ID: 1105860263

View in Genome Browser
Species Human (GRCh38)
Location 13:24403899-24403921
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 207}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105860263 Original CRISPR GCCTCTCCTTTGTGGCATCC CGG Intergenic