTTCTGGCTCTTGGGGG + Intergenic
981098635 4:140807101-140807123 CTGGACCTCCTGTTTCCAGGTGG - Intergenic
981750570 4:148089780-148089802 TTGGCACTGCTGACTCATGGTGG - Intronic
986065810 5:4232904-4232926 GTGGCCCTCATCAGTCATGGAGG + Intergenic
990712848 5:58604547-58604569 CTGCCTCTGCTGAGTCATGGAGG + Intronic
992883537 5:81134414-81134436 CTGGGCCTGTTGTTTCATGGTGG + Intronic
993070513 5:83156870-83156892 CTGGTACTCCCAATTCATGGGGG - Intronic
993425917 5:87764122-87764144 TTGGCCCTCCTAATCCTTGGGGG + Intergenic
994148080 5:96416926-96416948 TTGGCCCTCCTGAGTCAGGATGG - Intronic
994653702 5:102562271-102562293 CTGGCCCTCCTGAATGGGGGAGG - Intergenic
998039755 5:138944724-138944746 CTCCGCCTCCTGATTCATCGCGG - Intergenic
998909179 5:146939631-146939653 CTGGACCTCCTGCTTCATAGAGG + Intronic
999192554 5:149759467-149759489 CTGCCCCTCCTGCTCCACGGTGG - Intronic
1000871078 5:166578557-166578579 CTGGTCCTCTTGAGTCCTGGAGG - Intergenic
1001469271 5:171998218-171998240 ATGGCCCAACTGATTCATGTAGG - Intronic
1001784401 5:174399592-174399614 CCAGCCCTCCTGATGCTTGGGGG - Intergenic
1002868938 6:1148210-1148232 CTGTCCCTGCTGATTCCAGGAGG + Intergenic
1002874889 6:1202009-1202031 CTGTACCTTCTGATGCATGGGGG - Intergenic
1003794204 6:9581691-9581713 GTTGCCCTCCTCATTCTTGGTGG - Intergenic
1006607627 6:35269921-35269943 CTGAGCTTCGTGATTCATGGAGG - Intronic
1010131169 6:72495256-72495278 CTGGCTGTCCTGTTTTATGGAGG - Intergenic
1010633687 6:78231075-78231097 CTGGCTCTGCTGAGTCATGGAGG + Intergenic
1011233310 6:85187874-85187896 CTGCCTCTGCTGATTCATGTAGG - Intergenic
1013852649 6:114534683-114534705 CTGCCTCTGCTGATTCATGCAGG + Intergenic
1013937295 6:115613087-115613109 CTGGTCCTCCTGAGTTAGGGAGG - Intergenic
1014738760 6:125124355-125124377 CTGGCTCTGCTGAGTCATGCAGG - Intronic
1016411370 6:143787102-143787124 CTGGCACTGCTGCCTCATGGAGG - Intronic
1021365179 7:19769916-19769938 TTGGCCCTCCCTATTCATAGGGG - Intronic
1022538354 7:31112465-31112487 GTGGCCCACCTGATTGCTGGAGG - Intergenic
1022777718 7:33544936-33544958 CTGCCCCTGCTGAGTCATGCAGG + Intronic
1024572983 7:50739876-50739898 CTGGCTCTCCTGAGTCAGGGAGG - Intronic
1026442321 7:70455305-70455327 CTGGACCACCTTATTCCTGGTGG + Intronic
1026759437 7:73115407-73115429 CTGGCCCTGCTGACACCTGGAGG + Intergenic
1027087973 7:75278066-75278088 CTGGCCCTGCTGACACCTGGAGG - Intergenic
1027898565 7:84078561-84078583 CTTGCTCTCCTGTCTCATGGTGG + Intronic
1029394084 7:100295199-100295221 CTGGCCCTGCTGACACCTGGAGG - Intergenic
1031879218 7:127177247-127177269 CTGCCTCTCCTGAGTCATGCAGG - Intronic
1032700761 7:134377126-134377148 CTGTCTCTCCTCATTCTTGGAGG - Intergenic
1037981292 8:23256347-23256369 CAGGCCCCCCTTATCCATGGGGG - Intronic
1038490394 8:27966431-27966453 CTGGTCTTCCTGATTCTTGTGGG - Exonic
1039841098 8:41293725-41293747 CTCGCCCACCAGATTCTTGGGGG + Intronic
1047997292 8:130348929-130348951 CTGCCCCTTCTGATTCTTGCTGG - Intronic
1049249358 8:141579937-141579959 CTGGCCCTCCTCCTTCTTGCAGG - Intergenic
1051607559 9:18930334-18930356 CTGGTCCTCAAGATGCATGGAGG - Intronic
1056263388 9:84872057-84872079 CTTGCCATCCTGATTGATCGAGG - Intronic
1056559330 9:87716575-87716597 CTGACCCTCATATTTCATGGCGG - Intergenic
1056568801 9:87798225-87798247 CTGGCCCCTGTGTTTCATGGTGG + Intergenic
1057948861 9:99353763-99353785 CTGGCCCTCCTTTCTCTTGGGGG + Intergenic
1059387012 9:113972534-113972556 CACGCCCTCCTGCTTCTTGGTGG + Intronic
1060426685 9:123512286-123512308 CTGGCCCTCTGCATTCACGGAGG - Intronic
1060968332 9:127724005-127724027 CTGGGCCTCCTGACCCATGGAGG - Intronic
1061587616 9:131578940-131578962 CTTCCCCTTCTGATGCATGGAGG - Exonic
1185512847 X:676190-676212 CTGGCTCTGCTGCTTCTTGGAGG + Intergenic
1188058818 X:25575215-25575237 ATAGCCTTCCTGATTCATGCAGG - Intergenic
1189717539 X:43881753-43881775 CAGGCCCTCCTGATTCTTTGAGG - Intronic
1200385218 X:155883405-155883427 CTGGCCCACCAAATTAATGGAGG - Intronic