ID: 1105860457

View in Genome Browser
Species Human (GRCh38)
Location 13:24406088-24406110
Sequence GAGAGAATGAAGGACAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1214
Summary {0: 1, 1: 2, 2: 6, 3: 95, 4: 1110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105860452_1105860457 0 Left 1105860452 13:24406065-24406087 CCACTGAGAGATATTTACTTGTT 0: 1
1: 0
2: 3
3: 15
4: 240
Right 1105860457 13:24406088-24406110 GAGAGAATGAAGGACAGGGGTGG 0: 1
1: 2
2: 6
3: 95
4: 1110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105860457 Original CRISPR GAGAGAATGAAGGACAGGGG TGG Intergenic
900002964 1:25089-25111 GAGTGAATGAGGGAAAGGGCAGG + Intergenic
900022685 1:195614-195636 GAGTGAATGAGGGAAAGGGCAGG + Intergenic
900295831 1:1949008-1949030 GAGAGAAGGAAGGAAGGGGAAGG - Intronic
900356820 1:2268921-2268943 GAGAGAAGGAAAGAGAGGGAGGG - Intronic
900797996 1:4720972-4720994 GAGAGGATGGGGGACAGGGATGG + Intronic
900824121 1:4912641-4912663 GGGAGTATGCAGGACAGGGGAGG - Intergenic
901218357 1:7567318-7567340 GGGACCCTGAAGGACAGGGGAGG + Intronic
901225326 1:7609898-7609920 AAGAGAATGAAGACCAGGAGAGG - Intronic
901339028 1:8478504-8478526 GGGAGCAGGAAGGACAGGAGTGG + Intronic
901377367 1:8848974-8848996 GAGAGAAGGAAGGGCTGGGATGG + Intergenic
901617124 1:10550138-10550160 GAGAGAATAATGGAGAGGGTGGG + Intronic
901656098 1:10770594-10770616 GGGAGCATGCAGGACAGAGGGGG - Intronic
902200975 1:14833413-14833435 GAGACAGGGAAGGAAAGGGGAGG + Intronic
902644151 1:17786576-17786598 GGAAGAATGGAGAACAGGGGAGG + Intronic
902664364 1:17927282-17927304 CAGAAAAGGAAGGACAGGGGTGG - Intergenic
902692021 1:18115893-18115915 GAAAGAAAGAAGGAGAGGGAGGG + Intronic
902777531 1:18684292-18684314 GAGGGGATGAAGGACAGTGCTGG + Intronic
902787159 1:18740128-18740150 GAGAGACAGAGGGACAGGGAGGG + Intronic
902853456 1:19180802-19180824 CTGAGAAGGAAGGATAGGGGTGG - Intronic
903324561 1:22562664-22562686 GAGACAGGGAAGGTCAGGGGAGG + Intergenic
903331733 1:22600127-22600149 GAGAGAAGGAAGGAGGAGGGAGG + Intronic
904073104 1:27817026-27817048 GAGAGAAGGAAGGAAAGAGAGGG + Intronic
904313166 1:29642282-29642304 GAGAGGAAGAAGGGAAGGGGAGG + Intergenic
904352455 1:29917442-29917464 GAAAGAAGGAAGGGAAGGGGAGG - Intergenic
904390759 1:30184298-30184320 GAGAAAATGATGGACATAGGAGG - Intergenic
904513223 1:31031874-31031896 GAGAGAGAGAGGGCCAGGGGAGG - Intronic
904803860 1:33117535-33117557 GAGAGCATGTAGAACAGTGGCGG - Intronic
904933925 1:34113042-34113064 GAGAAAAAGAAGGACATGGATGG + Intronic
904992427 1:34603925-34603947 GAGAGAAGGAAGGAGAGAGGAGG - Intergenic
905345320 1:37307277-37307299 GAGAGGAGAAAGGACAGGAGGGG + Intergenic
905462374 1:38130093-38130115 AAGGGAAGGAAGGACAGAGGAGG + Intergenic
905631660 1:39522157-39522179 CATAGGCTGAAGGACAGGGGAGG + Intronic
905666093 1:39764015-39764037 CATAGGCTGAAGGACAGGGGAGG - Intronic
905752302 1:40477052-40477074 GAATGAATGAATGACAGGGAAGG + Intergenic
905769588 1:40628959-40628981 GAGAGAATGTATGACAGGGAGGG + Intronic
905821344 1:40994067-40994089 AAGAAAATGAAGGCCAGGTGCGG - Intronic
906117328 1:43365526-43365548 GAAAGAAGGAAGGAAAGGGCTGG + Intronic
906359356 1:45139448-45139470 GAGAGAGGGAGGGAGAGGGGAGG - Intronic
906523748 1:46482148-46482170 GAGAGAGAGAGGGACAGAGGCGG - Intergenic
906568949 1:46820147-46820169 CAGAGAACAAAGGACAGTGGGGG - Intergenic
906805749 1:48777318-48777340 GAGTGAATGCGGGATAGGGGTGG + Intronic
907327270 1:53646929-53646951 GAAAGAAGGAAGGAAAGGGAAGG + Intronic
907861595 1:58358913-58358935 GAGAGAAAGAAAGGAAGGGGGGG - Intronic
908450345 1:64248204-64248226 GAGAGAAAGAGGGACAGGAGAGG - Intronic
908476232 1:64491465-64491487 GAGAGAAAGAAGAGCAAGGGGGG + Intronic
908744963 1:67367500-67367522 GAAAGAAGGAAGGAAGGGGGAGG + Intronic
908798333 1:67853471-67853493 GAGAGAAGGAAGGGAAGGGAAGG - Intergenic
908907061 1:69028120-69028142 GAAAGAATAAAGGACTGTGGTGG - Intergenic
909091780 1:71234932-71234954 GCTCGAATGAAGGACAGAGGAGG - Intergenic
909129211 1:71714155-71714177 GAGAGAATGAGGGCCAGGAAGGG + Intronic
909332958 1:74437032-74437054 GGGAGAGTGAAGGAGAGGGCAGG - Intronic
909860019 1:80593489-80593511 GAGAGAAGGAACAACACGGGAGG + Intergenic
909953980 1:81754477-81754499 GAAAGAAGGAAGGAAAGGGGAGG - Intronic
910422715 1:87084776-87084798 GAGAGGGAGAAGGAGAGGGGGGG - Intronic
910457367 1:87412033-87412055 GAAAGAATGAGGGAGGGGGGTGG + Intergenic
910490418 1:87763469-87763491 GAGAAAAAGAAGGAGAAGGGGGG + Intergenic
910530755 1:88232972-88232994 CAGAGAATGGAAGACATGGGAGG - Intergenic
910874254 1:91863081-91863103 GGGTGACTGCAGGACAGGGGTGG + Intronic
911971810 1:104448343-104448365 GAGAAAAGGAAGAAAAGGGGAGG - Intergenic
912063798 1:105709043-105709065 GAGAGAGAGAAGGACTGGGGTGG - Intergenic
913492481 1:119393981-119394003 GAGGGCCTGAAGCACAGGGGTGG - Exonic
913996979 1:143659469-143659491 GAGAGAGAGAAGGACAGAGAAGG + Intergenic
914328339 1:146642868-146642890 GAGAGATTGAGGGTCAAGGGAGG - Intergenic
914505274 1:148283299-148283321 GAGAGACAGAAGGACAGAGAAGG - Intergenic
914507291 1:148300848-148300870 GAGAGACAGAAGGACAGAGAAGG + Intergenic
915326027 1:155081635-155081657 GAGAGAAGCAGGGACAGGGAAGG - Intronic
916146079 1:161740540-161740562 GAGAGGATGCAGAACAGGAGAGG - Intergenic
916243800 1:162666394-162666416 GAGCAAATGAAGGACAGGTGTGG + Intronic
916858961 1:168781994-168782016 AAGAGAAAGAAAGAGAGGGGAGG - Intergenic
917058612 1:171012375-171012397 GAGAGACTGAATGAGAGAGGAGG - Intronic
917421247 1:174866073-174866095 GAGAGAGTGAAGGAGAGGAGGGG + Intronic
917541880 1:175922376-175922398 GAGAGAAAGCAAGAGAGGGGAGG + Intergenic
917621803 1:176803690-176803712 GAGAGAATGAAGGAAATTGATGG - Intronic
917672793 1:177289011-177289033 AAGGGAAGGAAGGAGAGGGGAGG + Intergenic
917680254 1:177358750-177358772 GAGAGAAAGAAAGAGAGTGGGGG + Intergenic
918087506 1:181258085-181258107 GAGGGAGAGAAGGAAAGGGGAGG + Intergenic
918177929 1:182061437-182061459 GAAAGAATGAAGGAAAGAAGAGG - Intronic
918246207 1:182661574-182661596 GAGAGAATGAAGGAGATGAAGGG + Intronic
918795020 1:188883117-188883139 GAGAGAAGGATCGACAAGGGTGG + Intergenic
919295851 1:195698932-195698954 GAGAGGAAGAAAGAGAGGGGAGG + Intergenic
919964556 1:202509333-202509355 GAGAAAGTGAAGGAGAGAGGGGG + Intronic
920888518 1:209957937-209957959 GAGAGAAAGAAGGAAGGAGGGGG - Intronic
920915874 1:210257599-210257621 GGCAGAGTCAAGGACAGGGGAGG + Intergenic
920988336 1:210911869-210911891 GAGAGATTGCAGGAGAGGGGTGG - Intronic
921338433 1:214110909-214110931 AAGATAATGAAGGAGGGGGGAGG - Intergenic
922239716 1:223747773-223747795 GAGAGACAGAAGGAAAGGGGAGG + Intronic
922605493 1:226887477-226887499 GGGAGAGTGAAGGACAAGAGGGG - Intronic
922979310 1:229812232-229812254 GAGGGAAGGGAGGGCAGGGGAGG + Intergenic
923403749 1:233640659-233640681 TAGAGAATGAAGGTCAGGTCTGG + Intronic
923473794 1:234314397-234314419 GAGGCAATGAAGGACAGTGAGGG - Intronic
924934866 1:248759150-248759172 GAGAGAAGGCGGGTCAGGGGTGG - Intergenic
1062793526 10:324849-324871 GACAGAATGAAGAACAGAGTTGG - Intronic
1063153358 10:3356362-3356384 GAGGGAAGGAAGGAGAGGGAGGG - Intergenic
1063286268 10:4692132-4692154 GGGGGAAGGAAGGACAAGGGAGG + Intergenic
1063511253 10:6647083-6647105 GAGAGAAGGAGGGAGAGAGGGGG - Intergenic
1063884097 10:10560488-10560510 GAGTGAATCAAAGACAGGGTAGG - Intergenic
1063926069 10:10979064-10979086 CAGAGAATGAGAGGCAGGGGTGG - Intergenic
1063982875 10:11470120-11470142 GAGACAGTGAAGGAGAGGTGAGG + Intronic
1064337632 10:14458107-14458129 GAGGCAATGAATCACAGGGGTGG + Intronic
1064450075 10:15434293-15434315 GAGAGAAAGAAAGACGGGGGAGG - Intergenic
1064735030 10:18373228-18373250 GAGTGAATGAATGAAAGGAGAGG - Intronic
1064939372 10:20715315-20715337 AGCAGAATGAAGGACAGGGAGGG + Intergenic
1065144452 10:22754370-22754392 ACGAGAATGAAGGACAAAGGTGG - Intergenic
1065241927 10:23714361-23714383 GAGGGAAAGTAGAACAGGGGAGG + Intronic
1065245102 10:23748515-23748537 GAGGAAAGGAAGGAGAGGGGAGG + Intronic
1065494436 10:26314359-26314381 GAGTGATTGCAGGACAGAGGAGG - Intergenic
1065818382 10:29502565-29502587 GAAAGAATGAAGGACAGATGGGG - Intronic
1065885362 10:30072112-30072134 GAAAGAAGGAAGGGCAGGGCAGG + Intronic
1065886698 10:30084194-30084216 GAGAGAAGGAAAGAAAGGGAAGG + Intronic
1065954525 10:30681933-30681955 GAAAGAATAAAGGACAGATGGGG + Intergenic
1066524978 10:36267522-36267544 AAGAGAAGGAAGGGGAGGGGAGG + Intergenic
1067815384 10:49471632-49471654 GGGAGAATAAATGACAGGGAGGG - Intronic
1068391883 10:56408769-56408791 GAGAGAAGGAAGAACAGTGTTGG + Intergenic
1068580374 10:58732278-58732300 GAGAGAAAGAAGGAGAAGAGAGG + Intronic
1068772995 10:60842953-60842975 GAAAGAAGGAAGGAAAGGGAGGG - Intergenic
1068948603 10:62755107-62755129 GAGAGAAGGAAGGAGGGAGGAGG + Intergenic
1069316418 10:67109552-67109574 AAGAAAATGAAGGCCAGGCGTGG + Intronic
1069441548 10:68433229-68433251 GAGAGGATGAGGGAGAGGGAAGG - Intronic
1070092541 10:73302274-73302296 GAGATAAAGAAGGCCAGGGAGGG + Intronic
1070107646 10:73450455-73450477 GAGGAAATGGAGGACAGAGGAGG - Intronic
1070156103 10:73836565-73836587 CAGAGAATGAGGGAAAGAGGAGG + Intronic
1070160207 10:73862187-73862209 GAAAGAGGGAAGGACAGTGGGGG - Intronic
1070402256 10:76063600-76063622 GAAAGAAGGAAGGAGAGGGAGGG + Intronic
1070432274 10:76352806-76352828 GATGGAATCAGGGACAGGGGAGG + Intronic
1070680950 10:78448613-78448635 GAGAGAAGGAAAGACGGGGAAGG + Intergenic
1070723515 10:78772775-78772797 GAGAGAGGGCAGGGCAGGGGTGG - Intergenic
1071068542 10:81665909-81665931 GAGAGAGAGAAAGAGAGGGGAGG + Intergenic
1071512384 10:86270327-86270349 GAGAGAATGAAGGGTGGGGGTGG - Intronic
1071554893 10:86594367-86594389 GAGGGAAGGAAGGAGAGGGAGGG + Intergenic
1072222784 10:93340811-93340833 GAGAGAATGAAGAACTGGGAAGG + Intronic
1072420682 10:95289024-95289046 GAGTGAATGATGGAATGGGGTGG - Intronic
1072490613 10:95902557-95902579 GAGAGAAAGATGGGCAGGGATGG - Intronic
1072642817 10:97225353-97225375 GAGAGAGAGATGGACAAGGGAGG + Exonic
1072695446 10:97599788-97599810 GTGGGCATGAAGGACAGCGGTGG + Exonic
1072736456 10:97882666-97882688 GGCAGAAAGGAGGACAGGGGAGG - Intronic
1073582199 10:104678888-104678910 GAGGGAAAGCAGGACAGGGAAGG + Intronic
1073662235 10:105489214-105489236 GAAAGAAAGAAGGACAGGGAAGG + Intergenic
1074482647 10:113839371-113839393 GGGTAAATGAGGGACAGGGGAGG + Intronic
1075094979 10:119465347-119465369 GATAGAAGGAAGGAAAGGTGGGG + Intergenic
1075136087 10:119787606-119787628 GATAGAAGGAAGGAAAGGGAAGG + Intronic
1075153182 10:119953535-119953557 GAGGGAAGGAAGGAGAAGGGGGG - Intergenic
1075153202 10:119953598-119953620 GAGGGAAGGAAGGAGAAGGGGGG - Intergenic
1075225645 10:120626348-120626370 GAGAAAATGAAGGGATGGGGTGG + Intergenic
1075238731 10:120757969-120757991 GAGAGAAGGAAAGAAAGGGAAGG + Intergenic
1075316735 10:121459227-121459249 GAGAGAAAGCAGGAGAGGAGCGG - Intergenic
1075379835 10:122010192-122010214 GACAGAATGAAGGGGTGGGGAGG - Intronic
1075456464 10:122588232-122588254 GAGAGGATGAGGGTCAGGGTGGG + Intronic
1075531403 10:123233192-123233214 GAGAGAAAGGAGGGGAGGGGAGG - Intergenic
1075627309 10:123972463-123972485 GAGAGGATGTAGGGGAGGGGAGG + Intergenic
1075627347 10:123972553-123972575 GAGAGGATGCAGGGGAGGGGAGG + Intergenic
1076310873 10:129506644-129506666 GAGAGATGGGAGGACAGGGTAGG - Intronic
1076364587 10:129913894-129913916 GAGTGAATGAAGGATATGGCTGG - Intronic
1076425084 10:130361965-130361987 GAGAGAAAGAAGAAAAGAGGAGG + Intergenic
1076473566 10:130736758-130736780 GAGAGATTAAAGGCCATGGGAGG - Intergenic
1077162178 11:1118901-1118923 GAGAGAAGGAGGGAGTGGGGAGG + Intergenic
1077582647 11:3426735-3426757 GAGAGAATGAGGGCCGGGCGTGG + Intergenic
1077644583 11:3912163-3912185 GGGAGAAAGGAGGAGAGGGGAGG - Intronic
1078266427 11:9758836-9758858 GAGAGAAGGGAGGAGACGGGAGG - Intergenic
1078268138 11:9770192-9770214 GAGAGAATGAAGGCCAGTTATGG + Intergenic
1078289283 11:9990868-9990890 CAGAGTATGAAGAACAGAGGAGG + Intronic
1078298782 11:10103788-10103810 CAGATAATGAAGGCCAGGTGCGG + Intronic
1078580916 11:12539080-12539102 GGGAGAGGGAAGGACATGGGTGG + Intergenic
1078875475 11:15390952-15390974 GAAAGAAAGAAGGAAAGAGGAGG + Intergenic
1078893429 11:15577772-15577794 GAGATAATGCAGAAAAGGGGAGG - Intergenic
1078950643 11:16129156-16129178 GAGATAAAGATGGACAGGTGGGG - Intronic
1080604666 11:33855106-33855128 GAGAGAGGGAAGGGAAGGGGGGG + Intergenic
1080816941 11:35767458-35767480 TGGAGAATTAAGGAGAGGGGAGG + Intronic
1080932257 11:36823898-36823920 GGGAGAATGGGGAACAGGGGCGG + Intergenic
1080959161 11:37137701-37137723 GAGAGAATGAGGGCCAGCAGGGG + Intergenic
1081275363 11:41141667-41141689 GAGAGAATGAATGCCAGCAGGGG - Intronic
1081396330 11:42590455-42590477 GAGGGATTGAGGGACAGGGAAGG - Intergenic
1082062693 11:47874210-47874232 GAGAGAATGGGGGAAAGAGGAGG + Intergenic
1082617797 11:55382776-55382798 GAGAGAATGAGTGCCAGGAGGGG - Intergenic
1083001817 11:59299199-59299221 GAGAGAGGGAAGGGGAGGGGAGG + Intergenic
1083515847 11:63257785-63257807 AAGAGAAGGAAGGGGAGGGGAGG - Intronic
1084135789 11:67180384-67180406 GAGAGAATGACTCACAGGGTGGG - Intronic
1084239547 11:67809555-67809577 GAGAGAATGAGGGCCAGGCATGG + Intergenic
1084529246 11:69717409-69717431 GAGAGAAGGAAGGAGACTGGAGG - Intergenic
1084532126 11:69733507-69733529 GAGAGAAGGAAAGAAAGGAGAGG + Intergenic
1084956199 11:72692943-72692965 GACAGAATGAGGGAGAAGGGTGG + Intronic
1085410794 11:76289179-76289201 GAGAGGATGGGGGCCAGGGGAGG + Intergenic
1085502712 11:77038105-77038127 GAGAGAAGGGAGGATAGAGGAGG + Intronic
1085693554 11:78685034-78685056 GAGAGAAAGATGGAGAGAGGAGG - Intronic
1085969830 11:81574470-81574492 GAGAGAATGAATGCCAGCAGGGG - Intergenic
1086476145 11:87176776-87176798 GAGTGAGTGAATGAGAGGGGAGG + Intronic
1086781324 11:90909987-90910009 GAGAGAAAGTAAGAGAGGGGAGG + Intergenic
1087008745 11:93493902-93493924 TAGAGAATGACAGAGAGGGGTGG - Intronic
1087142274 11:94776464-94776486 GAAAGAAGGAAGGACAGAGTAGG - Intronic
1087726653 11:101725846-101725868 GAGAGTAGGGAGGAGAGGGGAGG + Intronic
1088144094 11:106653205-106653227 GAGAGAATGAATGCCAGCAGGGG - Intergenic
1088393802 11:109345140-109345162 GAGAGAATGAGTGCCAGTGGGGG - Intergenic
1088516511 11:110641245-110641267 GAGAGAGTGAAGGTCAGAGAAGG + Intronic
1088982402 11:114875550-114875572 GAGAGGATGAAGGAACTGGGTGG - Intergenic
1089069507 11:115688637-115688659 GAGATACTGAAGGTCAGGGAGGG - Intergenic
1089919111 11:122190780-122190802 GAAAGGTTGAAGGACAGGGAAGG + Intergenic
1090062635 11:123477282-123477304 GGGAGAATGAAAGGGAGGGGAGG - Intergenic
1090899444 11:131014196-131014218 GTGACAATGAAGGCCAGGTGGGG + Intergenic
1091109247 11:132950299-132950321 CAGAGAATGATGGAGAGGTGAGG + Intronic
1091376383 12:27152-27174 GAGTGAATGAGGGAAAGGGCAGG + Intergenic
1091763611 12:3104027-3104049 GAGAGACTGGAAGACAGGGAGGG + Intronic
1092138948 12:6169517-6169539 GAGAGGAGAAAGGACAGGGCAGG - Intergenic
1092618753 12:10239513-10239535 GAAAGAAAGAAAGAAAGGGGAGG - Intergenic
1092892516 12:12981924-12981946 GAGAGAGAGAAGCACAGGAGAGG + Intronic
1093100043 12:15017014-15017036 GAAAGGATGAAGGAGAGGCGGGG - Intergenic
1093316609 12:17659225-17659247 GAGAAAATGAAGGAAAGAGAGGG + Intergenic
1093391676 12:18631585-18631607 GAATGAATGAAGGAAAAGGGTGG + Intronic
1093684578 12:22041655-22041677 GAGAGAAAGAAGGCCAGGCACGG + Intergenic
1093831378 12:23763556-23763578 GTAAGTATGAAGGACTGGGGAGG + Intronic
1094068128 12:26383132-26383154 GAGAGAACGAGAGAGAGGGGAGG - Intronic
1094738753 12:33264470-33264492 GAGGGAAGGAAGGAAGGGGGAGG - Intergenic
1095175247 12:39084615-39084637 AAGAGAAAGAAGGAGAGGAGAGG - Intergenic
1095302554 12:40602290-40602312 GATAGAATTAAGGAGAGGGTGGG + Intergenic
1095433186 12:42156619-42156641 CAGGCAATGAAGGACAGGGATGG - Intergenic
1095464705 12:42478104-42478126 GAGAGAAAGAGGGAGAGGGAGGG - Intronic
1095576345 12:43744427-43744449 GAGAGAATGAATGCCAGCAGGGG - Intronic
1095833491 12:46612513-46612535 GAAGGAAGGAAGGAAAGGGGAGG - Intergenic
1095905542 12:47373758-47373780 GAGAGAAGGGAGGGAAGGGGAGG + Intergenic
1095946570 12:47757264-47757286 GAAAGAATGAAGGAGAGAGCAGG - Intronic
1095999641 12:48118556-48118578 GAGACAATGAAGCAAAGGGAAGG + Intronic
1096232049 12:49902252-49902274 CAGAGAAGGAAAGACTGGGGTGG + Intronic
1096267482 12:50135217-50135239 GAGAGAGAGGAGGACAGGGAGGG + Intronic
1096317741 12:50583385-50583407 GAGGGACTGAAGCACAGGTGGGG - Intronic
1096498564 12:52052323-52052345 GAGAGAAAGAGAGACAGAGGTGG + Intronic
1096562528 12:52447090-52447112 GGGAGACTGGAGGCCAGGGGAGG + Exonic
1096667115 12:53173240-53173262 GAAAGAAGGAAGGAAGGGGGGGG + Intronic
1096782339 12:53998474-53998496 GAGGGAAAGAAGGGCAGGCGTGG + Intronic
1096788817 12:54032810-54032832 GAGAGAAAGAGGGAAGGGGGAGG - Intronic
1096943202 12:55372500-55372522 GAGGGAAGGAAGGAAAGGGAAGG + Intergenic
1097313079 12:58142369-58142391 GAGAGAAGGAGGGAAAAGGGAGG + Intergenic
1097333412 12:58356335-58356357 GAGAGAGAAAGGGACAGGGGAGG + Intergenic
1098018396 12:66130479-66130501 GCGGGAGTGAACGACAGGGGTGG + Intronic
1098230029 12:68363844-68363866 GAGAGAAGGGAGGACAGATGGGG - Intergenic
1098567897 12:71956400-71956422 GAGAGAGGGAAGGAGAGGGAGGG - Intronic
1098662957 12:73122039-73122061 GAGAAAAAGAGGGGCAGGGGTGG + Intergenic
1099137383 12:78923679-78923701 GAGAGAGAGAAAGAAAGGGGGGG - Intronic
1100272822 12:93042655-93042677 GAGGGAGGGAAGGAGAGGGGAGG + Intergenic
1100352427 12:93797228-93797250 GAGAGAAAGAAAGAGAGGGGAGG + Intronic
1100407821 12:94286285-94286307 GAGAGCCTGAAGGAAACGGGAGG + Intronic
1100427446 12:94500425-94500447 GAAAGAAGGAAGGAAAGGGGAGG + Intergenic
1100676711 12:96876696-96876718 GGGAGGATGAAGGACAGGAGCGG + Intergenic
1101130821 12:101689582-101689604 GACGGAAGGAAGGAAAGGGGAGG + Intergenic
1101254641 12:102965395-102965417 GAGAGAATAAAGGAGAGGCGAGG + Intergenic
1101510256 12:105386622-105386644 GAAGGAAGGAAGGAAAGGGGAGG - Intronic
1101547681 12:105731984-105732006 CCGAGAATGAAGGAAAGGGAAGG - Intergenic
1101877805 12:108607096-108607118 GAGGGAAGGAAGGAGAAGGGAGG - Intergenic
1102299761 12:111762710-111762732 GAGAGAGGGCAGGACATGGGTGG + Intronic
1102577166 12:113863066-113863088 GAGAGAAGGGAGGAGGGGGGAGG + Intronic
1102870417 12:116409837-116409859 GAGAGGAGGCAGGACAGGGCAGG + Intergenic
1103315581 12:120052251-120052273 GAGAGAGAGAAGGGGAGGGGAGG - Intronic
1103339926 12:120215844-120215866 GAAAGGAAGAAGGACAGGGAGGG + Intronic
1103366973 12:120390590-120390612 GAGGGAAGGAAGGAAAGGAGAGG + Intergenic
1103518599 12:121523291-121523313 GAGAGAAATAAGGACAAGGGCGG + Intronic
1104000934 12:124859588-124859610 GAGAGAAGGCAGGACACTGGGGG - Intronic
1104249304 12:127075937-127075959 GAGAGAAGGAAGGAGAGGAGGGG - Intergenic
1104268879 12:127264049-127264071 TAGAGAGTGAGGGACTGGGGTGG - Intergenic
1104324886 12:127786396-127786418 GAGACAAAGAAGTACAGGAGTGG + Intergenic
1104401917 12:128483283-128483305 GAGAGAAAGAAAGAGAGAGGGGG + Intronic
1104673695 12:130698107-130698129 GAGACAGAGAAGGACAGGGAAGG + Intronic
1105334468 13:19453323-19453345 GAGAGAATGAAGGACAGGGATGG - Intronic
1105570289 13:21596283-21596305 GGGAGAAGGAAGGACAGGATTGG - Intronic
1105860457 13:24406088-24406110 GAGAGAATGAAGGACAGGGGTGG + Intergenic
1105939051 13:25130638-25130660 GAGAGAATTTAGGCCAGGTGTGG + Intergenic
1106008350 13:25792954-25792976 GAAGGAAGGAAGGAGAGGGGAGG + Intronic
1106175815 13:27330294-27330316 GAGAGAAAGAAAGAAAGGGAAGG - Intergenic
1106177023 13:27340401-27340423 GAGAGAATGGAGAAGCGGGGAGG + Intergenic
1106404385 13:29461190-29461212 GAGAGAGAGAAGGGAAGGGGGGG + Intronic
1106497021 13:30287383-30287405 GAGAGAATGAATGCCAGCAGGGG - Intronic
1106879775 13:34116517-34116539 GAGAGAAAGAAGGACATCAGAGG - Intergenic
1107488681 13:40858298-40858320 GAGAGAATGAAGGACAGGGCCGG - Intergenic
1107742880 13:43471884-43471906 GATAGAATGATGCACAGTGGTGG + Intronic
1107788524 13:43977896-43977918 GAGAGAAAGAAAGAGAGGGAGGG - Intergenic
1107795336 13:44045959-44045981 GAGAGAATGAAAGAGAGGAAGGG - Intergenic
1108790256 13:53961488-53961510 GAGAGAAGGGAGGGCAGGGGAGG - Intergenic
1109475268 13:62873071-62873093 GAGAGAGAGAATGACGGGGGAGG - Intergenic
1110457980 13:75711616-75711638 GAGTGGGTGCAGGACAGGGGGGG - Intronic
1110614969 13:77531259-77531281 GAGAGAAGGAAGAACCTGGGAGG - Intergenic
1110939753 13:81334851-81334873 GAGAGAAAGAAGGAAGGAGGGGG - Intergenic
1111015920 13:82381848-82381870 GAGAGAATGAATGCCAGCAGAGG - Intergenic
1111086377 13:83380559-83380581 GAAAGAAGGAAGGAAGGGGGAGG - Intergenic
1111086393 13:83380613-83380635 GAAAGAAGGAAGGAAGGGGGAGG - Intergenic
1111414181 13:87917446-87917468 GAGAGAATGAATGCCAGCAGGGG - Intergenic
1111766564 13:92538244-92538266 GAGAGAAGGAAGATCAGGTGGGG - Intronic
1111939941 13:94598011-94598033 GAGATCATAAAGGACAGTGGGGG - Intergenic
1111950730 13:94707255-94707277 GAGAGAAAAAAGAAAAGGGGGGG + Intergenic
1111964603 13:94848089-94848111 GAGACACTTGAGGACAGGGGTGG - Intergenic
1112015148 13:95325515-95325537 GAGAGAAGGAAGGAAGGGGAGGG + Intergenic
1112109012 13:96273990-96274012 GAGAGAGAGAAGGAGAAGGGAGG - Intronic
1112157539 13:96833880-96833902 GAGTGGATCCAGGACAGGGGAGG + Exonic
1113372803 13:109738212-109738234 GGGAGAATGAGGAAGAGGGGAGG + Intergenic
1113651461 13:112036701-112036723 AAGAGGGTGGAGGACAGGGGAGG - Intergenic
1113937509 13:114002122-114002144 GAGTGACTGGAGGACAGAGGTGG + Intronic
1114450411 14:22821918-22821940 GAAAGGGTGAAGGGCAGGGGAGG + Intronic
1114617588 14:24076428-24076450 GAGGGAAAGAAGGAGATGGGGGG + Intronic
1114828894 14:26114266-26114288 GAGAGAAAGAGGGAAAGGGAGGG - Intergenic
1114964854 14:27944408-27944430 GAGAAAATAGAGGACAGAGGGGG + Intergenic
1115275607 14:31605846-31605868 GAGACAAGGAAGGAGAAGGGAGG - Intronic
1115275618 14:31605893-31605915 GAGAGAAGGAAGGAGAAGGGAGG - Intronic
1115384999 14:32787207-32787229 GAAAGAATGAAAGAAAGGGGGGG + Intronic
1115389832 14:32842061-32842083 GAGAGAAGGAAGGGAAGGGAAGG - Intergenic
1115556084 14:34546142-34546164 GAGAGAAGGAAGAAAAGAGGGGG - Intergenic
1115557824 14:34556939-34556961 GAGAGAAGGAAGAAAAGAGGGGG + Intergenic
1115801616 14:37000550-37000572 GAGAGAATGAAGGGTCTGGGTGG - Intronic
1116208660 14:41905853-41905875 GAGAGAATCAAGAACAGGAATGG + Intergenic
1116267497 14:42712499-42712521 GAGAGAATGAGGGCCAGCAGGGG + Intergenic
1116435893 14:44895271-44895293 AAGAGAATGAGGGCCAGGTGTGG + Intergenic
1117051395 14:51863678-51863700 GAGAGAAGGAGGGAAAGAGGAGG - Intronic
1117320070 14:54613181-54613203 AAGAGAAGGAAGGAAAGGGAAGG + Intronic
1117783850 14:59262007-59262029 AAGAGATGGAAGGGCAGGGGAGG - Intronic
1118038382 14:61892402-61892424 GAGAAAATGGAGGCCAAGGGTGG - Intergenic
1118087288 14:62432158-62432180 AAAAGAATGAAGGAAAGGGAAGG - Intergenic
1118202019 14:63683575-63683597 AAGGGAATGAATGACAGGGAGGG + Intergenic
1118355362 14:65009143-65009165 TTGAGAATGAAGGACCGGTGAGG + Intronic
1118613530 14:67559783-67559805 GACAGAATGAAGGTCAGCCGAGG - Intronic
1118674614 14:68170388-68170410 GAGAGAATGAAAGATTGGGCAGG + Intronic
1119404462 14:74388929-74388951 GGGAGAATGAAGCACAGGGCTGG - Intergenic
1119438630 14:74613380-74613402 GAGAGAGTGAAGGGCTGGGTGGG - Intergenic
1119573368 14:75695879-75695901 AAGGGAAGGAAGGAGAGGGGAGG - Intronic
1119898257 14:78238830-78238852 GAGGGACTGAAGGAATGGGGAGG + Intergenic
1119941606 14:78647287-78647309 TAGAACATGAAGGGCAGGGGCGG - Intronic
1120097601 14:80405912-80405934 GAGTTAAAGAATGACAGGGGAGG - Intergenic
1120133716 14:80838547-80838569 GATAGAATGGAGGCCAGAGGAGG - Intronic
1120237228 14:81905658-81905680 TGGAGAATGTAGGAGAGGGGAGG + Intergenic
1120577085 14:86195748-86195770 AAGACAATGAAGGCCAGGTGCGG - Intergenic
1121747199 14:96306800-96306822 GAGAGAATGAGGCATAGGTGGGG + Exonic
1121883558 14:97522473-97522495 GAAAGAAAGAAGGGGAGGGGAGG - Intergenic
1121893430 14:97621290-97621312 GAGAGAATGAAAGACAACAGGGG - Intergenic
1122096481 14:99376547-99376569 GAGGGAAGGAAGGGGAGGGGAGG + Intergenic
1122115886 14:99527018-99527040 GGGAGGATGCAGGACAGGGCAGG + Intronic
1122359450 14:101150881-101150903 GAGGGAAGGAAGGGAAGGGGAGG - Intergenic
1122374064 14:101247089-101247111 CAGAGGATGAGGGGCAGGGGCGG - Intergenic
1122576642 14:102747171-102747193 GACAGGATGGAGGAGAGGGGAGG - Intergenic
1122777687 14:104129277-104129299 GAAAGAAGGAAGGGAAGGGGAGG - Intergenic
1124045207 15:26142545-26142567 GAGAGAAAGAAAGAGAGGGAGGG - Intergenic
1124428844 15:29588558-29588580 GAGAGAGAGAAGGAGAAGGGAGG + Intergenic
1125349951 15:38756087-38756109 GAGAGAATGAATGAAAGTGACGG + Intergenic
1125421405 15:39508434-39508456 GAGAGAATGAAGGGCAATTGGGG - Intergenic
1125431532 15:39599527-39599549 GAGAGAAAGAAGGAGGAGGGAGG - Intergenic
1125617808 15:41031428-41031450 GAAAGAAAGAAGGAAAGGAGGGG + Intronic
1126197684 15:45950276-45950298 GAGGGAGTGAAGGACGGAGGCGG - Intergenic
1126669714 15:51104959-51104981 CAGAGAAGGAAGTATAGGGGCGG - Intronic
1126704826 15:51397351-51397373 GAGAGAGGGAAGGAAAGGGGAGG - Intronic
1126782374 15:52149786-52149808 GAGAGAAATCAGGACAGGGCCGG + Intronic
1127398716 15:58564429-58564451 AAGAAAAGGAAGGACAGGGCTGG + Intronic
1127630489 15:60823014-60823036 GAAGGAAGGAAGGAAAGGGGAGG - Intronic
1127654837 15:61046157-61046179 GAGGGAAAGGAGGGCAGGGGAGG + Intronic
1127751170 15:62045747-62045769 GAAAGAAGGAAGGACAGAAGAGG + Intronic
1127763906 15:62166102-62166124 CAGAAAATGAAGGTCGGGGGTGG - Intergenic
1128055982 15:64700524-64700546 GGCAGGATGAAGCACAGGGGTGG - Intronic
1128134614 15:65253618-65253640 AAGAGAATGAAGGCCGGGCGCGG - Intronic
1128702914 15:69817120-69817142 GAAGGAAGGAAGGAGAGGGGAGG + Intergenic
1129491139 15:75926723-75926745 GAGAGAAGGAAGGATGGGGAAGG + Intronic
1129605689 15:77023967-77023989 GAGAGGAAGAAGGAGAGGGGTGG - Intronic
1129856487 15:78828886-78828908 CAGAGACTGAAGGGCAGGGCAGG - Intronic
1130127393 15:81105222-81105244 GAGAGAAAGAAAGAGGGGGGAGG - Intronic
1130332559 15:82933590-82933612 GAGAGAATGCAGAGCAGGAGGGG - Intronic
1130750022 15:86701781-86701803 GAGGGAAGGAAGGAGTGGGGAGG - Intronic
1130755322 15:86756624-86756646 GAGAGAAGGAGGGTCTGGGGTGG + Intronic
1130759932 15:86808583-86808605 GAAGGAAGGAAGGAAAGGGGAGG - Intronic
1131071837 15:89471034-89471056 GAGAGAAAGAAGGGAAGGGATGG + Intergenic
1131430526 15:92384661-92384683 GAGGGAAAGAAGGGCAGGAGAGG + Intergenic
1131643262 15:94314909-94314931 CAGAGAATGAAAGAGAAGGGTGG + Intronic
1131938496 15:97534402-97534424 AAGATAATGAAGGGCAGAGGAGG + Intergenic
1132450542 15:101965850-101965872 GAGTGAATGAGGGAAAGGGCAGG - Intergenic
1132480776 16:165193-165215 GGGAGGGTGAAGGGCAGGGGAGG - Intronic
1132658227 16:1050078-1050100 GAGGGAGTGCAGGACAGGGCAGG + Intergenic
1132772138 16:1569567-1569589 GAGAAAAGGAAGGGGAGGGGAGG - Intronic
1132839614 16:1972606-1972628 GGGAGAATGCAGGAGAGGGGCGG + Intronic
1133157979 16:3889353-3889375 GAGAGAAGGAAGGAAGGGGAAGG - Intergenic
1133582571 16:7160409-7160431 GAAAGAAGGAAGGAAAAGGGAGG - Intronic
1133638293 16:7691449-7691471 GAGAAAAGGAAGGAAAGGGTAGG + Intronic
1133751604 16:8730307-8730329 GAGTGAATGAAGGAGGGAGGCGG - Intronic
1134076489 16:11295654-11295676 GAGGGAATGAAGGCCAGGCATGG - Intronic
1134252598 16:12584976-12584998 GAGAGACTGAAGGAGCAGGGTGG - Intergenic
1134312122 16:13084468-13084490 GTGAGAATGACAGACAGGGCTGG + Intronic
1134316819 16:13126587-13126609 GAGAGAAAGAGAGACAGGGAGGG + Intronic
1134554776 16:15155339-15155361 GAGAGACAGAAGGAGAGAGGGGG + Intergenic
1134600606 16:15530777-15530799 GAGAGAATGAATGCCAGCAGGGG - Intronic
1134650270 16:15903083-15903105 GAGAGAGAGAAGGGGAGGGGAGG - Intergenic
1134834300 16:17348114-17348136 CAGAGAAGAAAGGAGAGGGGTGG + Intronic
1135348631 16:21710402-21710424 GAGATAATGAGGGTCAGGTGGGG - Intronic
1135521465 16:23181866-23181888 AAGAGAAAGAAGGACAGGCCAGG + Intergenic
1135914506 16:26593576-26593598 GAGAAAAAGAGGGAAAGGGGAGG - Intergenic
1136605582 16:31331294-31331316 GAGAGGATGAAGGGAGGGGGTGG - Intronic
1137497672 16:48983269-48983291 GAGAAAAGGAAGGAAAAGGGAGG - Intergenic
1137610533 16:49814363-49814385 GAGGGCAAGCAGGACAGGGGTGG + Intronic
1137688589 16:50403965-50403987 GGGAGAATGAAAGAGTGGGGGGG - Intergenic
1138103070 16:54270099-54270121 GTGTGAATGAAGGACAGGGATGG + Intronic
1138446657 16:57068515-57068537 GAGAGAGTGAAAGAAAAGGGAGG - Intronic
1138448414 16:57078806-57078828 AAGGGAATGAAGGCCAGGAGAGG + Intronic
1138643691 16:58407046-58407068 GAGAGGAGGAAGGTCAGGGGGGG - Intergenic
1139674652 16:68515011-68515033 GAGAGAGTGAAGGCCGGGTGTGG + Intergenic
1139701534 16:68710927-68710949 GAGAGAAGGGAGGGGAGGGGAGG + Intronic
1139818477 16:69698117-69698139 GAGAGAAAGAAAGAAAGGGGTGG - Intronic
1140005226 16:71068073-71068095 GAGAGATTGAGGGTCAAGGGAGG + Intronic
1140410547 16:74738217-74738239 GAGAGAATGAGAGAGAGGTGGGG + Intronic
1140610403 16:76592059-76592081 GAGAGAAAGATGGACAGTTGGGG - Intronic
1140724452 16:77799425-77799447 GAGAGCATGAGGCACAGGTGTGG - Intronic
1140831554 16:78756094-78756116 GGAAGAATGATGGAAAGGGGAGG + Intronic
1140862299 16:79028556-79028578 GAGGGAAGGAAGGAGAGAGGAGG - Intronic
1140944904 16:79758709-79758731 GAGAGAAAGGAGGACGGGGCAGG + Intergenic
1140997167 16:80272257-80272279 GAGAGAATGAGAGCCAGGAGGGG + Intergenic
1141006987 16:80361792-80361814 GAGAGAATGTTGGAGATGGGGGG + Intergenic
1141063730 16:80897699-80897721 GGGAAACTGAGGGACAGGGGAGG + Intergenic
1141194320 16:81848594-81848616 GAGAGGAAGAAGGACAGAGGAGG - Intronic
1142216672 16:88833422-88833444 GAGAGAAGGAAAGAAAGGGAGGG - Intronic
1142259326 16:89035237-89035259 GAGAGAATGAAGAGGAGGGAGGG - Intergenic
1142574713 17:898910-898932 CAAAGAAGGAAGGACAGGGCTGG + Intronic
1143003350 17:3809967-3809989 GAGAGAAGGAAGATCAGTGGTGG + Intergenic
1143389561 17:6552312-6552334 GAGAGAATGAGGGTAGGGGGTGG - Intronic
1143514377 17:7412046-7412068 GAGAGAAAGCAGAAAAGGGGAGG - Intronic
1143552950 17:7642477-7642499 GAGAGAACGGAGGAGGGGGGAGG - Intergenic
1143624279 17:8100109-8100131 GAGAGAAAGAAAGAGAGGGAGGG + Intronic
1143737147 17:8919830-8919852 GAGAGAGAGAAGGAGAGGAGAGG - Intronic
1144041375 17:11414065-11414087 GAGAGGAGGAAGAAGAGGGGAGG - Intronic
1144050386 17:11492908-11492930 GACAGACTGTGGGACAGGGGAGG - Intronic
1144174175 17:12688606-12688628 GAAAGAAGGAAGGAGAGGGAAGG - Intronic
1144217645 17:13070478-13070500 GAGAGAGAGAAAGAAAGGGGGGG + Intergenic
1144255551 17:13463714-13463736 GATGGAAGGAAGTACAGGGGAGG + Intergenic
1144352904 17:14415828-14415850 GAGAAAAGGAAGGAAAGGGAGGG - Intergenic
1144365743 17:14542192-14542214 AAGGGAAAGAAGGAAAGGGGAGG - Intergenic
1145116400 17:20214440-20214462 GAAAGAATGAAGGACAGAACAGG + Intronic
1145196300 17:20897127-20897149 GAGAGAACGAAGGACAGAGAAGG + Intergenic
1145296396 17:21595965-21595987 GAGAGAAGGGAGAAAAGGGGAGG + Intergenic
1145398880 17:22515524-22515546 GAGAGAGAGAAGGAGAGGAGGGG + Intergenic
1145787806 17:27605404-27605426 GAGAGCAGGAAGAACAGGGATGG - Intronic
1146098616 17:29956841-29956863 GAGAGAAAGAAAGAGAGAGGTGG + Intronic
1146507036 17:33414407-33414429 GGGAGAAGGAAGTAGAGGGGAGG + Intronic
1146570944 17:33952136-33952158 GAGAGAATGAGAGAGAGGAGAGG + Intronic
1146667915 17:34717007-34717029 GAAGGAAGGAAGGAAAGGGGAGG + Intergenic
1147336070 17:39727569-39727591 GAGAGACTGATGGGCAGGGGAGG + Intronic
1147364785 17:39952785-39952807 GAGAGAATGACCGGCTGGGGTGG + Intergenic
1147437794 17:40428344-40428366 GAGAGAAGAGAGGGCAGGGGAGG + Intergenic
1147529612 17:41263267-41263289 GAAAGAAAGAAAGAAAGGGGAGG + Intergenic
1147534513 17:41310632-41310654 GATAGCATGGAGGACAGCGGTGG - Intergenic
1147658825 17:42106208-42106230 GAGAGAAGGAAAGAAAGGGAGGG + Intronic
1147945782 17:44079349-44079371 GAGAGAAAAAAGGCCAGGCGCGG + Intronic
1148107839 17:45128645-45128667 GGGAGGATGAGGGGCAGGGGCGG + Intronic
1148180723 17:45602647-45602669 GAGAGAAAGAAGGAAGGGGAGGG - Intergenic
1148268180 17:46243279-46243301 GAGAGAAAGAAGGAAGGGGAGGG + Intergenic
1148474145 17:47916081-47916103 GAGAGGATCATGGACAGAGGCGG + Intronic
1148679729 17:49466675-49466697 GAGAGAAGGAGGGGAAGGGGAGG + Intronic
1148859111 17:50594895-50594917 GAGAGGATGAAGAAAAGGAGGGG - Intronic
1149261320 17:54882828-54882850 GAAAGAAGGAAGGGGAGGGGAGG + Intergenic
1149327519 17:55547316-55547338 GAAAGAAGGAAGGACAGGAATGG - Intergenic
1149576700 17:57718763-57718785 GAGAGAAAGGAAGAAAGGGGAGG + Intergenic
1149674102 17:58443366-58443388 AAAAAAATGAAAGACAGGGGTGG - Intronic
1149867854 17:60160766-60160788 GAGAGAATTCAGGGCAGGGAAGG + Intronic
1150139904 17:62718834-62718856 AAGAGAAGGGAGGGCAGGGGAGG - Intronic
1150519631 17:65852429-65852451 GAGGGAAGGAAGGAAAGGGAGGG - Intronic
1150553336 17:66231302-66231324 GAGGGAAGGAAGGAGAAGGGAGG - Intronic
1150652421 17:67018682-67018704 GAGAGTATGCAGGAGAGGGTGGG - Intronic
1150723066 17:67629643-67629665 GAAAGAAAGAAGGAGCGGGGGGG + Intronic
1151345707 17:73500143-73500165 CAGAGAATGGAGGAGAGTGGAGG - Intronic
1151651215 17:75470946-75470968 AAGAAAATGAAGGTCAGGCGCGG + Intronic
1152199918 17:78939372-78939394 GGGAGTCTGAAGGACAGGGCTGG + Intergenic
1152271564 17:79327982-79328004 GAGAGAAGGAAGGCCAGGTGCGG - Intronic
1152412886 17:80138412-80138434 GATAGGATGGAGGACAGGGCTGG - Intronic
1153304486 18:3619576-3619598 GAGAGAAGGAAGGACTAGGGCGG - Intronic
1153330364 18:3867402-3867424 GAGAGAAGGGAGTACTGGGGAGG + Intronic
1153362098 18:4208820-4208842 GAGAGAATGAATGAGAGCTGTGG + Intronic
1153608834 18:6861309-6861331 GAGAGACTGTAAGACAGGAGGGG - Intronic
1153828155 18:8896279-8896301 GAGAGAAAGAGAGACAGGGAGGG + Intergenic
1153978988 18:10293532-10293554 GAGAAAAAGAAGAAAAGGGGAGG + Intergenic
1153987751 18:10368434-10368456 GTGAGAGTGAGGGCCAGGGGAGG + Intergenic
1154929934 18:20982802-20982824 GAGGAAATGAAGGACAGATGCGG - Exonic
1155218381 18:23662784-23662806 GGGAGAGTGAAGGGCCGGGGAGG - Exonic
1156183149 18:34629729-34629751 GAGAAAATGAAGGACTGGGGAGG - Intronic
1156274306 18:35568078-35568100 GAGAGAATGAGAGAGAGGGAGGG + Intergenic
1156364343 18:36411920-36411942 GAGAGAAGAAAGGCCAAGGGAGG - Intronic
1156379519 18:36545102-36545124 GAGATAAAGAAGGAGAGGGAGGG - Intronic
1156436664 18:37137968-37137990 GAGAAAAAGTAGGTCAGGGGCGG - Intronic
1156478518 18:37421529-37421551 GACACAATCAAGGACAGGGGTGG - Intronic
1156686109 18:39648756-39648778 GAAAGAAGGAAGGAGAGGGCAGG - Intergenic
1156957690 18:42988562-42988584 GAGAGAATGAAGCAGAGAGGTGG - Intronic
1157377534 18:47180096-47180118 GGGAGAATGAAGGAGTAGGGAGG - Intergenic
1157406203 18:47424439-47424461 GAGAGAGTGAAGGAAGGGGCTGG + Intergenic
1158057643 18:53301061-53301083 GAAAGAAAGAAGGAAAGGAGAGG - Intronic
1158080263 18:53581917-53581939 GAAAGAATGAATCACAAGGGAGG + Intergenic
1158396691 18:57084604-57084626 CAGAAAATGAAAGACAGGGAAGG + Intergenic
1158582094 18:58692460-58692482 GAGAGGAAGAGGGACAGGGAGGG - Intronic
1158610406 18:58935217-58935239 GAGGGAGAGAAGGAGAGGGGAGG - Intronic
1158612647 18:58956379-58956401 GAGAGAATGAAGGAGATGAGTGG + Intronic
1158772677 18:60539766-60539788 GAGAGAATGAAGGAGAGGGAAGG + Intergenic
1158799347 18:60888160-60888182 GAGAGAATGAATGCCAGCAGGGG + Intergenic
1159550835 18:69894503-69894525 GAGAGAAAGGAGGGGAGGGGAGG + Intronic
1159550891 18:69894614-69894636 GAGGGAAGGAAGGGGAGGGGAGG + Intronic
1159893166 18:73971997-73972019 GAGAGAATGAGGGAGAGGAGAGG - Intergenic
1159909239 18:74128536-74128558 GAGACAGTGAAGGAGATGGGAGG + Intronic
1160031723 18:75267563-75267585 GAGAGGATAAAGGAGAGGGAAGG + Intronic
1160619514 18:80160873-80160895 GAGAGAATCAATGGCAGTGGAGG + Intronic
1160634715 19:66697-66719 GAGTGAATGAGGGAAAGGGCAGG + Intergenic
1161030707 19:2056632-2056654 GAGAGAAGGACCGAGAGGGGAGG - Intergenic
1161131557 19:2592732-2592754 GAGGGAAGGAAGGGGAGGGGAGG + Intronic
1161139684 19:2639957-2639979 GAGGGAAGGAAGGAGGGGGGAGG + Intronic
1161302972 19:3551815-3551837 GAGAGAGGGAAGGGCAGGGCAGG - Intronic
1161452270 19:4353044-4353066 GAGGGGAGGCAGGACAGGGGCGG + Intronic
1161819951 19:6524006-6524028 GAATGAATGAAGGCCAGGTGCGG + Intergenic
1161913900 19:7214814-7214836 GAGGGAAGGAAGGAAAGGGAGGG - Intronic
1162539706 19:11287313-11287335 GAGAGAAAGAGAGACAGGAGAGG - Intergenic
1162985522 19:14266965-14266987 AGGAGGAGGAAGGACAGGGGTGG + Intergenic
1163035980 19:14569192-14569214 GAGAGAGTGAAGGATCCGGGAGG + Intronic
1163207369 19:15813534-15813556 GAGAGAAAGAAAGAGAGGTGGGG + Intergenic
1163260817 19:16188801-16188823 GAGGGAATGAAGGAGAAGGGGGG + Intronic
1163719379 19:18891443-18891465 CAGAGAATGCAGGGCAGGGCCGG - Intronic
1165278971 19:34780661-34780683 GAGGGAAGGAAGGAAGGGGGAGG + Intergenic
1165363614 19:35351164-35351186 GAGAGAATTCAGAACAGGGCTGG - Intergenic
1165365747 19:35363621-35363643 GAGAGAATTCAGAACAGGGCTGG - Intergenic
1165412444 19:35670398-35670420 GAAGGAAGGAAGGAGAGGGGAGG - Intronic
1165476928 19:36036025-36036047 CAGAGATTGAATGACAGGAGGGG + Intronic
1165491368 19:36125219-36125241 CAGTGAATGGGGGACAGGGGTGG + Intronic
1165639943 19:37376035-37376057 GAGAGAATGGAGGCCGGGTGCGG + Intronic
1165844263 19:38808243-38808265 GAGAGAAGGAAGAAGAGAGGAGG + Intronic
1166041420 19:40205091-40205113 GGGAGGAGGAAGGACAGTGGTGG - Intronic
1166389727 19:42402231-42402253 GAGAGAATGGAGGGAATGGGGGG + Intronic
1166509093 19:43392207-43392229 GAGAGAAGGAGGGAGAGGAGAGG + Intergenic
1166665296 19:44676239-44676261 GAGAGAAAGAAAGAGAGAGGGGG - Intronic
1166688138 19:44808303-44808325 GAGGGAATGAAGGAGAGAGCGGG + Intergenic
1166926522 19:46272611-46272633 GAAAGAGAGAAGGAGAGGGGAGG + Intergenic
1167108599 19:47445929-47445951 GAGAGAGAGAAGGAAAGGTGTGG + Intronic
1167240866 19:48342291-48342313 GAAGGAAGGAAGGACAGGGAGGG + Intronic
1167240880 19:48342344-48342366 GAAGGAAGGAAGGACAGGGAGGG + Intronic
1167284868 19:48593259-48593281 GAGAGAGAGAAGGCCAGGTGTGG + Intronic
1167305685 19:48707923-48707945 GAAAGAAAGAAGGGGAGGGGAGG + Intergenic
1167325783 19:48824472-48824494 GAGAGAAAGAAAGAAAGGGCCGG + Intronic
1167463295 19:49637603-49637625 GAGAGAGAGAAGGACAGGGCAGG - Intronic
1167689869 19:50978699-50978721 GAGAGAAAGAAAGACAGAGATGG + Intronic
1167742848 19:51334649-51334671 GAGATAATGGGGGACAGGTGTGG + Intronic
1168099589 19:54134060-54134082 GAGAGAGGGAGGGAGAGGGGAGG - Intergenic
1168099655 19:54134240-54134262 GAGAGAGGGAGGGAGAGGGGAGG - Intergenic
1168128407 19:54300064-54300086 GAAAGAAAGAAAGAAAGGGGGGG - Intergenic
1168158232 19:54490571-54490593 GAGAGAAAGAAGGAAAGGAAGGG - Intergenic
1168510461 19:56969392-56969414 GAAAGAAGGAAGGAAAGGAGGGG + Intergenic
925721523 2:6833089-6833111 GAGAGAAAGAAAGAGAGGGAGGG + Intergenic
925755567 2:7128411-7128433 GAAGGAAGGAAGGAGAGGGGAGG - Intergenic
925780195 2:7375045-7375067 GAGGGCATGAAAGACAGGTGAGG - Intergenic
926320540 2:11746099-11746121 ATCAGGATGAAGGACAGGGGTGG + Intronic
926345397 2:11940415-11940437 GAGATAAGGAAGGACATGAGGGG + Intergenic
926859897 2:17298645-17298667 GTGAGAAGGAAGGAGATGGGAGG - Intergenic
926921825 2:17946760-17946782 GAGGGAAGGAAGGAGAGGGAGGG - Intronic
926956843 2:18311099-18311121 GAGACAATGAAGGAGAAGGACGG + Intronic
926969725 2:18454410-18454432 GGGACAATGAATGACAGGTGAGG + Intergenic
927088123 2:19690377-19690399 GAGAGAAAGAAGGAAGGGAGGGG + Intergenic
927232190 2:20834693-20834715 GAGATAAGGAGGGAAAGGGGAGG - Intergenic
927347537 2:22063711-22063733 GAGAGAAAGGAGGGGAGGGGAGG - Intergenic
927489197 2:23509441-23509463 GGGAGAGTGAGGGACAGGGGCGG + Intronic
928180480 2:29065127-29065149 GGGAGAATGGAGGACAGGGGTGG - Intronic
928194618 2:29206248-29206270 GAGAGAAAGAAAGAAAGGGAGGG - Intronic
928211617 2:29327982-29328004 GAGAGGATGAGGGGCAGGTGGGG + Intronic
928269311 2:29842065-29842087 GAGGGAAGGAAGGAGGGGGGAGG - Intronic
928394917 2:30936182-30936204 GAGAGACAGAAGGAAAGTGGGGG - Intronic
929086527 2:38173061-38173083 GAGAAAAAGAAGGACTGGGGTGG + Intergenic
929183811 2:39071862-39071884 GAGAGAATGAATGACAGGCATGG - Intronic
929302736 2:40324686-40324708 GAGAGAGAGAAAGACAGGGAGGG - Intronic
929442112 2:41972681-41972703 GAAAGACAGAAGAACAGGGGAGG + Intergenic
929524906 2:42693106-42693128 GAGAGAAGGAAGGAGGGGGAGGG - Intronic
929748155 2:44680832-44680854 GAGAGAAAGAAAGAGAGAGGAGG + Intronic
930035130 2:47080463-47080485 GAGAGAAGAAAGGAAAGGGAAGG - Intronic
930159343 2:48138190-48138212 GAGAGAAGGAAAGAGAGGGGGGG + Intergenic
930296939 2:49566464-49566486 GAGGGAAGGAGGGACAGTGGGGG - Intergenic
930877207 2:56232554-56232576 GAGAGAATGAGGGCCAGCAGGGG - Intronic
930878943 2:56250115-56250137 GTGAGAGTGAAGGGCATGGGAGG + Intronic
930946691 2:57084459-57084481 GGGAGAATGAAGGGGTGGGGAGG - Intergenic
931053987 2:58447924-58447946 AGAAGAATGAAGGACAGGGAGGG - Intergenic
931123196 2:59244056-59244078 GAAAGAAGGAAGGAGAGGGAGGG + Intergenic
932234080 2:70107233-70107255 GAGAGAAAGAAGGAGAGAGAAGG + Intergenic
932629114 2:73323091-73323113 CAGAGAAGCTAGGACAGGGGAGG + Intergenic
932668355 2:73716219-73716241 GAGTGAATGGAGAACAGGAGTGG + Intergenic
933000137 2:76911664-76911686 GAGAGAAAGAAAGAGAGGGAAGG + Intronic
933069277 2:77836834-77836856 GAGGGAAGGAAGGAGAGGGAAGG + Intergenic
933127911 2:78634243-78634265 GGGAGAGAGAAGGACAGGGATGG + Intergenic
933200356 2:79440885-79440907 GAGAGCATCAAGGATAGGAGAGG - Intronic
933453351 2:82487867-82487889 GAGATCATGAAGGACAGTGAGGG + Intergenic
933686721 2:85147487-85147509 GAGAGGAGGAAAGACAGGGAGGG + Intronic
933997898 2:87683469-87683491 TGGGGAATGGAGGACAGGGGAGG - Intergenic
934493762 2:94780356-94780378 GACAGAAGGAAGGACAGTGAAGG - Intergenic
934755376 2:96820792-96820814 CAGAGGATGTGGGACAGGGGAGG + Intronic
934773320 2:96921660-96921682 GAGAGAAAAGAGGGCAGGGGTGG + Intronic
935051126 2:99525940-99525962 GATAGAAGGAAGGGCAAGGGAGG + Intergenic
935184628 2:100720997-100721019 GAGAGAAGGAAGGAAAGTGGTGG - Intergenic
935381776 2:102459522-102459544 GAAAGAAGGAAGGATAGGGAAGG + Intergenic
936073092 2:109384331-109384353 GAGAGGAGGAAGGACCTGGGAGG + Intronic
936090743 2:109499933-109499955 GAGAGAATGAGGGAGCAGGGAGG + Intronic
936224899 2:110640077-110640099 GACAGAATGAAGGACTTGAGAGG - Intronic
936295953 2:111267397-111267419 TGGGGAATGGAGGACAGGGGAGG + Intergenic
936534209 2:113299033-113299055 CAGAGAGAGAAGAACAGGGGAGG - Intergenic
936566762 2:113588330-113588352 GAGTGAATGAGGGAAAGGGCAGG - Intergenic
936790247 2:116142751-116142773 GAGAGAATGAGGGAGTGGAGGGG + Intergenic
936836752 2:116719194-116719216 GAAAGAATGAAGGAAGGGGTGGG + Intergenic
936953027 2:117997329-117997351 GAGTGAATGAAGAGCCGGGGAGG - Intronic
937117953 2:119422388-119422410 GAGAGGATGAAAGAGAGGGGAGG + Intergenic
937231773 2:120401965-120401987 GAGAGCAGGAAGGTCAGGGAGGG + Intergenic
937430666 2:121835649-121835671 GAGAGAGTGAAGGGGAGGTGGGG - Intergenic
937666270 2:124490365-124490387 GAGAGAAAGAAAGAGAGGGAGGG + Intronic
937720062 2:125083997-125084019 GAAGGAAGGAAGGACAGGGCAGG + Intergenic
937795416 2:126012555-126012577 TAGACAATGAAAGACAGGGAGGG + Intergenic
937863770 2:126732895-126732917 GAGAAAATGTGGGGCAGGGGTGG + Intergenic
938016982 2:127875373-127875395 GAGAGAAAGAAGGGCAAGTGGGG + Intronic
938262004 2:129903159-129903181 GAGAGAATGAGGGGATGGGGAGG - Intergenic
938809035 2:134834750-134834772 GAGAGAGAGAAAGAGAGGGGAGG + Intergenic
938938923 2:136152195-136152217 GAGGGAAGGAAGGAGAGGGAGGG - Intergenic
939252855 2:139705425-139705447 GAGAGAATGAATGCCAGCAGGGG + Intergenic
939536899 2:143442574-143442596 GAGAGAATTGAGGACTGGGTAGG + Intronic
939694133 2:145303059-145303081 TAGAGAATGAAGGAGAGAGAGGG - Intergenic
939704781 2:145439284-145439306 GAGAGACTGGAGGAGAGGGAAGG + Intergenic
939833323 2:147098741-147098763 GAGAGAAGGAAGGGGAGGGGAGG - Intergenic
941713764 2:168742724-168742746 GAAAGATTGATGGACAGGAGGGG + Intronic
942495050 2:176531464-176531486 GATAGAATGAAGGAGGTGGGAGG - Intergenic
942556149 2:177174412-177174434 GAGACAGTGAAGGAAAGGGAGGG - Intergenic
942929472 2:181472454-181472476 AAGAAAATTAAGGACAGGAGAGG - Intronic
943015173 2:182501761-182501783 GAGAGAAATGAGGACATGGGAGG - Intronic
943972952 2:194434207-194434229 GAGAGAATGAAAGAGGGTGGAGG + Intergenic
944142764 2:196475313-196475335 GGGAGAATAAAGGAGATGGGGGG + Intronic
944441980 2:199752123-199752145 GTGAGAAGGAATCACAGGGGAGG - Intergenic
944752033 2:202718846-202718868 CAGAATTTGAAGGACAGGGGAGG - Intronic
944822434 2:203444051-203444073 GAGAGAAGGAAGGGGAGGGAGGG + Exonic
944831299 2:203535656-203535678 CAGAGAATGAATGAGTGGGGAGG + Intergenic
945367816 2:208977921-208977943 GAGAGAAAGACAGAAAGGGGAGG - Intergenic
945842812 2:214908242-214908264 GAGAGAATGAGTGACAGCAGGGG + Intergenic
945876112 2:215279838-215279860 GAGGGAAGGAAGGAAAGGGAAGG + Intergenic
946010546 2:216560249-216560271 GAGAGAAGGGAGGAGAGGGGAGG - Intronic
946090380 2:217217398-217217420 GAGAAAATGAAAGAGAGGGAAGG - Intergenic
946147139 2:217739593-217739615 GAGAGATTGAAGGAAAGAGATGG + Intronic
946345825 2:219109648-219109670 CAGAGAATAAAGGAAAGGGGAGG + Intronic
946409206 2:219508106-219508128 GAGATAATGAAGGTCTGGGCTGG - Intergenic
946462584 2:219882228-219882250 GAGAGAAAGAAAGAGAGGGAGGG - Intergenic
947085899 2:226452515-226452537 GAGAGAACAAAGGGGAGGGGAGG + Intergenic
947182458 2:227423600-227423622 TAGAGAATGACAGGCAGGGGTGG + Intergenic
947539658 2:230967388-230967410 GAGAGAAAGAAAGGAAGGGGAGG - Intergenic
947594600 2:231403085-231403107 GAGAGAATGAACGTCAGGCCCGG + Intergenic
947819489 2:233060230-233060252 GAGAGAAAGAGAGAGAGGGGGGG - Exonic
947971795 2:234331136-234331158 GAGGGAGAGAAGTACAGGGGAGG + Intergenic
948344312 2:237282623-237282645 GAAGGAAGGAAGGAGAGGGGAGG + Intergenic
948388945 2:237598348-237598370 GAGGCAATGAAGGAGAGGAGAGG - Intronic
948718026 2:239878293-239878315 GACAGAAAGATGGACAGGGTGGG + Intergenic
948877194 2:240836024-240836046 GAAAGAAAGAAGGCCAGGCGCGG + Intergenic
949016836 2:241718274-241718296 GAAAGAAAGAAGGAAAGGGAAGG - Intronic
1170355785 20:15490251-15490273 GAGAGAAAGAAGGGAAGGGAAGG - Intronic
1170696463 20:18663799-18663821 GAGAGAATGAGTGCCAGCGGGGG + Intronic
1170916657 20:20633097-20633119 GAGAGAAAGAAAGAGAAGGGAGG - Intronic
1171035922 20:21712999-21713021 GAGGGAATGGAGGGCAGGAGGGG + Intronic
1171036326 20:21715125-21715147 GAGAGAAGGAACGACAGGGATGG - Exonic
1171041239 20:21765683-21765705 GACTGAATGAAGAACTGGGGTGG + Intergenic
1171185337 20:23120632-23120654 GAGACAAGGAAGGAAAGGGCAGG - Intergenic
1171469977 20:25362569-25362591 AAGAGACAGAAGGGCAGGGGAGG + Intronic
1171966451 20:31534371-31534393 GAAGGAAGGAAGGAGAGGGGAGG + Intronic
1172116822 20:32578041-32578063 GAGAAAATTAAGGCCATGGGAGG + Intronic
1172399942 20:34641304-34641326 GAGAGGAGTAGGGACAGGGGTGG - Intronic
1172615642 20:36281981-36282003 GAGAGAATGGAGAGCAGGGTGGG + Intergenic
1172723449 20:37016910-37016932 AAGAGAAAGGAGGGCAGGGGAGG + Intronic
1172823052 20:37755870-37755892 GTGAGCATGAGGGACGGGGGTGG - Intronic
1172919988 20:38473103-38473125 AAGAGAGGGAAGGAGAGGGGAGG - Intronic
1173001806 20:39110378-39110400 GAGAGAAGGAAAGGAAGGGGAGG - Intergenic
1173002036 20:39111621-39111643 GAGAGGAGGAGGGAAAGGGGAGG + Intergenic
1173015446 20:39221104-39221126 TAGGGAAAGAAGAACAGGGGAGG + Intergenic
1173054722 20:39599917-39599939 GAAAGAAGGAAAGACAGGGTAGG - Intergenic
1173067815 20:39729757-39729779 GAGAGAGAGAGAGACAGGGGAGG - Intergenic
1173192586 20:40887568-40887590 GAGAGAATGGAGGCGGGGGGGGG - Intergenic
1173201634 20:40959413-40959435 GAGAGAAAGGAGGAGAGGGAAGG + Intergenic
1173251425 20:41366077-41366099 GAGAGAAGGGAGGCCCGGGGCGG + Intronic
1173898782 20:46571739-46571761 GAGAGGAAGAGGGACTGGGGTGG + Intronic
1174199048 20:48794332-48794354 GAGAGAGGGAAGGCAAGGGGCGG + Intronic
1174267233 20:49340744-49340766 GAGAGAGGGAAGGAAAGGGAAGG - Intergenic
1174625446 20:51910676-51910698 GAGAGAAAGAAAGACAGGCTTGG + Intergenic
1175496433 20:59417776-59417798 GAGAGAAAGAATGACAGTGTAGG + Intergenic
1175571645 20:60027230-60027252 GTGAAAAAGAAGGACAGTGGTGG + Intronic
1175791754 20:61744414-61744436 GAGAGAGAGAAGGAAAGGGAGGG + Intronic
1175791770 20:61744490-61744512 GAGAGAGAGAAGGAAAGGGAGGG + Intronic
1175791787 20:61744567-61744589 GAGAGAGAGAAGGAAAGGGAGGG + Intronic
1176945514 21:14975667-14975689 GAGAGAAAGAAAGAAAGGGAGGG + Intronic
1177567663 21:22845341-22845363 GAGAGAAAGAAGGTCAGGCGTGG + Intergenic
1177745861 21:25212353-25212375 GAGTTAATGAAGGACTGGTGAGG + Intergenic
1177796571 21:25784881-25784903 GAGAGAAAGAAGGAAAAGGAAGG - Intergenic
1178262614 21:31113994-31114016 CAGAGAAAGGAGGACAGGAGTGG + Intergenic
1178290289 21:31362239-31362261 GAGAGAGTGAAGGAAGAGGGTGG - Intronic
1178630755 21:34259295-34259317 GAGAGAATCAGGGCCAGAGGAGG + Intergenic
1178933929 21:36844360-36844382 GCGAGACAGAAGGACAGGGAGGG + Intronic
1179049030 21:37872898-37872920 GAGAGAATGAGTGACAGCAGGGG - Intronic
1179646984 21:42782091-42782113 GAGAGAAGGAAAGAGAGGGAAGG - Intergenic
1179647390 21:42784275-42784297 GAGGGAACGAAGGAGAGGGGAGG - Intergenic
1180186842 21:46144497-46144519 GAGAGAGGGAGGGAGAGGGGAGG - Intronic
1180300328 22:11031956-11031978 GAGAGAGAGAAAGAGAGGGGAGG - Intergenic
1180300355 22:11032092-11032114 GAGAGACAGAGAGACAGGGGAGG - Intergenic
1180638474 22:17279343-17279365 GAGAGAACAAGGGACAGGGAAGG - Intergenic
1180729590 22:17971653-17971675 CAGAGATGGAAGGACAGTGGTGG + Intronic
1180881107 22:19204079-19204101 AACAGAGTGAAGGACAAGGGTGG - Intronic
1181085346 22:20437158-20437180 GTGAGGAGGAAGGTCAGGGGAGG - Intronic
1181146572 22:20852628-20852650 GAGATAATGAGGGTCAGCGGAGG - Intronic
1181628254 22:24135746-24135768 GAGAAACTGAAGGGCAGAGGTGG + Intronic
1181938188 22:26453925-26453947 GAGGGAGTGAAGGACAGGAGTGG + Intronic
1182103304 22:27672109-27672131 GAGGGAAGGAAGGGGAGGGGAGG + Intergenic
1182103838 22:27675058-27675080 GAGAGCAAGAAGGAAAGGGAGGG - Intergenic
1182222183 22:28767453-28767475 GAGGGAAGGAAGGAGAGAGGAGG - Intergenic
1182268474 22:29137578-29137600 GAGACGTTGAAGGACAGAGGTGG - Exonic
1182440111 22:30358077-30358099 GAGAGGAGGAAGGAGAGAGGGGG - Intronic
1182482310 22:30617099-30617121 TGGGGAATGAGGGACAGGGGAGG + Intronic
1182482326 22:30617142-30617164 TGGGGAATGAGGGACAGGGGAGG + Intronic
1182778813 22:32851096-32851118 GAGAGAAAAATGGGCAGGGGTGG + Intronic
1182953153 22:34396484-34396506 GAGAGAGGGAAGGGAAGGGGAGG - Intergenic
1182988401 22:34742817-34742839 GAGAGACTGAGGGGCAGAGGAGG + Intergenic
1183108330 22:35630280-35630302 GGGAGAAGGAGGAACAGGGGAGG + Intronic
1183157236 22:36084930-36084952 TCGAGAATGAAAGGCAGGGGTGG - Intergenic
1183201977 22:36391591-36391613 CAGAGAATGGAGTACAGAGGAGG - Intergenic
1183219358 22:36502665-36502687 GAGAGAAGGAAGGAGAGAGAGGG - Intronic
1184279693 22:43429913-43429935 GTGGGAAGGAAGGACAGGTGTGG + Intronic
1184291800 22:43501371-43501393 GAGAGAAAGAAGGAAGAGGGAGG - Intronic
1184395097 22:44230512-44230534 GAGAGAATGAAGAAAAGTAGGGG - Intergenic
1184463826 22:44657479-44657501 GAGAGAGAGAAGGGAAGGGGAGG + Intergenic
1184533541 22:45071575-45071597 GAGAGGAGGCAGGGCAGGGGTGG + Intergenic
1184659955 22:45961170-45961192 GAGAGAATGAATAACAGGTCTGG + Intronic
1184863857 22:47191928-47191950 GAGAGAAAGAGAGACAGGGGAGG + Intergenic
1185182479 22:49371468-49371490 GAGGGACTGCAGGACAGGGAGGG - Intergenic
1185217966 22:49614078-49614100 GAGTGAAGGAAGGACCCGGGAGG + Intronic
1185241736 22:49750597-49750619 GAGGGAAGGAAGGGGAGGGGAGG + Intergenic
949651438 3:6164562-6164584 GAGAGAGTGAAGGCCAGCAGGGG - Intergenic
949773872 3:7609636-7609658 GAGTAAATGAAGGCCAGGGAAGG + Intronic
950071523 3:10156633-10156655 GAGAGAATGAATGCCAGCAGGGG + Intergenic
950265322 3:11568945-11568967 GAGAGAAAGATGGAAAGAGGAGG + Intronic
950402579 3:12781278-12781300 GAAAGAAAAAAGGAAAGGGGAGG - Intergenic
950579238 3:13851982-13852004 GAGACAATGAGGGAAAGGAGGGG + Intronic
950636462 3:14318687-14318709 AAGAGAAAGAAGGAAAGGGCAGG + Intergenic
951149757 3:19274885-19274907 GAGAGAGGGAAGGGAAGGGGAGG - Intronic
951677169 3:25254669-25254691 GTGAGAAGGAAGGAGAGGGAGGG + Intronic
951743994 3:25956518-25956540 GACAGAATGAAGGAATGGGCAGG - Intergenic
951816861 3:26763902-26763924 GAGAGAAGGAAGGGAAGGAGAGG + Intergenic
952267052 3:31796878-31796900 GAGAGAAGTGAGGAGAGGGGAGG - Intronic
952439814 3:33315165-33315187 GAAAGAATGAAAGACAGGGAAGG - Intronic
952760909 3:36913475-36913497 GAGAGAAAGAAAGAGAGGAGAGG - Intronic
952760912 3:36913502-36913524 GAGAGAAAGAAAGAGAGGAGAGG - Intronic
952823932 3:37509211-37509233 GAGAGGATTAGGGACAGGGTGGG - Intronic
952951749 3:38531354-38531376 GAGAGAGTGAAGGACAGAGCCGG + Intronic
953307351 3:41842594-41842616 GAGAGAAGGAAAGAGAGAGGAGG - Intronic
953352519 3:42226522-42226544 GAGACAACCAAGGACAGTGGAGG + Intergenic
953470881 3:43164769-43164791 GGGAGAATGAGGGAGATGGGAGG + Intergenic
953991831 3:47489781-47489803 GAAAGAAAGAAAGAAAGGGGTGG - Intergenic
954166393 3:48762127-48762149 AAGAAAATGAAGGCCAGGTGCGG + Intronic
954567618 3:51611844-51611866 GAGAGAAGGTAGGCCAGGCGCGG - Intronic
954963914 3:54593381-54593403 GAAAGAAAGAAGGAGAGGGGAGG + Intronic
954992205 3:54851262-54851284 GAAAGGATGAAGGGGAGGGGAGG + Intronic
955188368 3:56736800-56736822 GAAAGAACGAAGGACAGGCACGG + Intronic
955460622 3:59179002-59179024 TAGATAATGAAGGCCAGGTGTGG + Intergenic
956018901 3:64912868-64912890 GAGAGATTGAGGCACAGGGTTGG - Intergenic
956151722 3:66250714-66250736 GAGAGACTGAAGGGAAGGAGGGG + Intronic
956160431 3:66345672-66345694 GAGAGAAGGAAGGTAAGGGGTGG - Intronic
956241400 3:67134729-67134751 AGAAGAATGAAGGACAGGGTTGG + Intergenic
956245709 3:67180727-67180749 GAGAGAAGGATGGGAAGGGGAGG - Intergenic
956530563 3:70213097-70213119 GAGAGAATGAAGGCCAGACATGG - Intergenic
956545370 3:70395305-70395327 GAGAGAGAGAAGGAGAGGAGAGG - Intergenic
956615828 3:71171651-71171673 GCAAGTATGAAGGACAGAGGAGG - Intronic
957113667 3:75996358-75996380 GAGAGAATGAGTGCCAGGAGGGG - Intronic
957293895 3:78311421-78311443 GAGAGAATGAAGGTGGTGGGAGG + Intergenic
957332346 3:78781479-78781501 GAGAAAATAAAGGAGAGGAGTGG - Intronic
958070168 3:88599672-88599694 GAAAGAAAGAAAGAGAGGGGAGG - Intergenic
958087245 3:88826031-88826053 GAGAGAAGGAAGGAAAGGAAAGG - Intergenic
958431221 3:94043653-94043675 GAAAGAAAGAAAGAAAGGGGAGG - Intronic
958700337 3:97581047-97581069 GTGAGCATGAAAGACAAGGGAGG - Intronic
958832907 3:99111161-99111183 GAGAGAATGAATGCCAGCAGGGG + Intergenic
958872387 3:99576072-99576094 GAGAGAGTGAACAACAGGGAGGG - Intergenic
959393527 3:105805899-105805921 GAAAGAATGAAAGAGAGGGAGGG + Intronic
960043393 3:113173228-113173250 GAAGGAAGGAAGGAGAGGGGAGG + Intergenic
960309322 3:116100937-116100959 GAGAGAATGAATCACAGAGAAGG - Intronic
960480235 3:118179127-118179149 GAGAGAGGGAAGGAGTGGGGTGG + Intergenic
960846822 3:122011638-122011660 GAGAGAAAGAGAGACAGGGCAGG - Intronic
960990126 3:123304742-123304764 GAGAGAATGAGGGAAATGGCAGG - Intronic
961149820 3:124628309-124628331 GAGGGAAGGAAGGAGGGGGGAGG - Intronic
961318013 3:126053836-126053858 CAGAGCAGGAAGGACACGGGTGG - Intronic
961466261 3:127083707-127083729 GAGAGAGAGAGGGAGAGGGGAGG - Intergenic
961475871 3:127145961-127145983 GAGAGATTGGAGGCCAGGTGTGG - Intergenic
961795430 3:129405365-129405387 GTGAGAAGGAAGGAGAGGGAAGG + Intronic
961999540 3:131281015-131281037 GAGAGAGGGAAGGACACGAGAGG - Intronic
962058494 3:131900072-131900094 GAGAAAATGAAAAACAGTGGAGG + Intronic
962102753 3:132359614-132359636 TGGAGAATGAAGGAGAGGGTAGG - Intronic
962254570 3:133861596-133861618 CAGGGCATGAAGGACAGGGAGGG - Intronic
962933477 3:140058811-140058833 GACAGAATGAAGGTGAGAGGGGG + Intronic
963015697 3:140821911-140821933 GAGAGAAGGAAGGCTAGGAGGGG + Intergenic
963202974 3:142602965-142602987 GAGAGAATGAGGGCCAGAGGTGG - Intronic
963626010 3:147673531-147673553 GAGAGAGAGAAAGACAGGGTAGG - Intergenic
963689915 3:148486780-148486802 GAGAGAATGAAAGGAAAGGGAGG - Intergenic
963832023 3:150018277-150018299 GAGAAGAGGGAGGACAGGGGAGG + Intronic
963926160 3:150953332-150953354 AAGAGAATGAAAGAAAGGGAGGG - Intronic
964074034 3:152671410-152671432 GAGAGAAAAAAAGAAAGGGGTGG + Intergenic
964086780 3:152828116-152828138 GAGAAAAGGAAAGAGAGGGGAGG + Intergenic
964350326 3:155796893-155796915 GACAAAATGAAGGACAGGCCTGG + Intronic
964607353 3:158572371-158572393 GGGAGTATGAAGTGCAGGGGAGG + Intronic
964650474 3:159005897-159005919 GTGAGAGTGAAAAACAGGGGAGG + Intronic
964683193 3:159365136-159365158 AAGAGAAGGAAGGATTGGGGCGG + Intronic
964779067 3:160315099-160315121 GAGAGAAAGAAAGAAAGAGGAGG + Intronic
964883576 3:161452611-161452633 GAGAGAGAGAATGACAAGGGGGG + Intergenic
965502933 3:169478057-169478079 CTGAGAATGAAAGACAGGGAAGG + Intronic
965783180 3:172309636-172309658 GAGAGAAGGAAGGGAAGGAGAGG + Intronic
966142301 3:176769822-176769844 GAAGGAAGGAAGGAAAGGGGAGG + Intergenic
966179247 3:177172659-177172681 GAGAGAAGGGAGGGGAGGGGAGG + Intronic
966619676 3:181950617-181950639 GAGACATTGAAGGAAAAGGGGGG - Intergenic
966888608 3:184390228-184390250 GGGAGAGTGAAGGGAAGGGGAGG - Intronic
967147043 3:186615186-186615208 GAAAGAAAGAAGGAGAGGGAGGG + Intronic
967187555 3:186958373-186958395 GGGAGAATGTGGGACAGGAGAGG + Intronic
967607768 3:191467894-191467916 GAGAGAATGAGTGCCAGCGGGGG + Intergenic
967794955 3:193590009-193590031 GAGAAAATGAAGGACTGAGAGGG - Intronic
968789189 4:2647690-2647712 GAGAGCAGGCAGGCCAGGGGTGG - Intronic
968989058 4:3896376-3896398 AAGAGAATGGAGGACAGGCCCGG - Intergenic
969020029 4:4133618-4133640 AAGAGAATGAAGGTCAGGCCTGG - Intergenic
969144927 4:5114258-5114280 GTCAGAATGAAGGGCAGGAGGGG - Intronic
969294901 4:6263994-6264016 GAGAGGACGAAGGAGGGGGGTGG + Intergenic
969481576 4:7449298-7449320 GAGAGAAGGGAAGAAAGGGGAGG - Intronic
969525310 4:7701233-7701255 GAGAGAAAAAAGGAGAGAGGAGG + Intronic
969644896 4:8422172-8422194 GAGAGAAAGAAAGAGAGAGGGGG + Intronic
969677347 4:8621404-8621426 GACAGAATGAAGTGCAGGGAAGG - Intergenic
969678302 4:8627042-8627064 GACAGAATGAAGTGCAGGGAAGG - Intergenic
969679258 4:8632680-8632702 GACAGAATGAAGTGCAGGGAAGG - Intergenic
969700939 4:8767427-8767449 AATAGAATGAAGGAGAGGGTTGG - Intergenic
969793415 4:9507852-9507874 AAGAGAATGAAGGTCAGGCCTGG + Intergenic
970494187 4:16609095-16609117 GAGAGAAGGAAGAACAGCGCGGG + Intronic
970626903 4:17896266-17896288 GAGAGAGGGAAGGAAAGGAGAGG - Intronic
970728484 4:19075383-19075405 GAAAGAAGGAAGGAAAGGGAAGG + Intergenic
970824998 4:20260946-20260968 AAGAGAATGGAGGAGAGGGGAGG - Intronic
970954830 4:21798068-21798090 GAGAGAAAGAAGGAAAGGAAAGG - Intronic
971344432 4:25798843-25798865 GAAAGAAAGAAAGACCGGGGAGG + Intronic
971394299 4:26214375-26214397 GAGAGAAAGAAGGGGAGGGAGGG + Intronic
971666749 4:29496787-29496809 GAGAGATTTAAGCACTGGGGTGG - Intergenic
972645680 4:40966193-40966215 GAGAGAAAGAACGAGGGGGGAGG - Intronic
972924178 4:43983660-43983682 GAGGGAAGGAAGGAAAGGGAAGG + Intergenic
973308768 4:48683861-48683883 GAGAGAAGGAGGGAGAGAGGGGG - Intronic
974028115 4:56751929-56751951 AAGAGAATGGAGGACGGGCGCGG + Intergenic
975315894 4:72952879-72952901 GATAGAATAAAGGACACTGGAGG + Intergenic
975609684 4:76191754-76191776 GAAAGAAAGAAAGACAGGGAGGG - Intronic
976389409 4:84493559-84493581 GAGAAAAGGGAGGAGAGGGGAGG + Intronic
976427894 4:84927701-84927723 GAGAGAATGAATGCCAGCAGAGG - Intronic
976707620 4:88035617-88035639 GAGGGAATGGAGAATAGGGGTGG + Intronic
976744832 4:88392135-88392157 GACAGAAGGGAAGACAGGGGAGG - Intronic
976854916 4:89591906-89591928 AAGAGAAAGAAAGAGAGGGGGGG + Intergenic
977980144 4:103311552-103311574 GAGAAAAGGAAAGCCAGGGGAGG + Intergenic
978007524 4:103635972-103635994 GAGAGGAAGAAGGACGAGGGAGG - Intronic
978363107 4:107951693-107951715 GGGAGAATAAAAGAAAGGGGTGG - Exonic
978581959 4:110240711-110240733 TATAGAATGAAGGATGGGGGTGG + Intergenic
978788089 4:112632230-112632252 GAGAGAGAGAAGGAGAGGGAGGG + Intronic
979207864 4:118062450-118062472 GAGAGAGTGAGGGAGAGGGAGGG - Intronic
979469009 4:121072648-121072670 GAGAGAAGGAGGGACGGAGGGGG - Intronic
979845289 4:125501901-125501923 TAGAGAATGGATGACAGGGAGGG - Intergenic
980122104 4:128738580-128738602 AATAGAATGAAGGCCAGGAGTGG + Intergenic
980603313 4:135055375-135055397 GAAGGAATGAAGGAGAGGGGAGG - Intergenic
980603324 4:135055526-135055548 GAAGGAATGAAGGAGAGGGGAGG - Intergenic
980814895 4:137932383-137932405 GAGAGAATGAGTGACAGCAGGGG + Intergenic
980969960 4:139558434-139558456 GTGGGAGTGAAGGAGAGGGGAGG + Intronic
981114757 4:140976671-140976693 GAGAGAAGGGAGGCCAGGAGAGG - Intronic
981409265 4:144409812-144409834 GAGAGAAGGAAGGGAAGGGAAGG + Intergenic
981917141 4:150046940-150046962 GGGAGAAGGAAGGAAGGGGGTGG - Intergenic
982402267 4:154981492-154981514 GATAGAATAAAGGACAGGCCAGG - Intergenic
982402443 4:154983118-154983140 GGGAAAATGAAGGAAAGGGGAGG + Intergenic
982666383 4:158269553-158269575 GAGAGATGGAAAGGCAGGGGAGG - Intergenic
982962851 4:161862442-161862464 GAGAGAATGAAGGCCGTGTGCGG + Intronic
984042484 4:174752516-174752538 GAGAGAATGAGAGAAAGGGGTGG + Intronic
984112909 4:175642571-175642593 GAGAGCATGAAGGAAAAGGTGGG - Intronic
984467981 4:180125696-180125718 AAGAGAGTGGAGGAAAGGGGAGG + Intergenic
984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG + Exonic
984852010 4:184162597-184162619 GAGGGAATGAATGACTGGAGGGG + Intronic
984990083 4:185371828-185371850 GAGAGGATGAAGGGAAGGAGGGG - Intronic
985013082 4:185604449-185604471 GAGAGAATGAAATGGAGGGGAGG + Intronic
985042940 4:185910452-185910474 GAGAGAAGGGAGGACAGGAGAGG - Intronic
985106970 4:186509436-186509458 GAGGGAAGGAAGGAGAGAGGAGG + Intronic
985108582 4:186523622-186523644 GAGAGAATGGAGGTGAGGGGTGG - Intronic
985485634 5:146682-146704 GAGAGAAGGGAGGACTGTGGGGG - Intronic
985890052 5:2708420-2708442 GAGAGGATGAAGCCCTGGGGAGG - Intergenic
985912710 5:2896190-2896212 GAGAGAGTGAGGGACAGGTGAGG - Intergenic
986278653 5:6304519-6304541 GAGAGAAAGAAGAAGAGGAGGGG + Intergenic
986295055 5:6430963-6430985 GACAGAGGGAAGGACAGGGGAGG + Intergenic
986532973 5:8758553-8758575 GAGAGAATGAATGCCAGCAGGGG - Intergenic
986867438 5:12006497-12006519 GAGAGAGAGAAAGACAGGAGAGG - Intergenic
987344192 5:16964268-16964290 GAGAAAGTGAAGGGGAGGGGAGG - Intergenic
987610807 5:20199866-20199888 GAGAGAATGAATGCCAGCAGGGG - Intronic
987663170 5:20904135-20904157 GAGAGAGAGAAGGGCGGGGGAGG + Intergenic
987681442 5:21140957-21140979 GAGAGAATGAATGCCAGCAGGGG - Intergenic
987795013 5:22616672-22616694 GAAAGAAAGTAGGAAAGGGGAGG + Intronic
988051424 5:26036100-26036122 GAGAGCAAGAAAGAGAGGGGTGG + Intergenic
988680552 5:33480819-33480841 GAGGGGATGAAGGGGAGGGGAGG - Intergenic
988680638 5:33481033-33481055 GAGGGAATGAAGGGGAGGGGAGG - Intergenic
988680677 5:33481155-33481177 GGGGGAATGAAGGGGAGGGGAGG - Intergenic
988927625 5:36005434-36005456 GAAAGAAGAAAGGGCAGGGGAGG + Intergenic
990879307 5:60521668-60521690 CAGAGAATAAGGGAGAGGGGAGG + Intronic
991173749 5:63660244-63660266 GAGAGAAAGAGGGAGAGGGAAGG - Intergenic
991433612 5:66573445-66573467 GAAAGAAGGAAGGGAAGGGGGGG + Intergenic
991461038 5:66859463-66859485 GAGGCAAGAAAGGACAGGGGTGG - Intronic
991491950 5:67192589-67192611 GAGAGAGAGAATGACAGAGGAGG + Intronic
991922107 5:71667311-71667333 GAAGGAAGGAAGGAAAGGGGAGG - Intergenic
992170653 5:74098387-74098409 GTAAAAATGAAGGACAGGGTGGG - Intergenic
993113778 5:83693422-83693444 AAGAGAATGAAGAACAGAAGAGG + Intronic
993302811 5:86233073-86233095 AAGAGAAGGAAGGAGAGGGATGG + Intergenic
993346393 5:86788622-86788644 AAGAGAAGGAAAGAAAGGGGAGG + Intergenic
994312999 5:98298359-98298381 GAGAGAAAGAGAGACTGGGGTGG - Intergenic
994383610 5:99101639-99101661 GGGAGAATGAAGCAAAGTGGAGG - Intergenic
994638082 5:102367523-102367545 GAGAGAAAGAAAGAGAGAGGAGG + Intergenic
994731046 5:103490672-103490694 GGGAGAATGAAGGAGGAGGGAGG - Intergenic
994873351 5:105381487-105381509 GAGAGAATGAATGACAGCAGGGG + Intergenic
994906248 5:105843564-105843586 AAGAGAAGAAAAGACAGGGGAGG - Intergenic
994981529 5:106880906-106880928 GAGAGAATGCAGGTAAGGGTGGG - Intergenic
995003730 5:107165729-107165751 GAGATAAGGAAATACAGGGGAGG - Intergenic
995154849 5:108898600-108898622 GAAGGAAGGAAGGAAAGGGGAGG - Intronic
995157659 5:108934275-108934297 GAGAAAATGAAGGTCAGAGGGGG - Intronic
996279072 5:121705506-121705528 GAGAGAAAGAAAGAGAGAGGGGG + Intergenic
996461813 5:123753606-123753628 GGGAGAATGGAGGGGAGGGGAGG - Intergenic
996938693 5:128977452-128977474 GAGAGAGAAAAGGAAAGGGGTGG + Intronic
997440130 5:133903395-133903417 GACAGAATGTAGGCCAGGCGCGG + Intergenic
997935107 5:138103526-138103548 CAGAGTGTGAAGGACAGGGCAGG + Intergenic
998014795 5:138723535-138723557 GAGAAGATGAAAGAGAGGGGTGG + Intronic
998040868 5:138950371-138950393 GAGACAGTGATGGACAGAGGTGG + Intronic
999184768 5:149698856-149698878 GAGGGAAGGAAGGAGAGGGAAGG + Intergenic
999719561 5:154388917-154388939 GAGAGAGAGAAGGAGTGGGGAGG + Intronic
999742066 5:154563528-154563550 GATAGAATAAAGGGAAGGGGAGG - Intergenic
999827309 5:155286169-155286191 GAGAGAATGGAAGAAGGGGGAGG - Intergenic
999990356 5:157044327-157044349 GAAAGAAGGAAGGAAAGGGAAGG + Intronic
1000081311 5:157850065-157850087 GAGAAAGTGAGGGACAGTGGTGG + Intronic
1000788367 5:165573767-165573789 GAGAGCATTAAGGACAGTGATGG + Intergenic
1000907946 5:166986106-166986128 GTGAGCATGAAGGACAGGTGAGG + Intergenic
1001039957 5:168327256-168327278 GAAAGAATGAGGGAAAGGAGAGG - Intronic
1001049201 5:168400832-168400854 GAGAGAGAGAAGGGGAGGGGAGG + Intronic
1002059074 5:176615756-176615778 GGCAGAATGAGGGACATGGGTGG - Intergenic
1002930640 6:1632403-1632425 ACGAGACTGGAGGACAGGGGAGG + Intronic
1003052610 6:2793466-2793488 GTCAGAAGGAATGACAGGGGAGG - Intergenic
1003395304 6:5747744-5747766 GAGAGCTGGAAGGACAGAGGTGG + Intronic
1003418434 6:5934457-5934479 GGCAGAAGGAAGGACGGGGGCGG - Intergenic
1003462429 6:6342339-6342361 GAGAGAATGAGAGACAGCAGGGG - Intergenic
1003479661 6:6519379-6519401 CAGTGAATGAAGGAAAGAGGAGG - Intergenic
1003759150 6:9155682-9155704 GAAAGAAGGAAGGAAAGGGAAGG + Intergenic
1004077990 6:12362819-12362841 GAGAGAAAGAGGGGCAAGGGTGG + Intergenic
1004320167 6:14625902-14625924 GAGAGGAAGAAGGAGAAGGGAGG + Intergenic
1004761545 6:18672171-18672193 GAGAGAGAGAGGGAGAGGGGTGG + Intergenic
1005534784 6:26744415-26744437 CAGAGAAAGAAGGAGAGTGGTGG + Intergenic
1005586984 6:27286696-27286718 GAAAGTATGAAGGAAAGGGCCGG + Intronic
1005666510 6:28063048-28063070 GAAAGAAGGAAGGGGAGGGGAGG + Intergenic
1006057502 6:31396217-31396239 GAGAGAAGGAAGGAGAGGTCTGG + Intergenic
1006069927 6:31490874-31490896 GAGAGAAGGAAGGAGAGGTCTGG + Intergenic
1006457535 6:34140581-34140603 GAGAGGAGGAAGGTCAGGGTGGG - Intronic
1006972762 6:38063694-38063716 AAGAGAATGAAAGACAAGGCTGG + Intronic
1007019349 6:38503775-38503797 GAGGAAATGAAGGACCTGGGAGG - Intronic
1007060165 6:38932725-38932747 GAGAAAAAGAATGACAAGGGAGG + Intronic
1008466860 6:51841405-51841427 GAGAAAAGGAAGGAAAGGAGAGG - Intronic
1009007953 6:57809759-57809781 GAGAGAAAGAAAGAGAGTGGTGG + Intergenic
1009840097 6:69060250-69060272 GAGAGAAGGAGAGACAGAGGAGG - Intronic
1009866578 6:69405673-69405695 GAGAGAAAGGAGGACAGGATGGG + Intergenic
1009890305 6:69672553-69672575 GGAAGAATGAAGAAGAGGGGTGG - Intergenic
1011768494 6:90650151-90650173 AAGAAAATAAAGGACAGGGAGGG - Intergenic
1012353314 6:98280504-98280526 GAGAGACAGATGGACAGAGGGGG - Intergenic
1012587660 6:100944077-100944099 GAGAGAGGGAAGGAGAGGTGAGG + Intergenic
1012758768 6:103268054-103268076 GAGAGGATGAAAGACAAGAGTGG + Intergenic
1012985788 6:105875104-105875126 GAGAGAATCAAGGGCATGGAGGG + Intergenic
1013742891 6:113309548-113309570 GAGAGAATGAGGGAGAGAGGGGG + Intergenic
1013916580 6:115346437-115346459 CAAAGAAAGAAGGAAAGGGGAGG - Intergenic
1014684357 6:124477680-124477702 GAGAGGATGAGGGAGAGGGGAGG - Intronic
1014737398 6:125110572-125110594 GAGAGGGAGAAGGAGAGGGGAGG - Intergenic
1015026682 6:128541500-128541522 GGGAGAATGAAAGAGAGGGAGGG - Intergenic
1015067960 6:129053839-129053861 AAGAGAATGAAGGACAGAGGAGG + Intronic
1015120834 6:129699715-129699737 GAAAGGATGAAGTAGAGGGGAGG - Intronic
1015398196 6:132758906-132758928 GAGAGAAAGAAGGAAAGAAGCGG - Intronic
1015528199 6:134193789-134193811 GGGAGAAGGGAGGAGAGGGGAGG + Intronic
1015528208 6:134193811-134193833 GGGAGAAGGGAGGAGAGGGGAGG + Intronic
1015556801 6:134470852-134470874 GAATGAAGGAAGGAGAGGGGAGG - Intergenic
1015649855 6:135444508-135444530 GAGTGAAGGAGGGACAAGGGCGG - Intronic
1016183312 6:141173074-141173096 GAAAGAAAGAAGGAATGGGGAGG + Intergenic
1016917108 6:149254102-149254124 GAAGGAAGGAAGGACAGGGAAGG + Intronic
1017652070 6:156593122-156593144 GAGAGAAAGAAGGAAGAGGGAGG + Intergenic
1017816208 6:158018274-158018296 GAGAGAAGGAAGGAAACAGGTGG - Intronic
1017897743 6:158695704-158695726 GACAGAATGTAGGACAGTGGGGG - Intronic
1018486838 6:164249204-164249226 GAGAGAATGAATTACAGGGAAGG - Intergenic
1018591693 6:165432423-165432445 GAGCGAGTGAGGGACAGGTGGGG + Intronic
1018781958 6:167076228-167076250 GAAGGAAAGAAGGAAAGGGGAGG - Intergenic
1018787435 6:167119088-167119110 GAGAGCAGTAAGGACAGGTGGGG - Intergenic
1018825112 6:167403055-167403077 GGGAGGCTGAAGGACAGGGTTGG - Intergenic
1019180705 6:170186052-170186074 GAGAGCAGGAAGGAAACGGGAGG - Intergenic
1019336468 7:485209-485231 GAGGGAATGAAGGAGGGAGGAGG + Intergenic
1019616029 7:1962153-1962175 GAGATAATGAATCACAGGGATGG + Intronic
1019641571 7:2106343-2106365 TAGAGAAGGAAGGGCAGGGTGGG - Intronic
1019780017 7:2934191-2934213 GAGAGAAAGAAAGACAGGCTGGG - Intronic
1020093865 7:5356816-5356838 GAGAGAGTGAGGGGCGGGGGGGG + Intronic
1020173789 7:5866322-5866344 GACAGAAGGAAGGAGTGGGGGGG + Intergenic
1020227025 7:6288459-6288481 GAAAGAAGGAAGAAAAGGGGAGG - Intergenic
1020307435 7:6845653-6845675 AAGAGAATGAAGGTCAGGCCCGG - Intergenic
1020739745 7:11999512-11999534 GAGAGACAGAAGGACAGAGGTGG + Intergenic
1021407120 7:20284746-20284768 GGGAGAAAGAAAGAAAGGGGTGG - Intergenic
1021452896 7:20798428-20798450 GAGAGGAGGAGGGACAGGGAGGG - Intergenic
1021630940 7:22646820-22646842 GAGAGGATGAAGTGCAGTGGTGG + Intergenic
1021829209 7:24586803-24586825 GAGAGCCTGAAAGACAGTGGTGG + Intronic
1021963384 7:25894469-25894491 GAGAGAATGAAGGACTGTGCAGG - Intergenic
1022118909 7:27287769-27287791 GAATGAATAAAGGCCAGGGGTGG + Intergenic
1022334783 7:29411986-29412008 GTGGGAATGAAGGACAGCAGAGG - Intronic
1022508517 7:30921402-30921424 GAGAGAAGGAGAGACAGGGAGGG + Intronic
1022835722 7:34112202-34112224 TAGACAATGAAGGCCAGGCGCGG + Intronic
1022843647 7:34189513-34189535 GAGAGAGAGAAGGAAAGGGTCGG - Intergenic
1023863175 7:44227307-44227329 GAGAGTATGGGGGACAGAGGGGG + Intronic
1024004560 7:45215996-45216018 GAGAGAAAGAAGGGGAGGGAGGG + Intergenic
1024055771 7:45659093-45659115 GGGAGAAGGAGGGACAGGGAGGG - Intronic
1024241303 7:47438607-47438629 GAGTGAATCAAGGATCGGGGAGG + Intronic
1024263671 7:47590299-47590321 GAGAGAAAGAAGAAGAGGGAAGG - Intergenic
1024319614 7:48051683-48051705 GAGAGAAAGAAAGAAAGGGAAGG - Intronic
1024343729 7:48292112-48292134 ATGAGCATGAAGGTCAGGGGAGG - Intronic
1024494592 7:50030228-50030250 GAGAGAGGGAAGGACAGGGAAGG + Intronic
1024555602 7:50600583-50600605 GAGGGAAGGAAGGAGAGAGGGGG + Intronic
1024700968 7:51903853-51903875 GAGAGAATGAAGTCCAGAGATGG - Intergenic
1024785070 7:52898158-52898180 GAGAGAAAGGAGGAGAGGGAGGG + Intergenic
1024885698 7:54139631-54139653 GAGAGCAAGAAAGAGAGGGGAGG - Intergenic
1024945617 7:54804887-54804909 GTGAGTATGTAGGGCAGGGGTGG + Intergenic
1026260887 7:68754311-68754333 GAGAGAAAGAAGGAAAGGAAAGG + Intergenic
1026267879 7:68811110-68811132 GAGAGACTGAAGGATAGAGATGG + Intergenic
1026436782 7:70406202-70406224 GACAGAAGGAAGGAAGGGGGTGG - Intronic
1026448717 7:70508283-70508305 GAGAGAAGGAAAGAAAGGGAGGG + Intronic
1026585292 7:71651183-71651205 GAGGGAATGCAGGAGAGGAGAGG + Intronic
1026593634 7:71716284-71716306 GGGAGAATGCAGGACAGGACAGG + Intergenic
1026939663 7:74280073-74280095 GAGAGAAAGAGAGAAAGGGGGGG - Intergenic
1027239454 7:76317905-76317927 GAGAAACTGAAGGGCAGGCGTGG + Intergenic
1027529539 7:79313446-79313468 GAGAGAGAGAGGGAGAGGGGAGG - Intronic
1028468881 7:91183498-91183520 GAGAGAATAAAGAAAAGGGCGGG - Intronic
1028753479 7:94409102-94409124 GAGAGACAGAAGGAGAGGGAAGG + Intronic
1029078560 7:97954592-97954614 AAGAGAATGAAGGTCAGGCCCGG - Intergenic
1029139484 7:98400380-98400402 GGGAGAAGAAGGGACAGGGGAGG + Intronic
1029141669 7:98415165-98415187 GAAGGAATGAAGGAGAGGGAGGG + Intergenic
1029187259 7:98748154-98748176 GAAAGAAGGAAGGAGAGGGAGGG + Intergenic
1029350722 7:100011182-100011204 GAGGGAAAGAAGGAAAGGGGAGG - Intergenic
1029363864 7:100105172-100105194 GAGAGGAGCAAGGAGAGGGGAGG - Intronic
1029392204 7:100282632-100282654 GAGAGAAAGAAAGAAAGGGGAGG - Intergenic
1029539905 7:101176571-101176593 GGCAGAAGGAAGGAAAGGGGCGG - Intronic
1029567826 7:101350650-101350672 GTGAGAAGGAAGGACACAGGTGG + Intergenic
1029574980 7:101397507-101397529 GAGAGAAGGAAGGGAAGGGAAGG - Intronic
1030275498 7:107717065-107717087 GAGTGAATGTAGGCCAGGCGCGG + Exonic
1030384292 7:108848730-108848752 GAGAGAAAGGAGGAGAGGGGAGG - Intergenic
1030943668 7:115688688-115688710 CAGAGAATGAAGGAAAGTGCAGG + Intergenic
1031008968 7:116503873-116503895 GAGAGAAAGAAAGAGAGGGAGGG + Intronic
1031019449 7:116611505-116611527 GTGACAAGGAAGGACAGAGGAGG + Intergenic
1031105788 7:117541064-117541086 GAGAGCATGATGAACAGGAGAGG - Intronic
1031650955 7:124289266-124289288 GAGAGGAGGAATGACATGGGAGG + Intergenic
1031690881 7:124786261-124786283 GAGAGAATGAGTGCCAGGAGGGG - Intronic
1031840264 7:126729149-126729171 GAGAAAATGAAGCAAAGGGAGGG - Intronic
1031914280 7:127547594-127547616 AACAGAATGAAGAAAAGGGGAGG - Intergenic
1032013430 7:128361068-128361090 GAGAGAGAGAGAGACAGGGGAGG - Intronic
1032041484 7:128566396-128566418 AAGAGGATGTAGGCCAGGGGCGG - Intergenic
1032172901 7:129600562-129600584 GGAAGAAGGAAGGACAGGAGAGG - Intergenic
1032521724 7:132550650-132550672 GAGGGAGGGGAGGACAGGGGAGG - Intronic
1033006627 7:137571870-137571892 GAGAGGAAGAAGGACAAGAGAGG + Intronic
1033277641 7:139984638-139984660 GAGAGAAAGAAAGAAAGGGAAGG + Intronic
1033390439 7:140923475-140923497 GAGAGAAGCAAGGACTGGAGAGG + Intronic
1033466443 7:141594568-141594590 GAGAGAATTTAGAACAGAGGTGG - Intronic
1033995290 7:147338189-147338211 GAGAGAATGAATGCCAGCAGGGG + Intronic
1034353066 7:150429767-150429789 GAGAGAAAGAGGGAGAGGTGGGG - Intergenic
1034385127 7:150734628-150734650 GGGAGAATGAGGGAAAGAGGAGG - Intronic
1034535017 7:151721005-151721027 AGGAGAATGAAGAACAGAGGGGG + Intronic
1034900510 7:154905512-154905534 GAGAGAGAGAAAGACTGGGGTGG - Intergenic
1035048532 7:155984619-155984641 GAGAAAATAAAGCACAGAGGGGG - Intergenic
1035141318 7:156765360-156765382 GAGAGAATGAGTGCCAGCGGGGG - Intronic
1035569518 8:662860-662882 AAGAGAAGGGAGGGCAGGGGCGG + Intronic
1035700132 8:1632075-1632097 GGGAGAAAGAGAGACAGGGGAGG + Intronic
1035762999 8:2083667-2083689 GGGAGAGGGAAGCACAGGGGTGG - Intronic
1036190708 8:6667744-6667766 GAGAGAAGGAAGGAAAGGAAAGG + Intergenic
1036589706 8:10157770-10157792 GAGAGAAAGAAGAAGAGGGCGGG - Intronic
1036817003 8:11909726-11909748 GAGAGAATGAATGTCAGGTCCGG - Intergenic
1037094071 8:14962067-14962089 GACAGAAAGAAGGACAGGAAGGG + Intronic
1037754186 8:21700735-21700757 GGAAGAAGGAAGGACAGAGGAGG + Intronic
1037916190 8:22774913-22774935 GAGAGACTGGAGGGCACGGGAGG - Intronic
1038069431 8:23997249-23997271 GAAAGAATGAAGGACAATGTAGG - Intergenic
1038379252 8:27076952-27076974 GAGAGAAGGAAGAACAAGGATGG + Intergenic
1038398534 8:27265475-27265497 GTGAGAAAGAAGGAAAGGGAGGG - Intergenic
1038472604 8:27837941-27837963 GAGGGAAGGAAGGAAAGGCGCGG + Exonic
1038798729 8:30730940-30730962 GAGAGAATGAACGTCAGGCCCGG + Intergenic
1039427557 8:37498629-37498651 GAGAGAATGAGTGCCAGCGGGGG - Intergenic
1039606738 8:38886697-38886719 GAAAGTATTAAGGCCAGGGGCGG + Intergenic
1039609775 8:38910364-38910386 GAGGGAGAGAAGGACAGGGAGGG + Intronic
1039741442 8:40386660-40386682 CAGAGAATAAAGGACAAGGAGGG - Intergenic
1039781679 8:40792625-40792647 GAAGGAAGGAAGGAAAGGGGAGG + Intronic
1040002080 8:42585856-42585878 GAGAGAGAGAAAGACGGGGGGGG - Intergenic
1040629742 8:49196739-49196761 GAGAGAATGATAGAGAGGGAAGG - Intergenic
1042269006 8:66937109-66937131 GAGAGAAAGAGGGAGAGGAGAGG - Intergenic
1042392507 8:68252076-68252098 GAGAGAAAGAAAGAAAGGGAGGG - Intergenic
1042397796 8:68311805-68311827 GAGAGAAGGAAGAAGAGGAGGGG - Intronic
1042734199 8:71969374-71969396 GAGAGACTGGTGGACAGTGGTGG + Intronic
1042788879 8:72581248-72581270 GACAGAAAGAAGGACAGAGAAGG - Intronic
1043363283 8:79500165-79500187 CAGAGAATGAAGAAAAGCGGGGG - Intergenic
1044297817 8:90548704-90548726 GAGAGGATGGAGGAGAGGTGGGG + Intergenic
1044327918 8:90881579-90881601 CAGAGGAGGAAGGAGAGGGGCGG - Intronic
1044398091 8:91737424-91737446 GAGATATTTAAGGACAGGGATGG - Intergenic
1045006750 8:97922762-97922784 GAGAGAGAGAAGGACAGTGAGGG - Intronic
1045006948 8:97924568-97924590 GGGAGAATGAAGGACGGGACAGG - Intronic
1045149846 8:99392225-99392247 GAGAGTATGAGAGAAAGGGGAGG - Intronic
1045496376 8:102712765-102712787 GAAAGAAGGAAGGAGAGGTGGGG + Intergenic
1045550210 8:103164642-103164664 TAGAGAAGGAAGGAAAGGGCAGG - Intronic
1045734017 8:105274451-105274473 GGGAAAATGAAAGACAGGAGGGG - Intronic
1045861660 8:106820514-106820536 GAGAAAAGGAAGGGAAGGGGAGG - Intergenic
1045862337 8:106827466-106827488 GAGAGAAGGAATGCCAGGGTGGG - Intergenic
1045950709 8:107848908-107848930 GAGGGAAGGAAGGAAAGGGAGGG + Intergenic
1046457105 8:114480914-114480936 TAGAGAATGCAGGAAAGGGAAGG - Intergenic
1046564202 8:115877901-115877923 GAGAGAGTGGGGGAAAGGGGAGG + Intergenic
1046814959 8:118572993-118573015 GAGAGAATGAATGCCAGAAGGGG - Intronic
1046886121 8:119369007-119369029 TAGAGAATAAATGTCAGGGGTGG - Intergenic
1047346123 8:124030632-124030654 GAGAGAAGGTAGGATAGGGATGG - Intronic
1047393714 8:124474992-124475014 GAGAGGAAGGAGGGCAGGGGCGG + Exonic
1047620597 8:126602597-126602619 GAAAGAATGAAAGAAAGGGAGGG + Intergenic
1047869819 8:129070508-129070530 GAGAGAATGAATGCCAGCAGGGG - Intergenic
1048054049 8:130846811-130846833 GAGGGAAGGAAGGAAAGGGAGGG - Intronic
1048277037 8:133074479-133074501 GAGAAAATGAAGGTCTGGAGAGG + Intronic
1048383880 8:133893123-133893145 GAGAGAAGGAAGGAAAGGAAAGG + Intergenic
1048431489 8:134375679-134375701 GAGGGAAGGAAGGGGAGGGGAGG - Intergenic
1048512831 8:135078101-135078123 GAGAGAAAGAAAGAAAGGAGAGG - Intergenic
1048541620 8:135347115-135347137 GAGGGGAGGAAGGAGAGGGGAGG + Intergenic
1048754837 8:137727264-137727286 GAGGGAAGGAAGGAGAGGGAAGG + Intergenic
1048910614 8:139131296-139131318 GACAGCATGAAGGACAGGCTGGG - Intergenic
1049091330 8:140516439-140516461 GAGATAATGAAGGCCAGGCATGG - Exonic
1049447860 8:142639690-142639712 GAGAAAAGGGAGGACAGGGCGGG + Intergenic
1049511154 8:143027213-143027235 GAGAGCAGGGAGGACAAGGGCGG + Intergenic
1049885768 9:25202-25224 GAGTGAATGAGGGAAAGGGCAGG + Intergenic
1049925993 9:407642-407664 GAGAGAAGGAAAGAAGGGGGTGG - Intronic
1050452845 9:5802125-5802147 GAGAGAAAGATGGACAGCGAGGG + Intronic
1050544797 9:6700755-6700777 GAGGGAATGAATGGAAGGGGAGG + Intergenic
1050698759 9:8312094-8312116 AAGAGAATCTAGGACAGGAGGGG - Intergenic
1050844636 9:10199433-10199455 GACAGAATAAAGAACAGAGGTGG - Intronic
1050971536 9:11882836-11882858 GAGAGAGGGCAGGGCAGGGGAGG - Intergenic
1050985488 9:12076706-12076728 GAGAGAAGGAGGGGGAGGGGAGG - Intergenic
1051725498 9:20084512-20084534 GAAAGAAAAAAGGAGAGGGGTGG - Intergenic
1052726683 9:32236540-32236562 GAGAGAGTGAAGGAAAGGATAGG + Intergenic
1052972625 9:34386262-34386284 AAGAAAATGAAGGACAGTGCTGG + Intronic
1053023018 9:34708823-34708845 GGGAGGCTGAAGGACAGGGTAGG - Intergenic
1053135601 9:35648737-35648759 GAGAGAGTGAAGGCCAGGCACGG + Intergenic
1053663322 9:40299675-40299697 GACAGAAGGAAGGCCAGGGAAGG + Intronic
1053663845 9:40303581-40303603 GACAGAATGATGGACAGTGATGG + Intronic
1053664788 9:40309773-40309795 GACAGAAGGAAGGCCAGGGAAGG + Intronic
1053913827 9:42930206-42930228 GACAGAAGGAAGGCCAGGGAAGG + Intergenic
1053914390 9:42934839-42934861 GACAGAATGATGGACAGTGATGG + Intergenic
1054375441 9:64445899-64445921 GACAGAAGGAAGGCCAGGGAAGG + Intergenic
1054375971 9:64449815-64449837 GACAGAATGATGGACAGTGATGG + Intergenic
1054519827 9:66066511-66066533 GACAGAAGGAAGGCCAGGGAAGG - Intergenic
1054520768 9:66072704-66072726 GACAGAATGATGGACAGTGATGG - Intergenic
1054521293 9:66076610-66076632 GACAGAAGGAAGGCCAGGGAAGG - Intergenic
1054836957 9:69685662-69685684 AAGAGAGAGAATGACAGGGGAGG - Intergenic
1055218071 9:73891835-73891857 GAGCCAATGAAGGACAGTGAAGG - Intergenic
1055431779 9:76251271-76251293 GAAAGAAAGAAGGCCAGGCGCGG + Intronic
1055440056 9:76328491-76328513 GAGAGAATGAGTGAGAAGGGGGG - Intronic
1056129521 9:83570093-83570115 GAGTGAATGAAGGTAAGCGGAGG - Intergenic
1056381711 9:86062467-86062489 GAGGGAAGGGAGGACGGGGGAGG + Intronic
1056531384 9:87491383-87491405 GAGAGAAAGTAGGACTAGGGAGG + Intergenic
1056942987 9:90971230-90971252 TAAAGAATGAAGGCCAGGTGTGG + Intergenic
1057226505 9:93296024-93296046 GAGGGGATGATGGAGAGGGGAGG - Intronic
1057527953 9:95819129-95819151 GAGAGAAAGAAGGACATGCCAGG + Intergenic
1058053836 9:100430441-100430463 GAGAGAATGAGGGGCTGGTGGGG + Intronic
1058932248 9:109732724-109732746 GAGAAAAAGAAAGTCAGGGGAGG + Intronic
1059432325 9:114257669-114257691 GAAAGAGAGAAGGAGAGGGGAGG - Intronic
1059525781 9:114989816-114989838 CAGAGACAGAAAGACAGGGGAGG - Intergenic
1059642674 9:116232953-116232975 GAGAAAATGACTGTCAGGGGTGG - Intronic
1059877576 9:118652639-118652661 GAGAGAAGGAAGAAGAAGGGAGG + Intergenic
1059883247 9:118715586-118715608 GAGAGAGAGAAAGAGAGGGGGGG - Intergenic
1059910907 9:119043133-119043155 GAGAGAATGAAGGATTGGGAAGG - Intergenic
1059992756 9:119880777-119880799 GAGAGAGGAAAGGACAGGGAAGG - Intergenic
1060184403 9:121555174-121555196 GAAAGAAAGAAGGAAAGGGCCGG - Intergenic
1060190670 9:121590294-121590316 GATAGTATGAATGACAGGGGAGG - Intronic
1060538434 9:124411716-124411738 CAGAGAATGAAGGTCAGGTCAGG + Intronic
1060984641 9:127813135-127813157 GAGGGAGTAAGGGACAGGGGTGG - Intronic
1061256378 9:129456002-129456024 AGGAGAAGGAAGGGCAGGGGAGG - Intergenic
1061432958 9:130542949-130542971 GAGAGAGAGCAGGGCAGGGGAGG + Intergenic
1061450331 9:130664042-130664064 GAGAGAAGGAAAAACAGGAGGGG + Intergenic
1061634861 9:131901085-131901107 GAGAGAATGAGGGAGGGAGGGGG + Intronic
1061996612 9:134189356-134189378 GAGAGACAGAAGGAGAGTGGAGG + Intergenic
1062362637 9:136194836-136194858 GAGGGAAGGGAGGAGAGGGGAGG - Intergenic
1062452999 9:136623345-136623367 GAGAGAAGGAAGGAGAAAGGAGG - Intergenic
1062550875 9:137086044-137086066 GAGAGAATGAAGGAGGGGCCGGG + Intergenic
1062589682 9:137267938-137267960 CAGAGAATGGAGCAAAGGGGAGG + Intronic
1203446616 Un_GL000219v1:63141-63163 GAGGGAAGGAAGGAGAGGGAAGG - Intergenic
1185490926 X:516475-516497 GAGAGGAAGAAAGAGAGGGGAGG - Intergenic
1185511503 X:667954-667976 GAGGGGGTGAAGGAGAGGGGAGG - Intergenic
1185545720 X:942296-942318 GAGAGAAAGAAGAAGAGGGGGGG + Intergenic
1185581230 X:1212952-1212974 GAGGGAATGGAGGGGAGGGGAGG - Intergenic
1185623405 X:1466836-1466858 AAGAGAAGGAAGGAGAGAGGAGG - Intronic
1185983172 X:4802390-4802412 AAGAGAATGAAGGCCAGATGTGG + Intergenic
1186309054 X:8297261-8297283 GAGAGAAGGAAGGAAAGGGAAGG - Intergenic
1186392972 X:9179927-9179949 GAGAGAAAGAAGGATAGGGGTGG - Intergenic
1186774248 X:12848124-12848146 GAGAGAAGGAAAGAAAGGGTGGG - Intergenic
1186817046 X:13248483-13248505 GAAAGAATGAAGGACAAAGAAGG - Intergenic
1186933532 X:14421324-14421346 GAGAGAAGGAAGGACAAGCAGGG + Intergenic
1187097713 X:16164998-16165020 GAGAGAAAGAAAGAGAGGGGTGG - Intergenic
1187327864 X:18308323-18308345 GAGGGAGGGAAGGACAGGGAGGG + Intronic
1188059104 X:25578187-25578209 GAGAAAATGGAAAACAGGGGAGG + Intergenic
1188062352 X:25617315-25617337 GAGAGAATGAGTGCCAGTGGGGG + Intergenic
1188982401 X:36738863-36738885 CCCAGAATGAAGTACAGGGGTGG - Intergenic
1189113459 X:38318938-38318960 GAAATAATGAAGGACAGTTGGGG - Exonic
1189121350 X:38398598-38398620 GAGAGAGAGAAGGAGAGGGTGGG - Intronic
1190258819 X:48785544-48785566 GAGAGAATGAGAGACAGAGATGG - Intergenic
1191593758 X:62919109-62919131 GAGAGAATGAGTGACAGGAGGGG - Intergenic
1191874062 X:65776304-65776326 AAAAGAATGAAGCACAGGTGCGG - Intergenic
1192177479 X:68895017-68895039 GAGGGAAGGGAGGGCAGGGGCGG - Intergenic
1192216831 X:69165022-69165044 GGAAGAAGGAAGGAGAGGGGAGG + Intronic
1192451543 X:71248095-71248117 GGGAGAATGGAGGAGAAGGGAGG - Intronic
1193758940 X:85441428-85441450 TGGAGAATGAAGAAAAGGGGGGG - Intergenic
1194411279 X:93561736-93561758 AAGAGGAAGAAGGACAGGGAAGG - Intergenic
1194811061 X:98387761-98387783 GACAGGATGAAGGACAGGATTGG + Intergenic
1194831316 X:98625344-98625366 GAAAGAAGGAAGGAAAGGGAAGG - Intergenic
1194861974 X:99010690-99010712 GAGAGAAAGAGAGACAGGGAGGG + Intergenic
1195611506 X:106872324-106872346 GAAAGAAGGAAGGGGAGGGGAGG + Intronic
1195933655 X:110105093-110105115 GAGTGAAGGAAGGACAGGAAGGG - Intronic
1196190040 X:112784640-112784662 GAGAGAATGAATCACATAGGTGG + Intronic
1197155357 X:123264422-123264444 GGGAAAATGAGGGAAAGGGGAGG + Intronic
1197620322 X:128740744-128740766 GATAGAATGAAGGTCAGTGTAGG - Intergenic
1197816010 X:130499439-130499461 GAGGGAATGTAGGAGAGGGTAGG - Intergenic
1198116501 X:133549785-133549807 GAGAAAAAGAAGGACAGGGAGGG - Intronic
1198116513 X:133549829-133549851 GAGAAAAAGAAGGACAGGGAGGG - Intronic
1198408692 X:136343179-136343201 GAGAGAATGAAGGAGACAGAGGG + Intronic
1198603103 X:138306435-138306457 GAGACAATCATGGAAAGGGGAGG + Intergenic
1199433425 X:147786247-147786269 GAAAGAAAGAAAGAAAGGGGGGG - Intergenic
1199531179 X:148849392-148849414 GAGAGAAGGAGAGAGAGGGGTGG - Intronic
1199594062 X:149492999-149493021 GAGAAAAGGCAGGGCAGGGGTGG + Intronic
1199883503 X:151995727-151995749 GAGAGAAGGAAGGAGAGGTGTGG - Intergenic
1200037402 X:153340984-153341006 GAAAGAATGAATGACAGATGTGG - Intronic
1200097307 X:153670276-153670298 GAGAGGTGGAAGGACAGGGAGGG - Intronic
1200097452 X:153670837-153670859 GAAAGGCTGAAGGTCAGGGGGGG + Intronic
1200108761 X:153728327-153728349 GGGGGACAGAAGGACAGGGGAGG + Intronic
1200232631 X:154451627-154451649 GAGGAAAGGAAGGAGAGGGGAGG - Intergenic
1201241433 Y:11960666-11960688 GTGAGAATGGGGGAGAGGGGCGG - Intergenic
1201256368 Y:12112083-12112105 GAGAGAAAGAAAGAAAGGGGGGG - Intergenic
1201550262 Y:15211161-15211183 GAGAGAGGGAGGGACGGGGGAGG + Intergenic
1201797440 Y:17913610-17913632 GAAAGAAAGAAAGAAAGGGGGGG - Intergenic
1201804113 Y:17992349-17992371 GAAAGAAAGAAAGAAAGGGGGGG + Intergenic
1202300189 Y:23405171-23405193 GAGAAAGTGAAGGAGAGAGGGGG + Intergenic
1202570621 Y:26265427-26265449 GAGAAAGTGAAGGAGAGAGGGGG - Intergenic
1202597338 Y:26554858-26554880 GAGAGAATGAGGGACAGGGATGG + Intergenic