ID: 1105860626

View in Genome Browser
Species Human (GRCh38)
Location 13:24408514-24408536
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 5, 1: 2, 2: 0, 3: 15, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105860624_1105860626 10 Left 1105860624 13:24408481-24408503 CCCATATTAGGTTTAGGAAAATC 0: 1
1: 0
2: 1
3: 25
4: 241
Right 1105860626 13:24408514-24408536 TCCTGCCAGATTGTGTTATGAGG 0: 5
1: 2
2: 0
3: 15
4: 167
1105860625_1105860626 9 Left 1105860625 13:24408482-24408504 CCATATTAGGTTTAGGAAAATCT 0: 2
1: 0
2: 2
3: 15
4: 223
Right 1105860626 13:24408514-24408536 TCCTGCCAGATTGTGTTATGAGG 0: 5
1: 2
2: 0
3: 15
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105860626 Original CRISPR TCCTGCCAGATTGTGTTATG AGG Intergenic
905490038 1:38336248-38336270 TCCTGCCAAAGGGTGTCATGGGG + Intergenic
906157666 1:43623279-43623301 TCTTGCCACATTGGTTTATGAGG - Exonic
907788935 1:57642417-57642439 TGGTGCCAGAATGTGTAATGAGG - Intronic
908611125 1:65862525-65862547 TTCTGCCAGGTTTTGTTATCAGG + Intronic
913663430 1:121025573-121025595 CCCTGCCAGATTTTGGTATCAGG - Intergenic
913969484 1:143403728-143403750 TCCTGCAAAATTGTGCTAAGAGG - Intergenic
914014821 1:143808841-143808863 CCCTGCCAGATTTTGGTATCAGG - Intergenic
914063861 1:144229327-144229349 TCCTGCAAAATTGTGCTAAGAGG - Intergenic
914115289 1:144737027-144737049 TCCTGCAAAATTGTGCTAAGAGG + Intergenic
914163000 1:145152366-145152388 CCCTGCCAGATTTTGGTATCAGG + Intergenic
914653442 1:149717398-149717420 CCCTGCCAGATTTTGGTATCAGG - Intergenic
915610265 1:156986294-156986316 TCCTACCAGATTGGGTTACAGGG - Intronic
917101760 1:171453648-171453670 TTCTGCCAGATTTTGGTATCAGG - Intergenic
917844046 1:179005615-179005637 TCCTGCCAGGTTATGTTAGTTGG + Intergenic
918331876 1:183469253-183469275 TCCTACCAGATTTTGTTTTTGGG - Intergenic
919511967 1:198476244-198476266 TCCTGCCAGGTTTTGGTATTAGG + Intergenic
921784386 1:219211174-219211196 TCCTTCCACATTGTGTGAAGAGG + Intronic
923332997 1:232942981-232943003 TCCTGCCATTATTTGTTATGAGG + Intergenic
923345619 1:233049152-233049174 TTCTGCCAGATTTTGGTATCAGG - Intronic
1064936554 10:20684929-20684951 TCCTGCCAGTTTTGGTTTTGTGG - Intergenic
1065793896 10:29288937-29288959 TCCTGCATGCTTGTGTTCTGAGG - Intergenic
1066245226 10:33576495-33576517 TACTGCCAAATTGTTTTATAAGG - Intergenic
1067457331 10:46428565-46428587 TCCTACCAGATGGTCTTCTGGGG - Intergenic
1067629871 10:47956073-47956095 TCCTACCAGATGGTCTTCTGGGG + Intergenic
1068145394 10:53062991-53063013 TTCTGTCAGATTGTGTATTGAGG - Intergenic
1068775126 10:60860778-60860800 TAATGCATGATTGTGTTATGAGG - Intergenic
1068781387 10:60922457-60922479 TCCTTCCAGTTTCTGGTATGTGG - Intronic
1069286690 10:66723463-66723485 TCCTTCCTAATTGTGTTTTGTGG - Intronic
1069333769 10:67324716-67324738 TCTTGCCAGATTTTGGTATCAGG + Intronic
1071052567 10:81469184-81469206 CTCTGCCAGATTTTGTTATCAGG + Intergenic
1071354525 10:84780578-84780600 TCTTGCCAGATTTTGGTATCAGG + Intergenic
1074976297 10:118584520-118584542 TGCTTCCAGATTGTGATAAGAGG - Intergenic
1075287698 10:121201567-121201589 GCCTGGCAGATTATGTTAAGGGG - Intergenic
1076028416 10:127137006-127137028 TCTTGCCAGAATGTATTATTTGG + Exonic
1079005707 11:16789940-16789962 TCCTGCAAGAATGTGTGATGAGG - Intronic
1086986563 11:93256802-93256824 TCCTGCCTGATTATGTAATGTGG + Intergenic
1088444902 11:109915756-109915778 ACCTTCTATATTGTGTTATGAGG + Intergenic
1093192300 12:16089005-16089027 ACCTGCCAGATTGATTTATGAGG + Intergenic
1093361268 12:18231910-18231932 TCCTGCCTGGTTTTGTTATCAGG + Intronic
1094081026 12:26536216-26536238 TCTTGACAGATTGAGTTATTTGG - Intronic
1100516866 12:95336544-95336566 TGCAGCCAGATGGTGTTCTGAGG - Intergenic
1102800770 12:115731540-115731562 TCCTCCCAGATAGTGTGATGTGG - Intergenic
1105334299 13:19450846-19450868 TCCTGCCAGATTGTGTTATGAGG - Intronic
1105860626 13:24408514-24408536 TCCTGCCAGATTGTGTTATGAGG + Intergenic
1106100820 13:26694252-26694274 TCCTGCCACACTGGGTTTTGGGG + Intergenic
1106651235 13:31692325-31692347 TCCTGCCAGGTTTTGGTATCAGG - Intergenic
1107207815 13:37816544-37816566 TTCTGCCAGATTTTGGTATCAGG - Intronic
1107317012 13:39143701-39143723 TTCTGCCAGATTTTGGTATCAGG - Intergenic
1107488451 13:40855438-40855460 TCCTGCCAGATTGGGTTATGAGG - Intergenic
1107531232 13:41284002-41284024 TCTTACCTGATTGTGTTATGGGG - Intergenic
1107920902 13:45206101-45206123 TCCTGCCATATTTTGGTATAAGG + Intronic
1108628677 13:52258210-52258232 TCCTGCCAGATTGTGTTATGAGG - Intergenic
1108657380 13:52548240-52548262 TCCTGCCAGATTGTGTTATGAGG + Intergenic
1110010617 13:70328433-70328455 TCCTGCCAGGTTTTGGTATTAGG + Intergenic
1110997601 13:82132980-82133002 TTCTGCCAGATTTTGGTATTAGG + Intergenic
1111307142 13:86429339-86429361 CTCTGCCAGATTTTGGTATGAGG + Intergenic
1113131328 13:107040533-107040555 CTCTGCCAGATTTTGTTATCAGG + Intergenic
1114576366 14:23717834-23717856 TCCAGCCATGTTGGGTTATGTGG - Intergenic
1115017051 14:28630165-28630187 TCCTGCCAGATTTTGGTATCAGG + Intergenic
1115290504 14:31766878-31766900 TCCTCCCAGATTATTTTATGTGG + Intronic
1117790670 14:59337884-59337906 TCCTGTCATCTTGTGTTATAAGG - Intronic
1118865030 14:69696095-69696117 ACCTGCCAGGTTCTGTTTTGTGG - Intronic
1123571311 15:21612806-21612828 TTCTGCCAGATTTTGGTATTAGG + Intergenic
1123607425 15:22048158-22048180 TTCTGCCAGATTTTGGTATTAGG + Intergenic
1124805482 15:32877649-32877671 TGCTGGAAGATTGTATTATGTGG - Intronic
1131815869 15:96220607-96220629 TCTTGCCAGATTTTGACATGTGG + Intergenic
1202979664 15_KI270727v1_random:339932-339954 TTCTGCCAGATTTTGGTATTAGG + Intergenic
1133572658 16:7056792-7056814 GACTGCCAGATTCTGTTCTGTGG + Intronic
1138073844 16:54021051-54021073 ACATGCTACATTGTGTTATGTGG - Intronic
1138311946 16:56032893-56032915 TTCTGTGAGATTCTGTTATGAGG - Intergenic
1140632322 16:76868176-76868198 TGCTGCCAGAGTGTGTGACGTGG - Intergenic
1141060676 16:80865815-80865837 TTCTGCCAGATTTTGGTATCAGG - Intergenic
1144649836 17:17000431-17000453 TCCTCCCATATTGTTGTATGTGG - Intergenic
1147518851 17:41149107-41149129 CCCTGCCAGTTTGTCTCATGTGG - Exonic
1148967734 17:51450650-51450672 TTCTGCCAGATTTTGGTATCAGG - Intergenic
1149160133 17:53683313-53683335 TTCTGCCAAATTTTGTTATTAGG + Intergenic
1149185301 17:53990555-53990577 TCATACCTGATTGTATTATGGGG - Intergenic
1153442611 18:5137395-5137417 GCCTTCCAGAGTGTGTTATCTGG + Intergenic
1154325676 18:13389036-13389058 TCCTCCCAGGTTGTGGTGTGCGG + Intronic
1160361114 18:78280094-78280116 TTCTGCCAGATTTTGGTATCAGG + Intergenic
1163457028 19:17413123-17413145 TGCTTCCTGATTGTGTTAAGTGG - Intronic
1167029939 19:46951633-46951655 ACCTGCCAGGTACTGTTATGAGG - Intronic
1168535617 19:57166794-57166816 TCCAGCCTGACTGTGTTATGGGG + Intronic
928900384 2:36311498-36311520 TTCTGCCAGATTTTGGTATCAGG - Intergenic
934174175 2:89564631-89564653 TCCTGCAAAATTGTGCTAAGAGG - Intergenic
934284491 2:91638980-91639002 TCCTGCAAAATTGTGCTAAGAGG - Intergenic
934892145 2:98080041-98080063 TCCTGCCAGCTTGAGTGAGGAGG + Intergenic
937563180 2:123250074-123250096 TTCTGCCAGATTTTGGTATCAGG - Intergenic
939657248 2:144842423-144842445 TCCTGCCATATTGTGTCATTGGG - Intergenic
940054219 2:149496744-149496766 TTCTGCCAGATTTTGGTATCAGG + Intergenic
940104625 2:150084365-150084387 TGCTGTCTGATTTTGTTATGTGG + Intergenic
940860337 2:158764591-158764613 TCCTATCAGATTGTTTAATGTGG + Intergenic
942054464 2:172169331-172169353 TTGTGCCAGAGTGTGTTCTGTGG + Intergenic
943373863 2:187051124-187051146 TACTGCCAGATTTTGGTATCAGG + Intergenic
944157322 2:196621064-196621086 TTCTACCATATTGTGTTTTGTGG - Intergenic
944461957 2:199958533-199958555 TCCTCCCAGATTGGGTTAGAAGG + Intronic
947464425 2:230328735-230328757 TCCTGCCAAATTGTCTTTTTAGG + Exonic
1174059586 20:47823243-47823265 TTCTGCCAGCTTGGGTGATGAGG + Intergenic
1174523304 20:51150740-51150762 TCCTGTCAGATGTTGTTATCGGG - Intergenic
1176738763 21:10577817-10577839 TCTTGCCAGATTGTGTTATGAGG + Intronic
1179118212 21:38515587-38515609 TCTTGTCTGATTTTGTTATGAGG - Intronic
1185057854 22:48590326-48590348 GCCTGCAAGATGGTTTTATGCGG + Intronic
956384209 3:68699897-68699919 TCCAGCCAGATTCTGTTTGGAGG + Intergenic
956731100 3:72197511-72197533 CCCTCCCAAATTATGTTATGTGG + Intergenic
957201401 3:77140689-77140711 TCCTCCCAGAATATGATATGAGG + Intronic
958108610 3:89109843-89109865 TCCTTCCAGATTGTGTCCTATGG + Intronic
959694821 3:109238014-109238036 TTCTGCCAGATTTTGGTATCAGG - Intergenic
962180742 3:133203771-133203793 CCCTGCCAGATTTTGGTATCAGG + Intronic
964561541 3:158002165-158002187 CCCTGCCAGATTTTGGTATTAGG + Intergenic
965652160 3:170946087-170946109 TCTTGCCTGATTTTGGTATGAGG + Intergenic
966637578 3:182153172-182153194 CTCTGCCAGGTTTTGTTATGAGG + Intergenic
969828031 4:9773577-9773599 TCCTGCAAAATTGTGCTAAGAGG - Intronic
969886997 4:10223719-10223741 ACCTACCAGATTGTGATATTAGG - Intergenic
970184520 4:13435886-13435908 TCTTGCCACATTTTGTTATCAGG - Intronic
970424410 4:15933117-15933139 TCCTACCAGATGGAGTTGTGGGG + Intergenic
971858144 4:32069959-32069981 TTCTGCCAGATTTTGGTATCAGG + Intergenic
971879810 4:32356878-32356900 TCCTTCCAAATGTTGTTATGGGG + Intergenic
972558636 4:40205628-40205650 TCCTCCCAGACTGTGGTATCAGG + Intronic
972680520 4:41302172-41302194 TCCTGCCAGATTTTGGTATCAGG + Intergenic
972834275 4:42850241-42850263 TTCTGCCAGATTTTGGTATCAGG + Intergenic
973556986 4:52093297-52093319 TCCTCCCAGATTTGGTCATGAGG + Intronic
973651409 4:53000537-53000559 TCCAGCCAGATTGTGTACAGAGG + Intronic
974130191 4:57745216-57745238 TTCTGCCAGATTTTGGTATCAGG + Intergenic
974716834 4:65678809-65678831 GCCTCCCAGCTTGTGATATGAGG - Intergenic
978205728 4:106078804-106078826 CTCTGCCAGATTTTGGTATGAGG - Intronic
979732497 4:124042115-124042137 TCCTGCCAGGTTTTGGTATCAGG + Intergenic
981583075 4:146270551-146270573 TCCTGACAGATTGAGTTAACAGG + Intronic
987648977 5:20715879-20715901 CTCTGCCAGATTGTGGTATCAGG + Intergenic
988161852 5:27528457-27528479 TTCTGCCAGATTTTGTTATCAGG + Intergenic
988165707 5:27587130-27587152 TTCTGCCAGATTTTGGTATTAGG + Intergenic
988521511 5:31949588-31949610 TCCACCCAGATTGTGTTCTTCGG + Intronic
988746590 5:34145649-34145671 CTCTGCCAGATTGTGGTATCAGG - Intergenic
990584230 5:57194729-57194751 TACTGCCACATTCTCTTATGTGG - Intronic
991091348 5:62696613-62696635 CCCAGCCAGATTGTTTTATGTGG + Intergenic
992331768 5:75724212-75724234 TCATGCTAGATTGTTTTATCAGG - Intergenic
993301271 5:86213911-86213933 TTCTGCCAGGTTTTGTTATCAGG - Intergenic
993347416 5:86801719-86801741 TTCTGTCTGATGGTGTTATGAGG - Intergenic
995695136 5:114870411-114870433 TTCTGCCAGATTTTGGTATCAGG - Intergenic
995696092 5:114879895-114879917 TTCTGCCAGATTTTGCTATCAGG - Intergenic
995697516 5:114896859-114896881 TCCTGCCAGTTTATGTTTTCTGG + Intergenic
996144511 5:119957483-119957505 TACTGCCTCATTGTGTTTTGAGG + Intergenic
998347718 5:141478716-141478738 GCCTGCCAGAGTGTGGTTTGTGG + Intronic
998407386 5:141881886-141881908 TCCTGGGAGATTGTGCTGTGGGG - Intergenic
998704669 5:144744981-144745003 TTCTGCCAGATTTTGCTATTTGG + Intergenic
999331385 5:150675877-150675899 TCCTGCCAAATTGTCTTCTGCGG + Intronic
999488336 5:152023142-152023164 TTCTGCCAGATTTTGGTATCAGG + Intergenic
1004859383 6:19786071-19786093 TCCACCCAGATGTTGTTATGTGG - Intergenic
1005178288 6:23073196-23073218 TCCTGCCAGGTTTTGGTATCAGG + Intergenic
1005544735 6:26853897-26853919 CTCTGCCAGATTGTGGTATCAGG - Intergenic
1009015526 6:57895530-57895552 CTCTGCCAGATTGTGGTATCAGG - Intergenic
1009783645 6:68302113-68302135 GCCTGCCAGGTTTTGTTATAAGG + Intergenic
1011201364 6:84840124-84840146 TTCTGCCAGATTTTGGTATCAGG + Intergenic
1013431341 6:110057979-110058001 TCCAGCTAGATTGTTTTTTGAGG - Intergenic
1018486564 6:164246439-164246461 TCCTGCTCCATTGTGTTATATGG + Intergenic
1020384892 7:7590187-7590209 TGCTACCATATTGTGATATGAGG - Intronic
1020728015 7:11841631-11841653 TCTAGTCAGATTGTGTGATGTGG + Intergenic
1021916661 7:25440569-25440591 TCCTGCCAGGTTTTGGTATCAGG + Intergenic
1023317897 7:38959306-38959328 GTCTGCCAGATTTTGTTATCAGG - Intergenic
1025235319 7:57230749-57230771 TTCTGCCAGCTTGGGTGATGAGG - Intergenic
1026015928 7:66670497-66670519 TCCAGCCAGTGTGTGTTATTTGG - Intronic
1028892027 7:95999115-95999137 CACTGCCAGAGTGTGTTATGGGG - Intronic
1030473188 7:109993982-109994004 CTCTGCCAGATTTTGGTATGAGG + Intergenic
1033082513 7:138311561-138311583 TTTTACCTGATTGTGTTATGGGG - Intergenic
1033846574 7:145440149-145440171 TCCTGCAAGGGGGTGTTATGAGG + Intergenic
1038218531 8:25585522-25585544 TCCTGACAGATTGGATAATGTGG - Intergenic
1040483238 8:47845847-47845869 TCCTGCCAGATTTTGGTATCAGG - Intronic
1042829692 8:73012901-73012923 TACTGCCAGCCTGTGTTAGGAGG - Intronic
1049214113 8:141399790-141399812 ACCTGCCAGGTTGTGTTCTTGGG + Intronic
1052032362 9:23643334-23643356 TGCTGAGAGTTTGTGTTATGAGG - Intergenic
1056141161 9:83681382-83681404 TCCTACTAGATTGAGTTCTGAGG - Intronic
1056887888 9:90461098-90461120 TCTAACCAGATTGTGTCATGAGG - Intergenic
1057899889 9:98940412-98940434 TCCTGCCAGACAGTGTTTTTAGG - Intergenic
1060234232 9:121851376-121851398 TCATGCAAGATGGTGTTATAAGG + Intronic
1060360849 9:122955724-122955746 TCCTGCCAGATGTTTATATGTGG + Intronic
1189998430 X:46661614-46661636 CCCGGCCACATGGTGTTATGTGG - Intronic
1192397034 X:70792861-70792883 TCCTGCCAGATTTAGGTATCAGG - Intronic
1193081784 X:77413292-77413314 ACCTGCCAGATAGTCTTATTGGG + Intergenic
1193228107 X:79009888-79009910 TCTTGCCAGGTTTTGTTATCAGG + Intergenic
1193611932 X:83643105-83643127 TCCTGCTTGATTATGTTGTGTGG + Intergenic
1193625673 X:83817713-83817735 CTCTGCCAGGTTGTGTTATCAGG + Intergenic
1194357497 X:92903734-92903756 TTCTGCCAGATTTTGGTATCAGG - Intergenic
1194864604 X:99050294-99050316 TTCTGCCAGATTTTGCTATCTGG + Intergenic
1195802165 X:108724972-108724994 CCCTGCCAGATTTTGGTAGGAGG - Intronic
1197406779 X:126063648-126063670 TTCTGCCAGATTTTGCTATCAGG - Intergenic
1197512162 X:127383064-127383086 TCATGCCAGCTTTTGTTATCAGG + Intergenic
1199671263 X:150150384-150150406 TCCTGCAGGCTTGTTTTATGAGG + Intergenic
1200665674 Y:6019343-6019365 TTCTGCCAGATTTTGGTATCAGG - Intergenic
1200801395 Y:7390315-7390337 TCCTGCCAGGCTGTCTCATGTGG + Intergenic
1202597500 Y:26557345-26557367 TCCTGCCAGATTGTGTTATGAGG + Intergenic