ID: 1105860263

View in Genome Browser
Species Human (GRCh38)
Location 13:24403899-24403921
Sequence GCCTCTCCTTTGTGGCATCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 207}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105860263 Original CRISPR GCCTCTCCTTTGTGGCATCC CGG Intergenic
900239714 1:1610023-1610045 GCCCGTCCTTCGTGGCCTCCTGG - Intergenic
900820947 1:4888152-4888174 GTCTCTTTTTTGTGGCTTCCAGG + Intergenic
901586949 1:10303790-10303812 TCCTTTGCTTTGTGGCTTCCTGG - Intronic
903592108 1:24464505-24464527 TGCACTCCCTTGTGGCATCCAGG - Intronic
903990037 1:27260833-27260855 GCCTGTCATTTGTGGCATGGTGG - Intronic
904425639 1:30421175-30421197 GCCCCTCCATTGTGACCTCCTGG + Intergenic
906529673 1:46516396-46516418 GCCACTCCAGAGTGGCATCCCGG - Intergenic
913074315 1:115328521-115328543 CCCTCTGCATTGTGGCAGCCTGG + Intronic
915236928 1:154490650-154490672 CTCTCTCCTTTGTGGCCTTCTGG - Intronic
919740870 1:200980978-200981000 GCAACTCATCTGTGGCATCCAGG + Exonic
919743747 1:200995825-200995847 GCCTCTCATTTGGTGCAACCTGG - Intronic
919866415 1:201786444-201786466 GCCTCTCCTTGGTCTCCTCCTGG - Exonic
921753697 1:218827336-218827358 TCATCTCCTTTGTGGCAACATGG - Intergenic
922958999 1:229628985-229629007 GCCTCCCCTTTGTTTCACCCTGG - Intronic
924611421 1:245576804-245576826 GCCTCTCCTAAGTGGAAGCCTGG + Intronic
1064597151 10:16957344-16957366 TCCTGTCATTTGTGGCATCATGG - Intronic
1065875440 10:29993617-29993639 TTCTCTCCTTTGTTTCATCCTGG - Intergenic
1067250041 10:44578440-44578462 GGCTTTGCTTTGTGGCATCCTGG + Intergenic
1067348659 10:45456303-45456325 GCCTCTCCTTTCTGTCTCCCAGG - Exonic
1067667127 10:48288254-48288276 GCCTCCTCCTTGTGGCTTCCAGG - Intergenic
1068567115 10:58588583-58588605 GGCTCTTGTTTGTGGCATTCTGG + Intronic
1069782483 10:70965504-70965526 GCCTCTCATTTGTGGAATGGGGG + Intergenic
1070618394 10:77987313-77987335 GCCCCTCCTTTGTAGCAGCAAGG + Intronic
1070827833 10:79401534-79401556 GTCTCTTCTTTGTGCAATCCTGG - Intronic
1073323850 10:102631323-102631345 CCCTCTCCTTTCTGGCATCCTGG + Exonic
1073849821 10:107601615-107601637 GCCTCTGCTTTGTAACATACCGG + Intergenic
1075276491 10:121097600-121097622 ACCCCTTATTTGTGGCATCCAGG - Intergenic
1076023073 10:127090109-127090131 GCTTCTCCTTTCTGGCTTCCTGG + Intronic
1077591246 11:3492582-3492604 GCCCCTCTTGTGTGGCATGCAGG + Intergenic
1080001664 11:27357534-27357556 GCCTCTCTTTTGTAGCACTCAGG - Exonic
1081195938 11:40160818-40160840 GACTCTCCTTTGCTGCATCATGG - Intronic
1081206055 11:40276985-40277007 GCCTCTCCCATGTACCATCCTGG + Intronic
1083146735 11:60765673-60765695 CCCTCTGCTTTGTGGCGTCCAGG + Intronic
1084246947 11:67864333-67864355 GCCCCTCTTGTGTGGCATGCAGG + Intergenic
1084499222 11:69525061-69525083 GCCTCTCCTTTCAGGCCCCCTGG - Intergenic
1085611507 11:77954542-77954564 CCCCCACCTTTTTGGCATCCGGG + Intronic
1089673915 11:120076346-120076368 GCCACTTCTTTGTGGAGTCCTGG - Intergenic
1091301481 11:134510695-134510717 GCCTCTCCTGTGGGGCACCCGGG - Intergenic
1092260649 12:6951765-6951787 GCCACTCTCTTGTGCCATCCAGG + Intronic
1092528573 12:9325988-9326010 GCCTTTCCTTCTTGGCTTCCTGG + Intergenic
1095981437 12:47976885-47976907 GCCTCTCCTTTGTCACCTCTGGG + Exonic
1098367855 12:69723872-69723894 GTCTTTCCTTTGTGCCCTCCTGG - Intergenic
1098881503 12:75921939-75921961 GCCTCTCTGTTCTTGCATCCAGG + Intergenic
1101198308 12:102408368-102408390 GCCTTTCCTCTCTGGCAGCCAGG + Intronic
1101578341 12:106018736-106018758 GCCTCTGCCCTGTGGCATCCAGG - Intergenic
1103661911 12:122526956-122526978 TCCTCGCCTTTGTGCCATCCGGG - Exonic
1103939519 12:124494319-124494341 GCCTCCCCCTTGTGACCTCCTGG - Intronic
1105765556 13:23555143-23555165 GCCTCTCCTCTGTGCCTTCCTGG - Intergenic
1105860263 13:24403899-24403921 GCCTCTCCTTTGTGGCATCCCGG + Intergenic
1106287761 13:28332586-28332608 GCCCCTCTTTTGTGGCACACTGG + Intronic
1107009969 13:35660657-35660679 CCCTCTCTTTGTTGGCATCCAGG + Intronic
1109273757 13:60281765-60281787 GGTTCTCCTTTTTAGCATCCAGG + Intergenic
1109766472 13:66906589-66906611 GCCTCTCCTGTGTTTCATTCTGG + Intronic
1115623575 14:35166374-35166396 TCCTCTTCTTTGAGGGATCCAGG + Intronic
1118887889 14:69881429-69881451 GGCTCTCCTTCCTGGCCTCCTGG + Intronic
1118933204 14:70262228-70262250 TCTTCTCCTTTGGGGCATGCAGG + Intergenic
1119644580 14:76339199-76339221 GCCTCTGCTGTGTGGCATCACGG + Intronic
1121122164 14:91382942-91382964 GCCCCTGCTTTGTAGCCTCCTGG - Intronic
1125179586 15:36867564-36867586 GCCTTTCCTTTGAAGCATACAGG + Intergenic
1125309900 15:38367481-38367503 GGCTCTCCTTCTTGGCATACAGG + Intergenic
1125327912 15:38555452-38555474 CCCTGTCCTATGTGGCATGCAGG + Intronic
1127960963 15:63890698-63890720 GCCTCCCCTTCCTGGCCTCCTGG + Intergenic
1128674236 15:69596874-69596896 GTCTCACCTCTCTGGCATCCTGG + Intergenic
1129820670 15:78599639-78599661 TCCTCTCCTTTGTAGCCCCCTGG + Intronic
1130067259 15:80615111-80615133 GCCTCACCTCCCTGGCATCCTGG - Intergenic
1130124773 15:81084230-81084252 TCCTCTTCCTTGTGGCATCTGGG + Intronic
1130353910 15:83113087-83113109 CCCTCTCCCAGGTGGCATCCCGG + Intronic
1131130236 15:89894246-89894268 GCCTCTCCGTTTTGGCAACCCGG - Exonic
1131310136 15:91283341-91283363 GCCTCTCCTTGGAGGCTACCTGG - Intronic
1132326650 15:100975479-100975501 GTCTCTTCTCTGTGGCATCATGG + Intronic
1137005798 16:35273527-35273549 GCCCTTCCTTTTTGGCTTCCTGG + Intergenic
1138530823 16:57633503-57633525 GCCTCTCCTAGGGGGCAGCCTGG - Intronic
1139167865 16:64591309-64591331 GTCCCTCCTTTGTGGTTTCCTGG + Intergenic
1139633885 16:68246393-68246415 GCCTCTGCTTTCAGGAATCCTGG - Intronic
1139940666 16:70603058-70603080 GCATCTCCTATGTGGCCACCAGG + Intronic
1141664415 16:85458507-85458529 GCCTCTCCATCTGGGCATCCTGG - Intergenic
1141928680 16:87186092-87186114 GCCTCGGCTCTGTGGCCTCCAGG - Intronic
1144744733 17:17606442-17606464 GCCTTTCCTTTATGGAATCAAGG + Intergenic
1146539464 17:33681734-33681756 GCCTCTCCTCTGTGTTATTCTGG + Intronic
1147746218 17:42696195-42696217 TGGTCTCCGTTGTGGCATCCAGG + Intronic
1148048207 17:44757055-44757077 GACTCTCCCTGGTGGCACCCTGG - Intergenic
1148540415 17:48475905-48475927 GCCTCTACTTGGTGGTATCTGGG - Intergenic
1148764396 17:50028774-50028796 CCCTCTCCTCTCTGTCATCCTGG + Intergenic
1149522395 17:57327561-57327583 GTCTCTTCTTTGTGGCATCAAGG + Intronic
1150162581 17:62911353-62911375 GCCTCTCATTGGTGGAGTCCGGG + Intergenic
1150386715 17:64767441-64767463 GCCTCTCACCTGTGGCAGCCAGG - Intergenic
1151248111 17:72811492-72811514 GCCTCTCCCTTCTGAGATCCAGG - Intronic
1152101092 17:78302122-78302144 GCCTCTCCCTAGTGCCATCCTGG + Intergenic
1152621325 17:81366315-81366337 GCCTCTACATCGTGGCACCCTGG - Intergenic
1156292134 18:35756458-35756480 GCCTCTCCTTAGCAGCATCTTGG - Intergenic
1157026733 18:43853624-43853646 GCCTCTGCTTTATGGCATCATGG + Intergenic
1157646670 18:49280733-49280755 CCATCACCTTTGTGGCAACCAGG + Intronic
1157777060 18:50403977-50403999 GCCCCTCCTTTCTGGCTTCCCGG - Intergenic
1158303686 18:56081216-56081238 GCCTCTGCTATGTGATATCCTGG + Intergenic
1158375605 18:56859814-56859836 GCTTCTACTTTGTGTTATCCCGG + Intronic
1160229375 18:77034781-77034803 GCCTCTCCTTGGTGGGCTCCTGG + Intronic
1160831306 19:1106008-1106030 CCCACACCTTTGTGGCCTCCTGG + Intronic
1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG + Intronic
1162181023 19:8868797-8868819 GCCTCTCATTGGAGGCATGCTGG - Intronic
1163807839 19:19410737-19410759 GCCTGTCTCTAGTGGCATCCAGG + Intronic
1164697288 19:30255191-30255213 GGCTCTCGTTTGTGGCTTTCAGG + Intronic
1165356544 19:35307939-35307961 TCCCCTCCTTTCTGGCTTCCAGG - Intronic
1165473547 19:36016864-36016886 CCCTCTCCTATGTGACATTCAGG - Intronic
1166594227 19:44030880-44030902 GCCACTCCTTTGGGGCATGGGGG - Intronic
1166867915 19:45852223-45852245 GCCTCTCAGTGGTGGCCTCCAGG + Intronic
1167308050 19:48720129-48720151 CCCTCTCCTTTCTTGGATCCAGG - Intergenic
1167772607 19:51530577-51530599 GGCTCTCCTCTTTGGCAACCAGG + Intronic
925739513 2:6993417-6993439 GCCTCTCTGTTGTGACCTCCTGG - Intronic
926802016 2:16666802-16666824 CCCTCTCCTTTCTGAGATCCAGG + Intergenic
926983216 2:18593577-18593599 GCCTCCCCTTTGTGGAATCTGGG - Intergenic
927863295 2:26573740-26573762 GCGGCGCCTCTGTGGCATCCAGG + Intronic
930377015 2:50580713-50580735 CCCTCTCCTTTGTGGCAGTCTGG + Intronic
933310349 2:80652616-80652638 GCCTCTACTCTGTTGCCTCCAGG - Intergenic
933834302 2:86232802-86232824 GCCCCTCCTGTGTTGTATCCAGG - Exonic
935012547 2:99149312-99149334 GCCTGTCCCTTCTGCCATCCTGG + Intronic
935397171 2:102620528-102620550 GCCTCTCTCCTGTAGCATCCAGG - Intronic
935800041 2:106686670-106686692 GCCTCTTCTTTCTGGCCTCCAGG + Intergenic
938228796 2:129640113-129640135 GCTTCACCTGTGTGGCCTCCTGG + Intergenic
941492861 2:166163888-166163910 GCCTCTCCTTCGTGCTTTCCTGG + Intergenic
943388903 2:187236752-187236774 GCCTCTCCTTTAGGTCAGCCTGG - Intergenic
949057637 2:241937092-241937114 GCGTCTCCACTGTGGCTTCCAGG - Intergenic
1169325037 20:4668685-4668707 TCATGTCCTTTGTGGCTTCCAGG - Intergenic
1169883841 20:10376095-10376117 GCCTTTCCCTTGTGGAATCCGGG + Intergenic
1169926951 20:10793752-10793774 GCCTCTCCATTTTGTCATTCTGG - Intergenic
1175878255 20:62241128-62241150 GTCTCTCCTCTGTGCCGTCCAGG + Intronic
1176719555 21:10382010-10382032 TCATGTCCTTTGTGGCAACCTGG + Intergenic
1177899356 21:26894732-26894754 GCCTATCTATGGTGGCATCCAGG - Intergenic
1179015987 21:37594848-37594870 GCCTCTGCGTGGTGGAATCCTGG + Intergenic
1179510018 21:41866450-41866472 CTCTCTCCTTAGTGGCCTCCAGG + Intronic
1179990460 21:44945663-44945685 GCCTCTCCTTTGAGCCATGCTGG + Intronic
1181788865 22:25247462-25247484 TCCTCTCCTTTGTGCTCTCCTGG - Intergenic
1182203292 22:28596011-28596033 GCCTTTCCTTTGTAGAATGCAGG - Intronic
1184365458 22:44048146-44048168 GCCTCTCCTATGGGCCTTCCAGG - Intronic
1185395828 22:50587414-50587436 TCCCCTCCTTTGTGGCCTGCTGG - Intronic
950055114 3:10017970-10017992 GCCCGTCCTCTGTGGCATCGAGG + Intergenic
950645691 3:14375304-14375326 GACTCTCCTATTTGGCGTCCTGG + Intergenic
950872853 3:16244351-16244373 TCCTCTCCTTCCTGGCAGCCAGG - Intergenic
951264743 3:20552572-20552594 GCCCCTCCTTCATGGCACCCAGG + Intergenic
952367342 3:32686257-32686279 TCATATTCTTTGTGGCATCCAGG + Intronic
953183646 3:40618936-40618958 TCCTCTTCTTGTTGGCATCCTGG - Intergenic
953350214 3:42209804-42209826 ACCTCACCTTGGGGGCATCCTGG + Exonic
954420924 3:50418669-50418691 GCCTCTTCTCTGCGGCATCCTGG + Intronic
955598125 3:60613850-60613872 ACCTCTGCTGTGTAGCATCCAGG - Intronic
955648337 3:61164945-61164967 GCATGTCCTTTGTGGCAACATGG - Intronic
956482120 3:69683499-69683521 GCCTCTCTTTTGTCACATGCAGG - Intergenic
958407231 3:93764698-93764720 ACATCTCCTTTGTGGCAGCCAGG + Intergenic
958891799 3:99791818-99791840 CTCTCTCATTTCTGGCATCCAGG - Intronic
961469557 3:127102792-127102814 GCCTCTCCGATGGGGCAGCCGGG - Intergenic
963587499 3:147211087-147211109 ACCATTCCTTTGTGGCATCGAGG - Intergenic
967955121 3:194872028-194872050 GCCTCGCCTCTGTGGCATTTAGG + Intergenic
968181861 3:196601315-196601337 GCCTTTTCTGTGTCGCATCCTGG + Intergenic
968870892 4:3241680-3241702 CCCTCTCCTATGTGGCAGCTGGG + Exonic
969747702 4:9087027-9087049 GCCCCTCTTGTGTGGCATGCAGG - Intergenic
972180939 4:36464479-36464501 TCCACTCCTTTGTGACTTCCAGG - Intergenic
972595453 4:40525985-40526007 GCCTCTCCTTTGAGCACTCCGGG - Intronic
973050071 4:45585500-45585522 GGCTCACCTGTGTGCCATCCTGG - Intergenic
976985459 4:91290539-91290561 GCCTCTCCTCTGTACCATACTGG - Intronic
977643171 4:99380300-99380322 TCCTGTCATTTGTGGCATCATGG + Intergenic
977982920 4:103346869-103346891 TCCTCTCATTTGTGGCAACATGG - Intergenic
978580211 4:110224366-110224388 GCCCTTCCTTTATGGCCTCCTGG - Intergenic
979669849 4:123350783-123350805 GCATCCACTTTGTGTCATCCTGG + Intergenic
983810852 4:172059941-172059963 GCCTCTCCTTCTGGGCTTCCTGG - Intronic
984247519 4:177293592-177293614 GCTTCTGCTTTGTGGCAGCCAGG + Intergenic
986702033 5:10419883-10419905 GCCTCTGCTTTGTGCTATCTGGG + Intronic
987213637 5:15710174-15710196 GCCTCTACTCTGAGGCATCAGGG - Intronic
987370963 5:17192620-17192642 GCATGTCCTTTGTGTCATCAAGG - Intronic
988561400 5:32284962-32284984 GCCTTTCCTTTGTGCCATAATGG - Intronic
989570734 5:42943965-42943987 CCTACTCCTTTGTGGAATCCCGG - Intergenic
991456653 5:66811119-66811141 GCCTCTCCTGTGCGGCCACCTGG + Intronic
994046261 5:95313748-95313770 CCCACTCCTTTGGGGCATCCAGG + Intergenic
995250361 5:109985940-109985962 ACCTTTCCTTTGTGTCCTCCAGG - Intergenic
1000987964 5:167881663-167881685 GCGGCTCCTTCCTGGCATCCAGG + Intronic
1002301829 5:178261801-178261823 GCCTGTCCTTCTTAGCATCCTGG + Intronic
1002904558 6:1438204-1438226 ACCCCTCCTTTCTGGCCTCCAGG + Intergenic
1003118835 6:3303533-3303555 TCCTGTCATTTGTGGCATCATGG + Intronic
1005868933 6:29958771-29958793 GCCTCCCCTTTGTGACTTCAAGG + Intergenic
1007665829 6:43512500-43512522 GCTGCTCCTCTGTGGCACCCTGG - Exonic
1007998168 6:46330620-46330642 CCCTCTCCTTGATCGCATCCTGG + Intronic
1008249077 6:49215711-49215733 TCATGTCCTTTGTGGCATCATGG + Intergenic
1008491008 6:52087291-52087313 GCTTCTCCTTTGGGACATCGAGG + Intronic
1008836721 6:55841201-55841223 CCCTAACCTTTGTGGCATCAGGG - Intronic
1009863849 6:69370990-69371012 GCCTCGCCGTGGTGACATCCAGG - Intronic
1011968567 6:93192449-93192471 GCCTCAGCTTTGTGGGTTCCTGG + Intergenic
1012227819 6:96724818-96724840 GCCTCTCCATAGTGGCCTCAAGG - Intergenic
1012951495 6:105522587-105522609 CCCTCTCCTTTCTGACATCTAGG - Intergenic
1013946590 6:115729137-115729159 GCCTCTGCTGTGTGTCACCCAGG + Intergenic
1014263656 6:119249704-119249726 GCCTCTCCACTGAGACATCCAGG + Intronic
1016654574 6:146503233-146503255 GCCTCTCCTCTGTCATATCCTGG + Intergenic
1019445048 7:1066762-1066784 CCCTCTCCTTTGGGGCATGTGGG - Intronic
1019489176 7:1303226-1303248 GCCTCTCCCTTCTGGCATGCAGG - Intergenic
1020325297 7:6969608-6969630 GCCCCTCTTGTGTGGCATGCAGG + Intergenic
1021591257 7:22265412-22265434 GCCTGTCATTTGTAGCATCATGG - Intronic
1022089534 7:27098376-27098398 GCCTCTTTTCTGGGGCATCCTGG + Intergenic
1022107593 7:27208039-27208061 GCCTGTTCTTTGTGGAAGCCTGG + Intergenic
1022115962 7:27260737-27260759 GCCTCTGCCTTATGGCATCAGGG - Intergenic
1022529458 7:31057868-31057890 CCATCTCCTTTCTGGTATCCAGG + Intronic
1023968801 7:44977228-44977250 GCGTCTCCCTGGTGCCATCCTGG + Intronic
1027428402 7:78084801-78084823 GCCTGTCCTTTGTTCCATCAGGG - Intronic
1027939918 7:84664702-84664724 TTCTCTCCTTTCTGGCTTCCTGG - Intergenic
1028390508 7:90311259-90311281 TCATGTCCTTTGTGGCTTCCAGG - Intergenic
1030073214 7:105715069-105715091 ACCTGTCCTGTGTGGCATCCAGG - Intronic
1031380968 7:121085567-121085589 GCCTTTCTTTTTTGTCATCCTGG + Intronic
1034879496 7:154752602-154752624 GCCTCACCCTTCTGGGATCCAGG + Intronic
1035356315 7:158277863-158277885 GCTTCTCCTGTCTGGCATCACGG + Intronic
1035771550 8:2151343-2151365 TCCTGTCCTTTGCGGCATCATGG - Intronic
1036370771 8:8161201-8161223 GCCCCTCTTGTGTGGCATGCAGG - Intergenic
1036880122 8:12504429-12504451 GCCCCTCTTGTGTGGCATGCAGG + Intergenic
1037483464 8:19326342-19326364 GCCTCTCCTTTGGGACACCCCGG - Intronic
1038198937 8:25393729-25393751 GTCTGTCCCCTGTGGCATCCTGG + Intronic
1038521721 8:28238758-28238780 GCCACTGCTTGGTGGCATCTGGG - Intergenic
1045108133 8:98913584-98913606 GCATCTCCTTGGCGGCATTCAGG - Intronic
1046707887 8:117476586-117476608 GCAACTCCTATGTTGCATCCTGG - Intergenic
1050478507 9:6065278-6065300 GCCTCTCTTTTTTGTCATCTGGG - Intergenic
1051742315 9:20263827-20263849 CCCTCTCCCTTGTGCCCTCCTGG + Intergenic
1053104343 9:35397386-35397408 ACCTCTCCACTGTGGCCTCCTGG + Intronic
1055993283 9:82130831-82130853 GCAGATGCTTTGTGGCATCCGGG + Intergenic
1057034094 9:91799286-91799308 GCCTCTCATGAGTGGAATCCAGG + Intronic
1058107541 9:100989971-100989993 TCATTTCCTTTTTGGCATCCCGG - Intergenic
1058111944 9:101040400-101040422 GCCTCTCCTTTTTGGCATCAGGG + Intronic
1058317774 9:103589812-103589834 TCCTCTCATTTGTGGCAACATGG + Intergenic
1058949329 9:109888876-109888898 GCCTCTACCTAGTGGCTTCCAGG + Intronic
1059335326 9:113565234-113565256 CCCTCTTCTTTGAGACATCCCGG + Intronic
1060039021 9:120283798-120283820 GCCTCCCCTATGTGTCATTCAGG - Intergenic
1060058241 9:120434541-120434563 GCCTCTCCTGTTTGGCCTCTGGG - Intronic
1061534436 9:131238917-131238939 ACCTCTCCTTGCTGGCATCCTGG + Intergenic
1061928053 9:133816334-133816356 ACCTTTCCTTAGTCGCATCCTGG + Intronic
1062034051 9:134374946-134374968 GCCACTCCATTGTGACACCCTGG - Intronic
1062039273 9:134396664-134396686 GCCTTTCCTTTGCACCATCCTGG + Intronic
1203780841 EBV:100024-100046 GCCTCTCCTTCACGGCCTCCTGG - Intergenic
1192426276 X:71079745-71079767 CCCTCTCTATTGTGGAATCCTGG - Intergenic
1195323856 X:103742415-103742437 GCCTTTCCTTTTTGGGATCTAGG + Intergenic
1196553029 X:117052975-117052997 CCCTCTCCCTTGTGTCTTCCAGG - Intergenic
1198097663 X:133396403-133396425 GCCAATGCTTTGTGGCTTCCTGG - Intronic
1198581324 X:138067864-138067886 GGCTATCCTTTGTGGCAACAAGG - Intergenic
1198984957 X:142440586-142440608 ACTTATTCTTTGTGGCATCCTGG + Intergenic
1200920383 Y:8607811-8607833 CTCTCTCCTCTGTGGGATCCAGG + Intergenic
1201068552 Y:10123367-10123389 GCCTCTGCTTTGTAGTAGCCTGG + Intergenic
1201283148 Y:12358185-12358207 GCCTTTCCTTTCTGGCTTCCTGG + Intergenic