ID: 1105864948

View in Genome Browser
Species Human (GRCh38)
Location 13:24451185-24451207
Sequence GAGCCCTGACCTGGGAGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 1, 1: 2, 2: 6, 3: 51, 4: 449}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105864941_1105864948 -4 Left 1105864941 13:24451166-24451188 CCTCTGCCCTGTGGTGTCTGAGC 0: 1
1: 0
2: 2
3: 42
4: 385
Right 1105864948 13:24451185-24451207 GAGCCCTGACCTGGGAGCAGGGG 0: 1
1: 2
2: 6
3: 51
4: 449
1105864942_1105864948 -10 Left 1105864942 13:24451172-24451194 CCCTGTGGTGTCTGAGCCCTGAC 0: 1
1: 0
2: 1
3: 20
4: 176
Right 1105864948 13:24451185-24451207 GAGCCCTGACCTGGGAGCAGGGG 0: 1
1: 2
2: 6
3: 51
4: 449
1105864936_1105864948 30 Left 1105864936 13:24451132-24451154 CCCTCACTGAGGAAGGCATGAAT 0: 1
1: 0
2: 0
3: 12
4: 199
Right 1105864948 13:24451185-24451207 GAGCCCTGACCTGGGAGCAGGGG 0: 1
1: 2
2: 6
3: 51
4: 449
1105864937_1105864948 29 Left 1105864937 13:24451133-24451155 CCTCACTGAGGAAGGCATGAATA 0: 1
1: 0
2: 1
3: 13
4: 167
Right 1105864948 13:24451185-24451207 GAGCCCTGACCTGGGAGCAGGGG 0: 1
1: 2
2: 6
3: 51
4: 449
1105864940_1105864948 2 Left 1105864940 13:24451160-24451182 CCAGTACCTCTGCCCTGTGGTGT 0: 1
1: 0
2: 0
3: 17
4: 171
Right 1105864948 13:24451185-24451207 GAGCCCTGACCTGGGAGCAGGGG 0: 1
1: 2
2: 6
3: 51
4: 449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105864948 Original CRISPR GAGCCCTGACCTGGGAGCAG GGG Intronic
900192659 1:1358075-1358097 CAGCCCAGGCCTGGGAGCGGGGG + Intronic
900288604 1:1914342-1914364 GGGCCCTGGCCTGGGTGCTGCGG + Intergenic
900776091 1:4586486-4586508 GGGACCTGGCCTGGGAACAGAGG + Intergenic
900862273 1:5242136-5242158 GAGTCCTGAGCAGGGAGGAGGGG + Intergenic
900906857 1:5565332-5565354 GAACCCAGAGCTGGGGGCAGTGG - Intergenic
900962567 1:5934608-5934630 AAGCCCGGGACTGGGAGCAGTGG - Intronic
901440646 1:9275992-9276014 GAGTCCTGACCTGGGGGCCCTGG - Intergenic
901663785 1:10815117-10815139 GGGCCCTGGCCTTGGAGCTGTGG + Intergenic
901803034 1:11720233-11720255 GAGCACTGACCTGGGACCCTGGG - Exonic
901884722 1:12214969-12214991 GAGAGGTAACCTGGGAGCAGAGG + Intergenic
902394605 1:16125790-16125812 GAGGCCTGAGCTGGGGGCACTGG - Intronic
902684165 1:18064989-18065011 GAAGGCTGACCTGGGAGCAGAGG + Intergenic
902854514 1:19191180-19191202 TAGCCCTGGGCTGGGCGCAGTGG + Intronic
903653688 1:24935986-24936008 GAGCTCTGCGCTGAGAGCAGCGG - Intronic
903681718 1:25101980-25102002 GAGCCCAGAGCTGGGAGTATGGG - Intergenic
904044504 1:27601933-27601955 GAGCTCTGCCCAGGGAGCTGGGG + Intronic
904424062 1:30412359-30412381 GAGCCAAGACCTGTGAGGAGAGG + Intergenic
904497191 1:30893575-30893597 GGGCCCTGAGCAGGGAGGAGGGG - Intronic
905416274 1:37806868-37806890 GAGAACTGGCCTGGGAGCTGAGG + Exonic
905434360 1:37946657-37946679 GAGCCATGTCCTAGGAGCAAAGG - Intronic
907331199 1:53672803-53672825 CAGCCCTGAGCTGGGTGCTGTGG - Intronic
907333251 1:53684904-53684926 CAGCCCTGAGCTGGAAACAGAGG + Intronic
907630874 1:56080604-56080626 GAGCCCTGGCTGGGGATCAGTGG + Intergenic
908009770 1:59764269-59764291 GAGCCCTGGCCTGGGATCCTAGG + Intronic
909285520 1:73811798-73811820 GGGGCCTGTCCAGGGAGCAGCGG + Intergenic
910810942 1:91235730-91235752 GAGACGTGACCATGGAGCAGAGG - Intergenic
912062294 1:105687539-105687561 GATCCCGGACCTGGGAACAGGGG - Intergenic
916262797 1:162859494-162859516 AATTGCTGACCTGGGAGCAGAGG - Exonic
916665437 1:166962656-166962678 GAGGTCTGCCCTGGGAGTAGGGG + Intronic
916666273 1:166970575-166970597 GAGCCCTGACCTGGGAGCTGAGG - Intronic
916808162 1:168280408-168280430 GAGCCCTGACCCTTGAGCAGTGG + Intergenic
917146613 1:171899197-171899219 GAGCCATCACATGGCAGCAGCGG - Intronic
918184296 1:182113600-182113622 TAGCCCTGGGCTGGGCGCAGTGG - Intergenic
919753731 1:201053824-201053846 AAGCCCACACTTGGGAGCAGTGG + Intronic
920056958 1:203199734-203199756 GGGCCCCGACTTGGGAGCAGGGG - Intergenic
920122949 1:203672546-203672568 CCGCCCTGGCCTCGGAGCAGTGG + Intronic
922122891 1:222691138-222691160 GAGCCATGACCTAGGATGAGAGG + Intronic
922422759 1:225470743-225470765 GAGGCCTGTCCTGAGAGCACAGG - Intergenic
922455280 1:225769226-225769248 GCGCCCTGAGCTGGGAACTGTGG - Intergenic
922456739 1:225779429-225779451 GAGCCCTGGGCTGGGCGCAGTGG - Intronic
1064645211 10:17453760-17453782 GGGACCTGGCCTGGGAGCCGGGG - Intronic
1064694226 10:17949633-17949655 GAACCCTGGGCTGGGTGCAGTGG + Intergenic
1067054357 10:43042406-43042428 GCTCCCTGTCCTGGGAGGAGAGG + Intergenic
1067546659 10:47196817-47196839 GAGCCCTTGCCGGGGAGCGGAGG - Intergenic
1067689260 10:48490832-48490854 TTGCCCTCACCTGAGAGCAGAGG - Intronic
1069588850 10:69629946-69629968 GCGCCCTGGCCTGGGAGGAAGGG - Intergenic
1071530858 10:86389659-86389681 ACGCCCAGACCTGGGAGCACAGG - Intergenic
1072536825 10:96370471-96370493 GAGCCCTGACCTGGGAGCCAGGG - Intronic
1073072052 10:100800739-100800761 GGGCCCTGACCTGGGGTGAGAGG + Intronic
1074419937 10:113299798-113299820 GAGACCTCACCTGCCAGCAGGGG - Intergenic
1074831790 10:117254663-117254685 GAGCCCTGAGCTGGGGGTGGAGG + Intronic
1075060307 10:119252459-119252481 GAACCCTGAGCTGGGTGCAGAGG + Intronic
1075875291 10:125800855-125800877 AAGCCCTCAGCTGGGCGCAGTGG - Intronic
1076353871 10:129838434-129838456 GAGCCCAGACCTGGAAGCAGAGG - Intronic
1076821686 10:132942791-132942813 GAGCCCTGAGCGGGGAGAGGAGG - Intronic
1076821748 10:132943138-132943160 GAGCTAAGACCTGGCAGCAGGGG + Intergenic
1076858104 10:133127350-133127372 GAACCGGGAGCTGGGAGCAGCGG + Intronic
1076899029 10:133328068-133328090 GAGCCCTGAACTGAGAGGGGAGG + Intronic
1077412759 11:2411116-2411138 GAGCCCCGACCTGGGACCTGGGG - Intronic
1077486994 11:2843541-2843563 GACCCCCACCCTGGGAGCAGCGG + Intronic
1078541872 11:12219347-12219369 GAGCCCTGAGCTGCGAGGACTGG - Intronic
1080387262 11:31817526-31817548 CGGCCCTGAGCTGGGAGTAGGGG - Intronic
1082162632 11:48901121-48901143 GAGCCCTGAGCTGGCAGGGGCGG - Intergenic
1083234194 11:61341517-61341539 GAGTGCTGGCCTGGGAGCTGGGG + Intronic
1083404334 11:62446287-62446309 GAGCCCTGAGCTGGGAAGAGAGG - Intronic
1083725772 11:64627248-64627270 GAGCCCTGACCAGGGTGAGGAGG - Intronic
1084204776 11:67585025-67585047 GAGCCCCAGCCTGGGAGGAGGGG - Intronic
1084646778 11:70463574-70463596 GATCCCTGGCCTGGGAGCCGGGG + Intergenic
1084676895 11:70640605-70640627 GAGCCCTGACCTGGGATCACAGG + Intronic
1084710437 11:70840672-70840694 GAGCCCTGCCCTGATAGCTGAGG - Intronic
1084938059 11:72597671-72597693 GAGGCCTGGCCTGGGAACACAGG + Intronic
1084982365 11:72836843-72836865 GAGCCCTGACCTGTGCACTGTGG + Intronic
1085385681 11:76156980-76157002 GACCCCAGACCTGTGGGCAGAGG + Intergenic
1085758693 11:79223472-79223494 TAGCACTGACCTCTGAGCAGAGG - Intronic
1088710119 11:112499993-112500015 CAGCCCTGACCTGGCTGCATGGG - Intergenic
1088810506 11:113388456-113388478 CAGCCCTGCCCTGAGAGCTGGGG - Intronic
1089294377 11:117459081-117459103 GAGACGTGGCCTGGGGGCAGTGG - Intronic
1089312809 11:117571208-117571230 TATCCCTGGCCTGGGAGCAGAGG + Intronic
1089372876 11:117973754-117973776 GAGGCCTCTCCTGGGACCAGTGG + Intergenic
1089785208 11:120902709-120902731 GGGCCCTGGCATGAGAGCAGGGG + Intronic
1090094455 11:123729666-123729688 GAGCCCAGATCTGGGGGCACCGG - Exonic
1090136059 11:124200518-124200540 AAGACCTGGCCTGGGCGCAGTGG + Intergenic
1090357550 11:126150096-126150118 GGGCCCTGAGCTGGGAGGAGAGG + Intergenic
1090410269 11:126503329-126503351 GTACCCTGGCCTGGGAGCAGAGG + Intronic
1090643680 11:128750161-128750183 GAGCCCTGCACTGGGAGCGGCGG + Intronic
1090964643 11:131587714-131587736 GAGTCCTGGACTGGGTGCAGTGG - Intronic
1091209535 11:133844472-133844494 GAGACCTTGCCTGGGAGTAGCGG - Intronic
1091344208 11:134842115-134842137 GAGCCCTGCCCCAGGTGCAGGGG - Intergenic
1091767806 12:3133242-3133264 GAGCCCTGAAGTGGGAGGAGAGG - Intronic
1091878793 12:3959979-3960001 GTGACCTGGCCTGGGGGCAGAGG + Intergenic
1091898464 12:4123515-4123537 GAGCCCTGACCTGGAGGAAGAGG + Intergenic
1092109616 12:5949776-5949798 GAGCCCTTACCTGGCAGTAGTGG + Exonic
1094808150 12:34110114-34110136 GAGCACCAACCTGGGAGAAGTGG - Intergenic
1095422504 12:42039997-42040019 AAGTCCTAACCTGGGAGCAGAGG + Intergenic
1096107130 12:49002885-49002907 AAGCCCTGAGCTGGGGGAAGGGG - Exonic
1096718097 12:53503014-53503036 GGGCCCTGACCTGAGAGAGGGGG - Exonic
1097293762 12:57941893-57941915 GAGCCATGACCTGGAGGCTGTGG + Intronic
1098126856 12:67305600-67305622 GAGGCCTGTTCTGGGAGAAGGGG + Exonic
1098318245 12:69214635-69214657 GATTCCTGCCCTGGTAGCAGAGG + Intergenic
1099104358 12:78481030-78481052 GAGGCCTTACCCGGGAGCACAGG + Intergenic
1100438619 12:94594707-94594729 GAGGCCAAGCCTGGGAGCAGAGG + Intronic
1101434681 12:104654636-104654658 GAGCACTGGGCTGGGGGCAGGGG - Intronic
1101892560 12:108730718-108730740 GAGCCCGGCCAAGGGAGCAGAGG - Intronic
1102014536 12:109639065-109639087 CAGCACTGAGCTGGGAGCAGGGG - Intergenic
1102021044 12:109683180-109683202 GAACCCTGTTCTGGGGGCAGGGG + Intergenic
1102932957 12:116876546-116876568 GAATCCTGCCTTGGGAGCAGGGG - Intronic
1103083371 12:118042968-118042990 GAGCCCTGGCATGGGAGCAGGGG + Exonic
1103480503 12:121247329-121247351 CAGGCCTGTGCTGGGAGCAGGGG - Intronic
1104058156 12:125245905-125245927 GAGGCCTGACCTGGCAGCTCGGG - Intronic
1104724143 12:131065867-131065889 GGGCCCTAACCTGGGAGATGGGG - Intronic
1104967318 12:132514116-132514138 GAGCCCTGACGCGAGAACAGAGG - Intronic
1105747556 13:23392057-23392079 GAGCCCGGAGCTGGGAGCTGAGG + Intronic
1105864948 13:24451185-24451207 GAGCCCTGACCTGGGAGCAGGGG + Intronic
1106088485 13:26563960-26563982 GCCCTCTGACCTTGGAGCAGTGG + Intronic
1107305535 13:39014290-39014312 GAGACCTGCCCTGGGAACACAGG + Exonic
1108522799 13:51260304-51260326 GAGCCCTCCCCTGGGAGAAGCGG - Intronic
1108756890 13:53513871-53513893 AAGCCCTGACGGGGTAGCAGAGG - Intergenic
1110794320 13:79619496-79619518 GAGCCCTGACTGGGAAGTAGCGG - Intergenic
1112271794 13:97976177-97976199 GAGGCCTGGCCGGGGAGGAGGGG - Intronic
1112334939 13:98506984-98507006 GCGTGCTGACCTGTGAGCAGAGG + Intronic
1113485167 13:110647612-110647634 GAGCCCCGCCCTGGGGTCAGAGG + Intronic
1113885328 13:113655881-113655903 GAGCCCTGAGCTGTGATGAGAGG + Intronic
1116056639 14:39872355-39872377 CAGCCCTGAAGTGGCAGCAGAGG + Intergenic
1117043291 14:51787407-51787429 GAGACCTTAGCTGGGAGAAGGGG + Intergenic
1117880273 14:60306430-60306452 GAGCCCTGAGCTGCCAGGAGAGG - Intergenic
1117972485 14:61265805-61265827 GAGCCCCCAGCTGGGTGCAGTGG + Intronic
1118257882 14:64220947-64220969 GAGACCTGGCCTTGAAGCAGAGG + Intronic
1118324557 14:64772428-64772450 GAGCTCAGGGCTGGGAGCAGTGG - Intronic
1119259098 14:73226847-73226869 GATCCCTGAACTGGGAGCAAGGG - Intergenic
1119608631 14:76043015-76043037 GAGCCCTGGGCTGGGATGAGAGG + Intronic
1119776792 14:77254002-77254024 GAGCCCTGGCCTTGGGGCACAGG - Intronic
1119904936 14:78293200-78293222 GAGTCTTAACCTGGGAGGAGTGG - Intronic
1121279756 14:92689999-92690021 GAGGCCTCAGCTGGGTGCAGTGG - Intergenic
1121617257 14:95320920-95320942 AAGCACTGAGCTGGGAGCAGGGG - Intergenic
1121698331 14:95931314-95931336 GAGCACTGGCCTGGGAGCACAGG - Intergenic
1122206549 14:100150610-100150632 CAGCCCTGACCTTGGAGAATGGG + Intronic
1122274821 14:100586163-100586185 GAGCCTGGCCCTGGGAGTAGTGG + Intronic
1122338043 14:101006744-101006766 AAGCCCTGAGCTGGGCGCGGTGG + Intergenic
1122342515 14:101037607-101037629 CAGCCCCGACCTGGGGGAAGTGG + Intergenic
1122416455 14:101551960-101551982 GAGCACTCACATGGGAGCAGAGG - Intergenic
1122624942 14:103079811-103079833 GAGGCCTGACCTGGGCACTGTGG - Intergenic
1122625816 14:103084903-103084925 AGGGCCGGACCTGGGAGCAGTGG + Intergenic
1122770885 14:104097170-104097192 GAGCCCAGTGCTGGCAGCAGGGG - Intronic
1122792672 14:104190927-104190949 GATTCCTGCCCTGGGGGCAGAGG + Intergenic
1122826842 14:104374689-104374711 GAGCCCTGGCCCAGGAGGAGAGG + Intergenic
1122921453 14:104882062-104882084 GCGCCCTGACCTGAGGGCACTGG + Intronic
1123174238 14:106401719-106401741 GAGCCTTGACCTCAAAGCAGCGG - Intergenic
1123182450 14:106482654-106482676 GAGCCTTGACCTCAAAGCAGCGG - Intergenic
1202944452 14_KI270726v1_random:14075-14097 GAGCCTTGACCTCAAAGCAGCGG + Intergenic
1125098722 15:35885293-35885315 AAGCCCTTACCTGGGAGGAGTGG - Intergenic
1125523079 15:40358699-40358721 GAGTCCTGGCCTGAGAGGAGGGG - Intronic
1125903285 15:43368968-43368990 AAGCCCAGACCTGGGACCACAGG - Exonic
1127725334 15:61744072-61744094 AAGCCCTGAAGTGGGAGCTGGGG + Intergenic
1127806486 15:62525809-62525831 GAGGCCTGAGCTAGAAGCAGGGG - Intronic
1127983618 15:64051706-64051728 GAGCCCAGACATGGGAGGGGTGG + Intronic
1128078675 15:64843394-64843416 GAGCCCAGCCCTTGCAGCAGGGG - Intronic
1128254741 15:66188455-66188477 GATCCCTGATCTGTGAGCAAAGG - Intronic
1129196767 15:73973169-73973191 GAGCTCTGACCTAGGAGCCGAGG + Intergenic
1129207158 15:74044155-74044177 GAGCTCTGGGGTGGGAGCAGGGG - Intronic
1129391887 15:75224847-75224869 GAGCATGGACGTGGGAGCAGGGG + Intergenic
1129472488 15:75763315-75763337 GAGCATGGACGTGGGAGCAGGGG - Intergenic
1129591146 15:76916239-76916261 GAGCCTAGACCTGGGAGCTTTGG + Intergenic
1129732672 15:77940942-77940964 GAGCATGGACGTGGGAGCAGGGG - Intergenic
1130048096 15:80461582-80461604 GAGGTCAGTCCTGGGAGCAGAGG + Intronic
1130696476 15:86136616-86136638 GAGCCCAGACTTGAGAGCAGAGG + Intergenic
1131177900 15:90221301-90221323 GGGCCCTGAGCAGGGAGAAGGGG + Intronic
1132931088 16:2459599-2459621 AAGCTCAGACCTTGGAGCAGTGG - Intergenic
1133106630 16:3514713-3514735 GAGTCCTCACATGGCAGCAGGGG + Intronic
1133293072 16:4735342-4735364 GCACTCTGAACTGGGAGCAGCGG - Intronic
1133997975 16:10762317-10762339 GATCACTGGCCTGCGAGCAGGGG + Intronic
1134475687 16:14571513-14571535 GAGCCTTGACCAGAAAGCAGAGG - Intronic
1134846712 16:17446834-17446856 GGGCCCTGAGAAGGGAGCAGCGG - Intronic
1135572148 16:23557582-23557604 GGGGCCGGACCTGGGAGCGGAGG + Exonic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1136236475 16:28916903-28916925 GAACCAGGACCTGGGTGCAGAGG + Intronic
1136473780 16:30499222-30499244 GAGCTCTGACCTTGGAACTGGGG - Exonic
1137037084 16:35576582-35576604 CAACCCTGAGCTGGGAGCACTGG - Intergenic
1138491509 16:57379835-57379857 GAGCCCAGGTCTGGGAGCGGAGG - Intronic
1138508717 16:57494800-57494822 GAGTCCTGGACTGGGCGCAGTGG + Intergenic
1138548549 16:57734814-57734836 GAGCCCTGACCTGCGGTGAGAGG + Intergenic
1139637064 16:68264323-68264345 GAGCCCTGACGAGGCAGCTGGGG + Intergenic
1140028173 16:71311099-71311121 GAGCCCTGATCCAGGAGCACTGG + Intergenic
1141258192 16:82423676-82423698 GAGCTCTGACTGGGGAGCTGTGG - Intergenic
1141664918 16:85461091-85461113 AAGCCCTGAGCTGGGCGCAGTGG + Intergenic
1141932876 16:87217380-87217402 GAGCCCTGAATTGGGGTCAGGGG - Intronic
1141993070 16:87621364-87621386 CAGCCCAGACCTGGGATCCGCGG + Intronic
1142317308 16:89355995-89356017 GAGCCCCGCCCTGGGGGCTGAGG + Intronic
1142706439 17:1697920-1697942 GTGCCCTGACCTGGGATCTGAGG + Intergenic
1143582256 17:7834264-7834286 CAGCCCCGGCCTGGGAGAAGGGG + Intergenic
1144052448 17:11508594-11508616 GAGAAATGACCTGGGAGCACTGG - Intronic
1144185275 17:12790300-12790322 CAGCCCTGAACTCGGCGCAGGGG - Intronic
1144766579 17:17736281-17736303 CAGGTCTGACCTGGGGGCAGGGG - Intronic
1144948473 17:18981742-18981764 GAGGGCGGCCCTGGGAGCAGAGG - Intronic
1145904071 17:28506860-28506882 GAGCCCAGCTCTGGGAGCTGGGG + Intronic
1146708139 17:35017119-35017141 GAGCACAGACCAGGGAGCTGTGG - Intronic
1147470166 17:40651105-40651127 GAGCACTCACGTGGGACCAGTGG + Intergenic
1147627437 17:41909213-41909235 GAGCTATGTCCAGGGAGCAGGGG - Intronic
1147778431 17:42920850-42920872 CAGACCTGAGCTGGGTGCAGTGG - Intergenic
1148196848 17:45720204-45720226 GAGCTCAGCCCTGGGAACAGTGG + Intergenic
1148456803 17:47815534-47815556 GAGCCCTGGCCTGGGAGTGAGGG + Intronic
1148561069 17:48606481-48606503 GAGGCCAGGCCTGGGAGTAGAGG - Intergenic
1148611804 17:48969626-48969648 GAACCCAGACCTGGAGGCAGAGG + Intergenic
1150426189 17:65078868-65078890 AGGCCCTGAGCTGGGAGCTGGGG + Intergenic
1150811869 17:68363170-68363192 CAACCATGACCTGGGAGCAAAGG + Intronic
1151518267 17:74611364-74611386 GAGCTCAGGCCTGGGGGCAGAGG + Exonic
1151723924 17:75874021-75874043 GAGCCCTGGCCTGGGAGAAGGGG - Intergenic
1151835342 17:76579204-76579226 GAGCACAGAGCTGGGCGCAGTGG - Intronic
1151965727 17:77430233-77430255 GAGCCGTGACCTGTCAGTAGGGG + Intronic
1152326721 17:79645782-79645804 GAGCCCTCACCTGACAGAAGAGG + Intergenic
1152685056 17:81689863-81689885 GAGCCCTGGCCAGAGAGCAGAGG + Intronic
1152839605 17:82558613-82558635 GAGCCCTCTCCTGGGAGGACCGG + Intronic
1152911360 17:83006722-83006744 GAAGCCTGTCCTGGGAGCCGAGG - Intronic
1152926292 17:83089230-83089252 GAGCCAAGAACAGGGAGCAGTGG - Intronic
1153018526 18:606179-606201 GGACCCTGACCTAGGAGCATGGG - Intronic
1153942029 18:9986728-9986750 GTGCCATGAGCTGGGAGGAGCGG + Intergenic
1154088788 18:11336753-11336775 GAGCTCTGACCTTGGTGTAGGGG - Intergenic
1155006009 18:21729775-21729797 GAGGCTTGAGCTGGGTGCAGTGG - Intronic
1156214080 18:34978002-34978024 GAGCCGTAACCTCGGAGAAGGGG + Intronic
1156901360 18:42303844-42303866 GAGCCCTGGGCTGGGATCAAGGG - Intergenic
1157198396 18:45638877-45638899 GAGCACTGGCCTGGGAGTAGAGG - Intronic
1157625314 18:49045813-49045835 GAGCACACACCGGGGAGCAGAGG + Intronic
1157862509 18:51153841-51153863 CAGCCCTGGCCTGGGGGCATGGG - Intergenic
1158045015 18:53145398-53145420 GAGCCCTGGGCTGGGTGCGGTGG - Intronic
1158625037 18:59063552-59063574 AAGCCCTGACAGAGGAGCAGTGG + Intergenic
1159036686 18:63284844-63284866 TAGGCCTGACCTGGGCCCAGCGG - Intronic
1159579987 18:70224613-70224635 AAGCCCAGACCTCGGAGAAGGGG + Intergenic
1160075752 18:75674903-75674925 TAGCCCTAAGCTGGGAGCTGGGG + Intergenic
1160205203 18:76825896-76825918 CAGCCCTCAGCTGGAAGCAGTGG - Intronic
1160488882 18:79320256-79320278 GAGCCCGGACCTGGGAGTGTTGG + Intronic
1160575870 18:79853560-79853582 GATCGCTGAGCTGGGAACAGAGG + Intergenic
1160961805 19:1725506-1725528 AAGCCCTGGCCTGGGTGCTGGGG + Intergenic
1161171763 19:2815659-2815681 GAGCCCTGAGTGGGGAGCATGGG - Exonic
1161195509 19:2984056-2984078 AAGCCCGGAACTGGAAGCAGCGG - Intronic
1161464804 19:4422940-4422962 GGGCCCTGACGTGGGAGCGGTGG + Intronic
1161487715 19:4544525-4544547 GAGTCCTGGCCGGGGAGCACAGG + Exonic
1162212109 19:9100519-9100541 GAGCCCTGGGCTGGGCACAGTGG - Intergenic
1162575298 19:11495647-11495669 GAGCCCTGGCTTGGCAGCTGGGG - Intronic
1162770503 19:12946262-12946284 GAGCGCTGACATTGGAGCCGGGG - Intronic
1163015139 19:14450319-14450341 GAGTCCTGACCTGGGGGCTGTGG + Exonic
1163144744 19:15372952-15372974 GAGCCATGGACTGGGAGAAGAGG + Exonic
1163426497 19:17243674-17243696 CAGCCCTGACCCGGGACCTGGGG + Intronic
1163722348 19:18904356-18904378 GTGCCCAGGCCTGGGAGCTGAGG + Intronic
1163821623 19:19499482-19499504 CAGCACAGACTTGGGAGCAGCGG + Intronic
1163862302 19:19748705-19748727 GGGCCCAGGCCTGGGAGCACCGG - Intergenic
1163889718 19:20000092-20000114 GAGGCCTGACATGGGAGAGGAGG + Intronic
1164452449 19:28378469-28378491 GCGCCCTGGCCTGGGAGCTCAGG - Intergenic
1164563465 19:29309823-29309845 GAGCCCTGGGATGGGAGCAGGGG - Intergenic
1164679830 19:30126706-30126728 GGACCCTGACCTGGCATCAGGGG + Intergenic
1164698613 19:30265603-30265625 GAGCCCTGAGCAGGGACCACAGG - Intronic
1165064498 19:33221086-33221108 GAGCCCTGGGCTTTGAGCAGAGG - Intronic
1165118229 19:33542052-33542074 GAGCCCTGGCCTGGCCTCAGGGG - Intergenic
1165489332 19:36114307-36114329 GGGCCCTGAGCTGGGGGCGGGGG - Intronic
1165645380 19:37431518-37431540 GAGCCCTGAACAGTCAGCAGTGG + Intronic
1165996259 19:39846189-39846211 GGGCCTTGGCCTGGGGGCAGGGG - Intronic
1166072598 19:40395681-40395703 GGGCCCTGAGGTGGCAGCAGGGG - Exonic
1166341021 19:42136947-42136969 AAGCCCTGTGCTGGGAGCTGAGG + Intronic
1166364589 19:42272156-42272178 GAGCACGGAGCTGGCAGCAGTGG + Intronic
1167153617 19:47724700-47724722 AAGCCCTGTCCTGGGAGCCTGGG - Intronic
1167873501 19:52392586-52392608 AAGCCCTGGGCTGGGTGCAGTGG - Intergenic
925288656 2:2731748-2731770 GTGCCATGACCTGTGAGCTGAGG - Intergenic
925842999 2:8009772-8009794 GAGCACAGAACTGGGGGCAGAGG - Intergenic
926048513 2:9727891-9727913 GAGCCCTGAGCTGGACGCAGTGG - Intergenic
927151504 2:20198901-20198923 GAGGCCTGGCCATGGAGCAGAGG - Intergenic
927848013 2:26481207-26481229 GGGGCCTGAGCTGGAAGCAGTGG + Intronic
927885784 2:26717719-26717741 GGGCCCTGACCTGGGGCCGGTGG - Intronic
928378984 2:30802139-30802161 GAGCCCTGGACTGGGAGCTCTGG + Intronic
928862214 2:35872764-35872786 CAGGGCTGACCTGGGAGCACAGG - Intergenic
929971292 2:46579561-46579583 AAGCCCTCAGCTGGGTGCAGTGG + Intronic
930030476 2:47055580-47055602 GAGCCGTGACCTGGGATCATGGG - Intronic
931227152 2:60341360-60341382 CAGGCCTGACCGGGGAGCAGTGG + Intergenic
931697395 2:64881604-64881626 AAGCACTGTGCTGGGAGCAGTGG - Intergenic
932793729 2:74677187-74677209 GAGTCCTGGGCTGGGCGCAGTGG - Intronic
933022989 2:77218279-77218301 GAGACCTCAGCTGGGTGCAGTGG - Intronic
933248449 2:80001767-80001789 CAGCACTGTCCTGGTAGCAGTGG - Intronic
933774644 2:85764799-85764821 GAGCCCTGTGCTAGGGGCAGTGG + Intronic
933892582 2:86785476-86785498 GAGCCCTGAGCTGGGAGACAAGG + Exonic
934756486 2:96828086-96828108 CAACCCTGCCCTGGGAGGAGTGG - Exonic
935057622 2:99581350-99581372 GCACCCTCACTTGGGAGCAGTGG - Intronic
935570799 2:104658905-104658927 GGGCCCAGGCCTGGGTGCAGTGG + Intergenic
936053459 2:109242702-109242724 GAGCCCTGGTCTGGGCTCAGAGG + Intronic
936077401 2:109410392-109410414 CAGCCCTGACCTCGGTGCGGAGG + Intronic
936164196 2:110105657-110105679 GAGAACTGACAGGGGAGCAGAGG + Intronic
936515238 2:113177158-113177180 GAGCACTGCCCTTGGAGCACTGG + Intronic
936896543 2:117434224-117434246 CAGCCCTGACCTGGGACCTCTGG + Intergenic
937246857 2:120499250-120499272 GTGCCCTGAGCTAGGAGCACTGG - Intergenic
937299341 2:120829700-120829722 GGGCCCGGGCCTGGGAGAAGGGG + Intronic
937912642 2:127082875-127082897 CAGCCCTGACGAGAGAGCAGAGG + Intronic
937976400 2:127584586-127584608 GAGGGCTGAGCTGGGAGCAGAGG - Intronic
938086031 2:128402656-128402678 CAGCTCTCAGCTGGGAGCAGTGG - Intergenic
938298446 2:130193319-130193341 CATCACTGACCTGGGCGCAGTGG + Intronic
938580959 2:132646096-132646118 GAGCCCTGGCCTGAGGGCCGAGG + Exonic
943032842 2:182705799-182705821 TAGCCCTCAGCTGGGTGCAGTGG - Intergenic
943508392 2:188792543-188792565 GATCCCTTGGCTGGGAGCAGTGG + Intergenic
943646010 2:190408440-190408462 GAGCCCTGTCCCCGGAGCACGGG - Exonic
944321357 2:198347464-198347486 GAGCTCTGAACTAGGAGTAGAGG - Intronic
946073758 2:217056511-217056533 GATCCCTGAACTGGGAGAAATGG + Intergenic
947525727 2:230875667-230875689 GAGTCCGGACCTGGGAGGACAGG - Exonic
948387482 2:237590687-237590709 GAGGCCTGACCTTGGCGCTGGGG - Exonic
948722641 2:239911231-239911253 ACACCCTGACCTGGGAGAAGGGG + Intronic
948795990 2:240402315-240402337 GGTCCCTGAGCTGGGGGCAGAGG - Intergenic
948799582 2:240425909-240425931 GAGCCCTTACCTGGAAGGGGAGG - Intergenic
948864711 2:240769377-240769399 GATCCCTGACCATGGTGCAGAGG - Intronic
948987822 2:241536128-241536150 GGGGCCTGACCTGTGACCAGGGG + Intergenic
1169112515 20:3043237-3043259 AAGCCCTGAGCTGGGAGTTGGGG + Intergenic
1169195662 20:3680978-3681000 GAGCCCTATCCTGGGGTCAGGGG - Intronic
1169360779 20:4947067-4947089 GAGCCCAGACCTGGGAACTCTGG - Intronic
1169529148 20:6465502-6465524 AGGCCCTGACATGGGAGCAAGGG - Intergenic
1170776209 20:19376858-19376880 GAGCCGTCACCAGCGAGCAGTGG + Intronic
1172834460 20:37864055-37864077 GAGCCCTCACTTGGGTGGAGAGG + Intronic
1173053417 20:39587787-39587809 GAGCTCTGCCCTGGGAGTTGTGG - Intergenic
1173664795 20:44756067-44756089 CAGCCCTGACCTGGGACCCCAGG - Exonic
1173904184 20:46613812-46613834 GAGGCCTGGGCTGGGGGCAGAGG + Intronic
1174038505 20:47682938-47682960 AAGCCCTGAGCTGGGCCCAGGGG + Intronic
1174174371 20:48635773-48635795 AGGCCCTGAGCTGGGAGCTGGGG - Intronic
1175203405 20:57292888-57292910 GAGCCCAGACCAGTGTGCAGGGG + Intergenic
1175874162 20:62221573-62221595 CAGCCCTGAGGTGGCAGCAGAGG - Intergenic
1175905068 20:62375584-62375606 GACCCCTGACCTGGCTGCCGGGG - Intergenic
1176025695 20:62984417-62984439 GCGCCCTGTCCTGGCAGGAGGGG - Intergenic
1176074582 20:63242745-63242767 AAGCCCTGACATGACAGCAGAGG + Intronic
1176310909 21:5148365-5148387 CAGGCCTGGCCTGGGACCAGCGG + Intronic
1177182411 21:17757869-17757891 GGGCCCTGCACTTGGAGCAGCGG - Intergenic
1178121358 21:29473477-29473499 CAGGACTGTCCTGGGAGCAGTGG + Intronic
1179333662 21:40429607-40429629 CAGCCCTGAGCTGGGAGCCCAGG - Intronic
1179641191 21:42748032-42748054 GATACCAGAGCTGGGAGCAGAGG - Intronic
1179846146 21:44113670-44113692 CAGGCCTGGCCTGGGACCAGCGG - Intronic
1180011108 21:45052140-45052162 CAGGCCTCGCCTGGGAGCAGCGG - Intergenic
1180210996 21:46295501-46295523 GAGCCCAGAGCTGGGGGAAGAGG - Intronic
1180909698 22:19440729-19440751 GAGCCCAGACCTGGGTGAAGAGG - Intronic
1181055461 22:20258674-20258696 GGGCCCTGCCCTGGGAGCCAGGG - Intronic
1181168785 22:20996954-20996976 GAGCCCTGACCTTGGTGAACTGG - Exonic
1181262280 22:21607065-21607087 AAGCCCTGCCCTGGGAGGGGAGG - Intronic
1181582376 22:23835381-23835403 TAGCCCTGCCCTGGCAGCATGGG - Intronic
1181894351 22:26093670-26093692 GAGCACTGATGTGGGAGCTGGGG + Intergenic
1182310095 22:29398231-29398253 GAGGCCTGAACTGGGGTCAGTGG - Intronic
1182627164 22:31655922-31655944 GAGTCCTGGGCTGGGTGCAGTGG - Intronic
1183098555 22:35569341-35569363 GAACCCAGATCTGAGAGCAGGGG - Intergenic
1183510312 22:38230785-38230807 GAGCCAGGACTTGGGAACAGTGG + Intronic
1184094251 22:42308148-42308170 GAGCCCTGGTCTGGTAGCTGGGG + Intronic
1184464625 22:44661410-44661432 CAGCCCTGGGCTGGGAGCAGAGG + Intergenic
1184837515 22:47032650-47032672 GGGCCCTGCCCTGGCAGCATTGG + Intronic
1184895657 22:47405183-47405205 GACCACTGCCCAGGGAGCAGTGG + Intergenic
1184992823 22:48182201-48182223 GAGGCCTGACCTGGGACTTGGGG - Intergenic
1185273901 22:49941703-49941725 GGGCCCGGCCCTGTGAGCAGAGG + Intergenic
1185281594 22:49972161-49972183 GAGCCCTGGCCTGCGGGGAGGGG + Intergenic
949484433 3:4524150-4524172 GGCCCCTCACCTGGGTGCAGGGG - Intronic
950025730 3:9818802-9818824 ATCCCCTGGCCTGGGAGCAGAGG + Exonic
950277803 3:11678341-11678363 GAGCCTTGGGCTGGGTGCAGAGG - Intronic
950426449 3:12927141-12927163 GACCCCTCACCTGGAAGCTGAGG - Intronic
950869035 3:16213020-16213042 GATCCCTCACCTGGGGCCAGGGG + Intronic
952959719 3:38581711-38581733 GAGCCCTGTCTTGGCACCAGCGG + Intronic
954135429 3:48580091-48580113 GAGCCATGGCCTGGGACCTGAGG - Intronic
954317681 3:49810179-49810201 GCGCCCTGGCAAGGGAGCAGTGG + Exonic
954418516 3:50406083-50406105 GATCCCAGACCAGGGGGCAGGGG - Intronic
954713881 3:52517612-52517634 GGGTCCTGACCTTAGAGCAGGGG - Exonic
955721150 3:61882898-61882920 GAGGCCTGAGATGGCAGCAGAGG - Intronic
956175415 3:66468627-66468649 CAGCTCTGGCCTGGGAGCCGTGG + Intronic
957684303 3:83481126-83481148 GAGACCTGAGCTGGGTGCAGTGG + Intergenic
959966126 3:112357326-112357348 GAACACTGGCCTGGGAGGAGAGG + Intronic
960142249 3:114162451-114162473 GGGCCCTGCTCTGGGAGCTGGGG - Intronic
960445734 3:117746596-117746618 GAGCCCTGACCTGAGACTGGAGG + Intergenic
961592360 3:127990470-127990492 GAGGCCTGCCCTTGGAGCTGGGG - Intergenic
961682393 3:128608021-128608043 CAGCCCTGGCCTGGGAGCTCCGG - Intergenic
961798610 3:129427552-129427574 GAGCCCTGACCTGTGTGCCTGGG + Intronic
962149513 3:132878170-132878192 GTGCCCTGGGCTGGGAGCAGGGG + Intergenic
962901728 3:139767486-139767508 AAGCCCTGAGCTTGGAGCTGGGG - Intergenic
963148953 3:142023882-142023904 CAGCCCTGACCTGGGCTCAAGGG + Intronic
965747619 3:171941779-171941801 GAATCCTGAGGTGGGAGCAGGGG + Intergenic
967428857 3:189358611-189358633 GATCCCCGACCTGGTAGCTGTGG + Intergenic
968187045 3:196639973-196639995 GAGCCCTGAGCTGCGGGCCGCGG - Intronic
968594096 4:1473472-1473494 CAGCCCTGACCCAGGAGCACAGG + Intergenic
968876443 4:3270235-3270257 GAGCCGTGCCCAGGGAGCCGGGG + Intronic
969301650 4:6300590-6300612 GAGGCGTGAGATGGGAGCAGTGG + Intronic
969870266 4:10100229-10100251 GAGCCAGGCCTTGGGAGCAGGGG + Intronic
972224512 4:36996849-36996871 GAGCCCTGACATGATACCAGAGG - Intergenic
972320101 4:37965498-37965520 GACCCTTGATCTTGGAGCAGGGG + Intronic
975545670 4:75557748-75557770 GAGCGATGAACTGGAAGCAGGGG - Intronic
975592270 4:76011768-76011790 CAGGCCTGAGCTGGGCGCAGCGG - Intronic
977456677 4:97270495-97270517 GAGCCTTGGGCTGGGAGTAGAGG - Intronic
978360948 4:107931106-107931128 GTGCCCTGAGCTGGGAGAATGGG - Intergenic
979564053 4:122134296-122134318 TAGCCCTAAACTGGGAGCAGGGG + Intergenic
979646493 4:123076003-123076025 GCTCCCTGAACTGGGTGCAGTGG + Intronic
984573166 4:181417515-181417537 GACCCCTGACCAGAGAACAGAGG - Intergenic
984921502 4:184768263-184768285 GAGCACTGACTTGGACGCAGGGG - Intronic
984961518 4:185102191-185102213 GACCCCTCACCTGGGAGCTCCGG + Intergenic
985573825 5:664607-664629 GAGGCCTGTCCTGTGTGCAGCGG - Exonic
985874282 5:2583551-2583573 GAGGCCAGACCAGGGAGCAGAGG - Intergenic
986334823 5:6746415-6746437 GCGCCCTTACCTGGCAGCAGGGG - Exonic
986550224 5:8945416-8945438 GAGTCCTGTCCAGGGAGCAAGGG - Intergenic
986592670 5:9387389-9387411 GAGCTGTGATCTGGGAGTAGTGG - Intronic
987288813 5:16488366-16488388 GTTTCCTGGCCTGGGAGCAGGGG + Intronic
988539141 5:32093486-32093508 GGGCACTGACCTTCGAGCAGTGG + Intronic
990002204 5:50907698-50907720 GAGCCTTGACCTTGGTGAAGTGG + Intergenic
990751536 5:59021992-59022014 GAGTCATGCCCTGGTAGCAGAGG - Intronic
990864013 5:60360133-60360155 TATCTGTGACCTGGGAGCAGGGG + Intronic
992432731 5:76725187-76725209 GAGATCTGTCCTGGAAGCAGAGG - Intronic
992947431 5:81823801-81823823 GGGCCCTGCACTCGGAGCAGCGG + Intergenic
996667357 5:126074750-126074772 GAACACTGATCTAGGAGCAGAGG + Intergenic
997361895 5:133300464-133300486 GTGCCCTGAGCATGGAGCAGTGG + Intronic
997580830 5:135015833-135015855 GAGCCCTTAGCTGGGATCAGGGG + Intergenic
998005010 5:138651075-138651097 GAGCCCTGGCCTGGGGAGAGGGG - Intronic
998140897 5:139698830-139698852 AGGCGCTGAGCTGGGAGCAGAGG - Intergenic
998156153 5:139788258-139788280 GAGTCCTGCCCAGGGAGGAGCGG - Intergenic
999314840 5:150576662-150576684 GGGCCCTGGCCTTGGAGCACAGG - Intergenic
1000102028 5:158025493-158025515 GAGCCCTGACCTGAGAGTCTAGG + Intergenic
1000807864 5:165819565-165819587 GAGCCTGGAACTGGGAGGAGAGG - Intergenic
1001296366 5:170502022-170502044 GTGCCCTCATCTGTGAGCAGGGG + Intronic
1001515549 5:172353101-172353123 CAGCCCTGTTCTGGGAGCTGAGG - Intronic
1001594718 5:172890838-172890860 ATGGCCTGACCTGGGAGAAGTGG - Intronic
1002259568 5:177984186-177984208 GAGCCCTCTCCTGGTACCAGAGG + Intergenic
1002888731 6:1316904-1316926 GAGCCCTGCCCTCGGCGCGGGGG - Intergenic
1004560457 6:16744495-16744517 GAGCCCTGTCCTGGGAGCAGTGG - Intronic
1004634544 6:17454195-17454217 GAGCCCTGAGCCGGACGCAGTGG - Intronic
1004722315 6:18277827-18277849 CAGCCCTGACCTCAGAGCCGGGG - Intergenic
1005314210 6:24588588-24588610 GTTACCTGTCCTGGGAGCAGTGG + Exonic
1005699257 6:28383559-28383581 GCGCCCCGGCCTGGGAGCATGGG - Intronic
1006189762 6:32200780-32200802 GAGAGCTGGCCTGGGAACAGAGG + Intronic
1006455782 6:34131007-34131029 TGGCCCTGGCCTGGGAGCTGAGG - Intronic
1006806277 6:36791764-36791786 GAGCCCTGGCATGGGAGCTAGGG + Intronic
1007577986 6:42938484-42938506 GAGCACTGAGCAGGGAGCCGTGG - Intronic
1007819908 6:44553607-44553629 GATTCCTGCCCTGGGAGAAGAGG + Intergenic
1011624581 6:89272691-89272713 GAGCCCTGACCAGGGAACACAGG + Intronic
1011728700 6:90237208-90237230 GAGCACTGGGCTGGGCGCAGTGG - Intronic
1013529083 6:111002618-111002640 GAGACCTGGGCTGGGTGCAGTGG - Intronic
1014246987 6:119079226-119079248 CAGCACTGAACTGGGGGCAGTGG - Intronic
1018655731 6:166033985-166034007 GAGCTGGGACCTGGGGGCAGGGG + Intergenic
1018740699 6:166726435-166726457 GAGCCCAGACCCTGTAGCAGAGG + Intronic
1019011005 6:168843391-168843413 GAGACGGTACCTGGGAGCAGTGG + Intergenic
1019299087 7:294545-294567 GAGCCCTGAGCTAGGAGATGGGG + Intergenic
1019336538 7:485486-485508 GAGCCCCAGCCTGGGAGCTGTGG - Intergenic
1019346263 7:532233-532255 TGGCCCTGACCTGGGAGCTCAGG + Intergenic
1019480684 7:1265341-1265363 GTGCCCAGGGCTGGGAGCAGAGG + Intergenic
1019487602 7:1296477-1296499 CAGGCCTGAGCTGGGAGCCGGGG + Intergenic
1019511331 7:1419073-1419095 GAGCCCTGACCTGGGTGGGTGGG - Intergenic
1019708857 7:2509372-2509394 GAGCCCTGGCCTGGGGGCTGGGG - Intergenic
1019712438 7:2523788-2523810 GGCCCCTGACCTGGGGGCTGGGG + Intronic
1019713085 7:2526208-2526230 GGGCCCAGACCAGTGAGCAGAGG - Intronic
1019782872 7:2954604-2954626 GAGCACTGTGCTGGGAACAGAGG + Intronic
1020128305 7:5545481-5545503 GAGCCCTGGGCTGTGTGCAGGGG + Intronic
1020376788 7:7496333-7496355 GAGCATTGACTAGGGAGCAGGGG + Intronic
1022489333 7:30804808-30804830 TGGCCCTGACCTGGGGGAAGAGG + Intronic
1022637296 7:32148730-32148752 AAGCAATGACCTGGGAGCTGGGG - Intronic
1023019440 7:35997219-35997241 GAGGCCTGACCTGCCAGAAGTGG + Intergenic
1023872491 7:44270295-44270317 CTGCCCTGGCCTGGAAGCAGTGG + Intronic
1027379991 7:77597408-77597430 GACTTCTGAGCTGGGAGCAGTGG - Intronic
1029291214 7:99503863-99503885 TTGCCCGAACCTGGGAGCAGAGG + Intergenic
1031310499 7:120190974-120190996 GAGCCCTGACAAAAGAGCAGAGG - Intergenic
1032096010 7:128938847-128938869 GAGCGGGTACCTGGGAGCAGAGG + Intronic
1032210954 7:129913649-129913671 GAGCCTTTAACTGGGTGCAGTGG + Intronic
1032541377 7:132705811-132705833 GAGCCCAAACCTGGGTGCTGAGG - Intronic
1033011390 7:137626239-137626261 GAGTCCTTATCTGGGAGGAGAGG - Intronic
1033556177 7:142490116-142490138 GGACCTTGACCTGGGAGCACAGG + Intergenic
1033801655 7:144909089-144909111 GAGCCCTGATCTTTGAGCTGTGG + Intergenic
1035553441 8:545843-545865 GAGCCCCAACCTGGGCGCCGCGG - Intergenic
1037615696 8:20517210-20517232 GGGGCCTGTCATGGGAGCAGGGG + Intergenic
1038150881 8:24941892-24941914 GAGCCCTGGCGGGGGAGGAGGGG + Intergenic
1038288249 8:26225667-26225689 GCACCCAGACCTGGGAGCTGAGG - Intergenic
1038631052 8:29244298-29244320 GAGCACTGGGCTGGGCGCAGTGG - Intronic
1040514040 8:48120119-48120141 GAAACCTGAGCTGGGAGCAGTGG - Intergenic
1040740797 8:50571928-50571950 GACCCCTGATGAGGGAGCAGAGG + Intronic
1040918990 8:52595946-52595968 CAGCTCTGACCTTGGACCAGTGG - Intergenic
1042097445 8:65232807-65232829 GGGCCCTGAGCTGGGAGAATAGG + Intergenic
1042689962 8:71486660-71486682 GAGCCAAGACCTGACAGCAGGGG + Intronic
1045063566 8:98427317-98427339 AAGCGCTTACCTGGGAGCACGGG - Exonic
1045675305 8:104600873-104600895 GAACCCTGAGCTGGTAGCTGGGG + Intronic
1047348727 8:124053300-124053322 GAGCCCTGAGCTGGGCACACTGG + Intronic
1047403026 8:124561957-124561979 GAGCGCTGAGCTGTGAGGAGAGG + Intronic
1048010256 8:130449773-130449795 CAGCCCTGACCTTTGGGCAGTGG + Intergenic
1048293108 8:133195565-133195587 GGGCCCTGAGCTGGCAGCAGGGG - Intronic
1048664028 8:136641108-136641130 GAGCCCTAACCTAGGATCATGGG - Intergenic
1048871974 8:138806701-138806723 GAGCCCTGAGCTCACAGCAGCGG + Intronic
1048938801 8:139378760-139378782 TAGCTCTGGCCTGGGTGCAGTGG + Intergenic
1049339801 8:142105974-142105996 GGGCCCTGACCTGGAGGGAGTGG - Intergenic
1049357073 8:142194182-142194204 GAGCTCAGAGCTGGGAGGAGGGG - Intergenic
1049759713 8:144326507-144326529 GGGCCCCGACGTGGGAGCCGCGG - Exonic
1050478491 9:6065138-6065160 GAGCACTCACCAGGGAGCACTGG + Intergenic
1052990685 9:34517867-34517889 GGTCCCTGAGCTGGGAGCTGTGG + Intronic
1053062745 9:35044541-35044563 GAGCCCCTACCTGGGAACACAGG - Exonic
1053466474 9:38312196-38312218 GAGCCGTGACCTGGGAGGCGGGG - Intergenic
1053474937 9:38375842-38375864 CAGCCCCAGCCTGGGAGCAGTGG - Intergenic
1056234974 9:84585769-84585791 GAGTCCTAACCTTGGAGCGGAGG + Intergenic
1056731497 9:89169976-89169998 CATCCCTGACCTGGCAGGAGGGG - Intronic
1057367097 9:94432858-94432880 GAGAACTGTCCTGGGAGCTGAGG + Intronic
1057560323 9:96123077-96123099 GAGTCCTCCCCTGGGATCAGAGG + Intergenic
1057656238 9:96955212-96955234 GAGAACTGTCCTGGGAGCTGAGG - Intronic
1057805163 9:98214824-98214846 GTTCCCTCCCCTGGGAGCAGAGG - Intronic
1057840738 9:98483916-98483938 GCGCCCTGTTCTGGGAGCTGGGG - Intronic
1059281499 9:113137987-113138009 GAGCGCTGGCCTGGGATCAAGGG - Intergenic
1059335162 9:113564560-113564582 AAGCCCTGGACTGGGAGGAGAGG - Intronic
1060822781 9:126671206-126671228 GAGCTCTGAGCTGGGGGGAGGGG + Intronic
1060978225 9:127777602-127777624 GAGCCCAGGCCTGCGGGCAGGGG + Intronic
1061020255 9:128009732-128009754 AAGCCCTGAGATGGGAGGAGCGG - Intergenic
1061137057 9:128741027-128741049 CAGCACTGACCTAGGAGCATTGG - Intronic
1061217044 9:129227514-129227536 GAGCCTAGACCTGGGAGCAGGGG + Intergenic
1061275165 9:129565912-129565934 GAGCCCTCACCTGACTGCAGTGG - Intergenic
1061777746 9:132977300-132977322 GACCACAGAGCTGGGAGCAGTGG + Intronic
1061791566 9:133061813-133061835 TACCACTTACCTGGGAGCAGAGG - Intergenic
1061795244 9:133082371-133082393 TACCACTTACCTGGGAGCAGAGG - Intronic
1062032851 9:134369820-134369842 GAGCCTTGAACTAGGAGGAGGGG - Intronic
1062516539 9:136939799-136939821 GGGCCCAGAAGTGGGAGCAGAGG - Intronic
1062595744 9:137298409-137298431 GAGGCCTGGCCTGGCACCAGGGG - Intergenic
1062630974 9:137462910-137462932 GAGCCCTGACGTGGGGGTTGTGG + Intronic
1189185761 X:39053328-39053350 GAGCACATACATGGGAGCAGTGG - Intergenic
1189375012 X:40459809-40459831 GAGATCTGCCCTGGGAGTAGGGG - Intergenic
1189954577 X:46264052-46264074 GAGCCCAGACCTGGCCGCTGGGG + Intergenic
1195317585 X:103693925-103693947 GAACTCTGGCCTGGAAGCAGCGG - Intergenic
1196057154 X:111368077-111368099 GATCCCAGACCTAGGAACAGAGG + Intronic
1196122705 X:112067654-112067676 GGGCTCTGATCTGAGAGCAGTGG - Intronic
1198683771 X:139206550-139206572 TAGACCTGGACTGGGAGCAGGGG - Intronic
1199672135 X:150156110-150156132 GAGCCCAAAACTGGGAGAAGGGG + Intergenic