ID: 1105865869

View in Genome Browser
Species Human (GRCh38)
Location 13:24458712-24458734
Sequence TAGTGAGTTAGGTGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 472
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 435}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105865869 Original CRISPR TAGTGAGTTAGGTGGGTGGA GGG Intronic
900509468 1:3051711-3051733 GAGTGGGTTGGGTGGATGGATGG - Intergenic
900649840 1:3725424-3725446 TGGGTAGGTAGGTGGGTGGATGG + Intronic
900930846 1:5736287-5736309 GAGAGAGATGGGTGGGTGGATGG + Intergenic
901134395 1:6983747-6983769 TAGAGGGTTGGGTGGGTAGATGG + Intronic
901261788 1:7876504-7876526 TAGTGGGCTAGGTGGGTGAGTGG - Intergenic
901520068 1:9776772-9776794 GATAGAGATAGGTGGGTGGATGG - Intronic
901614157 1:10524796-10524818 TGGGGAGCTAGGTGGGAGGATGG - Intronic
902202655 1:14845310-14845332 TAGGTAGGTAGGTGGATGGACGG + Intronic
902412837 1:16221493-16221515 TAGACAGGCAGGTGGGTGGAGGG + Intergenic
902621829 1:17655290-17655312 TAGGTAGGTGGGTGGGTGGATGG - Intronic
902654969 1:17860762-17860784 TAGGCAGGTAGGTGGATGGATGG - Intergenic
902655013 1:17860938-17860960 TAGATGGATAGGTGGGTGGATGG - Intergenic
902755545 1:18547020-18547042 TATTGAGTTGGATGGGTGGGTGG - Intergenic
902941616 1:19804120-19804142 TACTCAGTTAGGGGTGTGGATGG + Intergenic
903175151 1:21576118-21576140 TAGACAGGCAGGTGGGTGGATGG + Intronic
903181043 1:21604978-21605000 TAGATGGGTAGGTGGGTGGATGG + Intronic
903341754 1:22659115-22659137 TAGAGAGATAGATGGATGGATGG + Intronic
903378979 1:22883970-22883992 CAGTGAGGTGGGTGGGTGGGGGG - Intronic
904303217 1:29569531-29569553 TGGATAGTTAGGTGGATGGAAGG + Intergenic
904487934 1:30839986-30840008 TAGACAGGTGGGTGGGTGGATGG + Intergenic
904565992 1:31428806-31428828 TGGTTAGTGAGGTGGGTGGTAGG + Intronic
904941258 1:34166023-34166045 TGGGGAGTGAGGTTGGTGGAAGG + Intergenic
905247252 1:36623757-36623779 GGGCGAGTTAGGTGGTTGGAGGG + Intergenic
905328665 1:37176446-37176468 AGGTCATTTAGGTGGGTGGATGG + Intergenic
906143532 1:43547175-43547197 GGGTGAGTGGGGTGGGTGGAGGG - Intronic
906674165 1:47681235-47681257 CAGTGAGTGTGTTGGGTGGACGG + Intergenic
907427799 1:54391875-54391897 GATTGAGGTGGGTGGGTGGAGGG - Intronic
907512568 1:54972742-54972764 TTCTGGGTTGGGTGGGTGGAGGG + Intergenic
908792297 1:67794881-67794903 TTGGCAGGTAGGTGGGTGGATGG - Intronic
911047776 1:93642777-93642799 GAGAGGCTTAGGTGGGTGGAGGG + Intronic
912008129 1:104929678-104929700 GAGAGTGTTGGGTGGGTGGATGG + Intergenic
913536794 1:119780741-119780763 CAGCGAGTTGAGTGGGTGGAAGG - Intergenic
915262211 1:154685136-154685158 TAGCGGGTTAGGTGGGCAGAAGG + Intergenic
917094533 1:171386796-171386818 GAGAGATTTAGGTGGGAGGATGG + Intergenic
917728995 1:177855350-177855372 GAGTGAGTGAGGTGGGGGGATGG + Intergenic
920744295 1:208611664-208611686 TAGGTAGGTAGGTGGATGGATGG + Intergenic
920788076 1:209061898-209061920 TAGGGAGTGAGGGGGGTTGATGG + Intergenic
922209657 1:223477819-223477841 GAGTGAGTTTGGTGGAAGGAGGG - Intergenic
923814233 1:237358078-237358100 TCCTGGGTTAGGTGGGTAGAGGG - Intronic
1063140721 10:3254305-3254327 TAGGTGGGTAGGTGGGTGGATGG - Intergenic
1065153443 10:22846136-22846158 TAGTGAATGTGGTGGGTGGATGG - Intergenic
1066551840 10:36567554-36567576 TAGTGGGGTATGTGGGAGGAGGG - Intergenic
1067233330 10:44426866-44426888 TGCTGAGTTGGGTGTGTGGAGGG + Intergenic
1067751909 10:48977389-48977411 TAGAGAGATGGATGGGTGGATGG - Intronic
1068717403 10:60203179-60203201 AACTGATTTAGATGGGTGGATGG - Intronic
1070001632 10:72382459-72382481 TAGTGAGTGATGTGGGTTGGGGG + Intronic
1070678956 10:78435387-78435409 CAGGGAGTTGGGTGGGTGGAGGG - Intergenic
1070692367 10:78536687-78536709 TAGTGCCTGGGGTGGGTGGAAGG - Intergenic
1070793725 10:79204763-79204785 TAGTTAGATGGGTGGGTGGGTGG + Intronic
1071312225 10:84353609-84353631 TCCTGACTTAGGTGGGTGAATGG + Intronic
1071802941 10:89085036-89085058 TAATGAGTTACCTGGGTGAAGGG + Intergenic
1072736620 10:97883494-97883516 TGATGAATGAGGTGGGTGGATGG + Intronic
1073389918 10:103166287-103166309 TAGAGATTGGGGTGGGTGGAGGG - Intronic
1073944049 10:108730206-108730228 GAGGGAGGTAGGTAGGTGGAGGG + Intergenic
1074425186 10:113344429-113344451 TGGGGAGGTGGGTGGGTGGAGGG + Intergenic
1075600388 10:123763356-123763378 TAGTGAGGTCTGTGGTTGGATGG - Intronic
1075685730 10:124364114-124364136 TAGAGGGGTGGGTGGGTGGAAGG - Intergenic
1075926190 10:126253684-126253706 TTGTGGGTTGGGTGGGGGGAGGG + Intronic
1076281245 10:129248262-129248284 TAGACAGTTGGGTGAGTGGATGG + Intergenic
1076867353 10:133174617-133174639 TAGGTGGATAGGTGGGTGGATGG + Intronic
1076867725 10:133176228-133176250 TATGTAGTTAGATGGGTGGATGG + Intronic
1077248533 11:1550692-1550714 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248567 11:1550818-1550840 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248601 11:1550936-1550958 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248636 11:1551062-1551084 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248727 11:1551379-1551401 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248775 11:1551557-1551579 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248792 11:1551614-1551636 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248863 11:1551862-1551884 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077302042 11:1851924-1851946 TGGTGTGTTTGGTGGGTGGGGGG + Intergenic
1077357650 11:2126147-2126169 GTGAGAGTTAAGTGGGTGGATGG + Intergenic
1077383439 11:2258064-2258086 CAGGGAGATGGGTGGGTGGAGGG - Intergenic
1077599776 11:3566178-3566200 TAGATGGGTAGGTGGGTGGATGG + Intergenic
1079298881 11:19259684-19259706 GGATGAGTTAGATGGGTGGATGG - Intergenic
1079505322 11:21146642-21146664 ATGAGAGTGAGGTGGGTGGATGG + Intronic
1079971414 11:27040400-27040422 GAGGGTGTTAGGTGGGAGGAGGG + Intergenic
1080355988 11:31446523-31446545 TAGTCTGTTACGTGGGAGGATGG - Intronic
1080578051 11:33617826-33617848 TGGATAGGTAGGTGGGTGGATGG + Intronic
1081156765 11:39702963-39702985 TTATGAGTGAGGTGGGTGGGGGG - Intergenic
1081279285 11:41188146-41188168 TTGTGTGTTGGGTGGGAGGAGGG - Intronic
1081591127 11:44423916-44423938 TGGTGAGTGAGGCGGGGGGAGGG - Intergenic
1084255686 11:67940791-67940813 TAGGTGGGTAGGTGGGTGGATGG + Intergenic
1084413393 11:69016676-69016698 TAGATGGTTTGGTGGGTGGATGG - Intergenic
1084491650 11:69481824-69481846 TAGGGAGGGAGGTGGGTGAATGG + Intergenic
1084609874 11:70195217-70195239 TAGATAGATAGGTGGATGGATGG + Intergenic
1084817066 11:71654527-71654549 TAGGTGGGTAGGTGGGTGGATGG - Intergenic
1085534574 11:77210381-77210403 TGGTGAGTTAGGTAGGTGAGTGG + Intronic
1085763123 11:79259525-79259547 TGGGTAGGTAGGTGGGTGGATGG - Intronic
1086123451 11:83326023-83326045 CAGTGAGTTGGGTGAGTGGATGG + Intergenic
1086579019 11:88375098-88375120 GAGGGAGTGAGGTGGGTGGCAGG - Intergenic
1087250440 11:95893080-95893102 TAGTGAGTGAGGAGGATGGGTGG - Intronic
1088969551 11:114760877-114760899 GAGTGATTAATGTGGGTGGATGG - Intergenic
1089404559 11:118186826-118186848 TACAGAGTTAGGTGGGTGGATGG - Intergenic
1089854734 11:121533229-121533251 TGGTGCGTTAGGTTGGTGGGGGG + Intronic
1089884724 11:121808976-121808998 TAGTGAGAGAGGTGGGTGCAGGG - Intergenic
1091187319 11:133658342-133658364 TAGGTAGATAGGTGGGTGGATGG + Intergenic
1091450140 12:567500-567522 TGGAGAGATTGGTGGGTGGATGG + Intronic
1091670005 12:2446150-2446172 TAGGTAGGTAGGTGGATGGATGG + Intronic
1092074810 12:5664255-5664277 TAGGTAGATGGGTGGGTGGATGG - Intronic
1092425922 12:8375517-8375539 TAGATGGGTAGGTGGGTGGATGG + Intergenic
1092449516 12:8588927-8588949 TAGTGAATACGGTGGGTGGGGGG - Intergenic
1094555347 12:31494192-31494214 TAGGTAGGTAGGTGGATGGATGG - Intronic
1094555348 12:31494196-31494218 TAGGTAGGTAGGTAGGTGGATGG - Intronic
1096318444 12:50589673-50589695 CAGTGAGTTAGGAGAGTGGTGGG + Intronic
1096597024 12:52702326-52702348 TTGTGGGCTAGATGGGTGGATGG + Intronic
1097686305 12:62694097-62694119 TAGTCAGTGTGGTGAGTGGATGG - Intronic
1098413339 12:70204853-70204875 TAGAGAGTTGGTGGGGTGGATGG + Intergenic
1101063069 12:100991479-100991501 TAGGGGGTGAGGTGGGAGGAGGG + Intronic
1101094085 12:101318075-101318097 TGGTGGGGAAGGTGGGTGGAAGG - Intronic
1101246230 12:102886401-102886423 TTGTAATTTAGGTGGGTGGTTGG - Intronic
1102996250 12:117353048-117353070 TAGGTAGGTAGGTGGGTGGATGG - Intronic
1103613495 12:122138070-122138092 TAGAGAGCTACGTGGGAGGAGGG - Intronic
1103908392 12:124339094-124339116 TAGGTAGGTAGGTGGGAGGAAGG - Intronic
1103908538 12:124339658-124339680 TAGGTAGGTGGGTGGGTGGAAGG - Intronic
1104334510 12:127880846-127880868 TAGGTAGGTAGGTAGGTGGATGG - Intergenic
1104357634 12:128101708-128101730 TAGAGAGACAGCTGGGTGGAGGG - Intergenic
1104519668 12:129461718-129461740 TAGAGAGGTGGGTGGGTGGGTGG + Intronic
1104766059 12:131331070-131331092 TGGATAGGTAGGTGGGTGGATGG - Intergenic
1104779323 12:131409756-131409778 TAGGTAGTTGGGTGGATGGATGG - Intergenic
1104888123 12:132124085-132124107 TAGACAGGTAGGTGGGTGAATGG - Intronic
1104954550 12:132457842-132457864 TAGGTAGACAGGTGGGTGGATGG + Intergenic
1104968193 12:132519001-132519023 TTGTGATTCAGATGGGTGGATGG - Intronic
1105213956 13:18273711-18273733 CAGTGAGTTTTGAGGGTGGAGGG - Intergenic
1105865869 13:24458712-24458734 TAGTGAGTTAGGTGGGTGGAGGG + Intronic
1107279831 13:38721001-38721023 TTGTGAGTTTGGTTGGGGGAGGG + Intronic
1108003119 13:45922731-45922753 TCGGGAGTTAGGTGGGAGGATGG + Intergenic
1110184661 13:72658471-72658493 TAGGGAGAGTGGTGGGTGGAAGG - Intergenic
1110495884 13:76167342-76167364 TAGAGGGTTATGTGGATGGAAGG - Intergenic
1110992410 13:82058997-82059019 AAGGTAGGTAGGTGGGTGGATGG + Intergenic
1111871092 13:93833052-93833074 TAGAGAGATAGATGGATGGATGG + Intronic
1112439160 13:99413247-99413269 TAGAGAGATAGATGGGTGGGTGG + Intergenic
1116458363 14:45144306-45144328 TAGTGGGCGAGGGGGGTGGAGGG - Intronic
1117016617 14:51525003-51525025 TTGTGTGTTGGGTGGGTGGGTGG + Intronic
1117784025 14:59263874-59263896 TTGTGCTTTAAGTGGGTGGAGGG + Intronic
1117951709 14:61089524-61089546 CAGTGGCTTAGGTGGGAGGAGGG + Intergenic
1119193401 14:72699950-72699972 GAGGGAGGTTGGTGGGTGGAGGG + Intronic
1119696651 14:76718791-76718813 TATTGAGTTTGGGGGCTGGAAGG + Intergenic
1120887367 14:89462369-89462391 TAGTGGCTTAGGTAGGTGGGAGG - Intronic
1121096569 14:91221526-91221548 TGGTTGGGTAGGTGGGTGGATGG + Intronic
1121277432 14:92677864-92677886 TAGATGGATAGGTGGGTGGATGG - Intronic
1121630410 14:95417819-95417841 CAGTGGGTTAGGTGGGTGGTGGG + Exonic
1121637761 14:95465384-95465406 TGGGTAGCTAGGTGGGTGGATGG + Intronic
1121956460 14:98217929-98217951 TACTCAGTGAGGTGGATGGATGG + Intergenic
1122011514 14:98752966-98752988 TAGATGGGTAGGTGGGTGGATGG + Intergenic
1122428599 14:101625886-101625908 TGGTTAAGTAGGTGGGTGGATGG + Intergenic
1122471889 14:101973940-101973962 TATTGAGTTAGGTGGTTATAAGG - Intronic
1122958527 14:105083829-105083851 TAGAGAGATGGGTGGATGGAGGG - Intergenic
1122958586 14:105084088-105084110 TAGAGGGATGGGTGGGTGGATGG - Intergenic
1202837026 14_GL000009v2_random:85930-85952 TAGTGAGTGAGGTTGGTGGTGGG + Intergenic
1202837271 14_GL000009v2_random:87471-87493 CAGTGAGTGAGGTTGGTGGCCGG + Intergenic
1123552944 15:21399707-21399729 CAGTGAGTGAGGTTGGTGGCTGG - Intergenic
1123587197 15:21771234-21771256 TAGGTAGATGGGTGGGTGGATGG + Intergenic
1123588866 15:21835171-21835193 CAGTGAGTGAGGTTGGTGGCTGG - Intergenic
1123589190 15:21837095-21837117 CAGTGAGTGAGGTTGGTGGCTGG - Intergenic
1123623835 15:22213799-22213821 TAGGTAGATGGGTGGGTGGATGG + Intergenic
1124282518 15:28376331-28376353 TAGAGAGATAGATGGATGGATGG - Intergenic
1124449776 15:29777021-29777043 TATTGAGTGGGGGGGGTGGAAGG - Intronic
1125019621 15:34971841-34971863 CAGAGGGTTGGGTGGGTGGAGGG - Intergenic
1125074931 15:35602982-35603004 GAGGGAGGTAGGTGGGTGCATGG - Intergenic
1125592078 15:40860925-40860947 CTGGGAGTTTGGTGGGTGGAGGG + Intergenic
1127658584 15:61078795-61078817 TAGGTAGGTAGGTGGGTGGGTGG - Intronic
1127917998 15:63471197-63471219 TAGGTAGTTGGGTGGGTGGAAGG + Intergenic
1128523352 15:68390207-68390229 TTGTGAGTGAGGTGGGAAGAAGG + Intronic
1128539402 15:68515903-68515925 TAGGGAGGTAGGTGGGAGCAGGG - Intergenic
1129037880 15:72661918-72661940 CAGGGAGGTGGGTGGGTGGAAGG + Intronic
1129212009 15:74075309-74075331 CAGGGAGGTGGGTGGGTGGAAGG - Intronic
1129398394 15:75265776-75265798 CAGGGAGGTGGGTGGGTGGAAGG + Intronic
1129402002 15:75290051-75290073 CAGGGAGGTGGGTGGGTGGAAGG + Intronic
1129729135 15:77919630-77919652 CAGGGAGGTGGGTGGGTGGAAGG - Intergenic
1131370573 15:91877866-91877888 TAGGGAGTCAGGTGTTTGGATGG + Intronic
1202960969 15_KI270727v1_random:125003-125025 CAGTGAGTGAGGTTGGTGGCTGG - Intergenic
1202961293 15_KI270727v1_random:126927-126949 CAGTGAGTGAGGTTGGTGGCTGG - Intergenic
1132984858 16:2760030-2760052 TAGGGAGTGGGCTGGGTGGATGG + Intronic
1133372429 16:5255396-5255418 TAGATGGGTAGGTGGGTGGATGG - Intergenic
1133372493 16:5255688-5255710 TGGATAGATAGGTGGGTGGATGG - Intergenic
1133462720 16:6000886-6000908 TAGGTAGGTAGGTGGGTGGGTGG + Intergenic
1133495765 16:6315486-6315508 TAGGTAGATAGGTGGATGGATGG + Intronic
1134447064 16:14338644-14338666 TAGGGAGGTGGGTGGATGGATGG - Intergenic
1135400145 16:22161330-22161352 TAATGAATTAGATGGGTGGAAGG + Intergenic
1135793227 16:25417763-25417785 TGGAGAGGTAGGTGGATGGATGG - Intergenic
1138351157 16:56346953-56346975 TAGAGTGTTAGGTGGGAGCAGGG - Exonic
1139255193 16:65534378-65534400 AAGGGAGTGAGGTGGGTAGAAGG + Intergenic
1139430103 16:66906520-66906542 TAGGGAGATAGGAGGGTGCATGG - Intergenic
1141178046 16:81733573-81733595 TAGATGGATAGGTGGGTGGATGG - Intergenic
1141658073 16:85426632-85426654 TAGATGGGTAGGTGGGTGGATGG + Intergenic
1141819850 16:86437767-86437789 TAGATGGTTGGGTGGGTGGAAGG - Intergenic
1142152194 16:88517517-88517539 TGGTTGGATAGGTGGGTGGATGG + Intronic
1142661343 17:1431690-1431712 TAGTGACTGAGATGGGAGGATGG - Intronic
1143264087 17:5622764-5622786 TGGTTGGGTAGGTGGGTGGATGG - Intergenic
1143299701 17:5900315-5900337 TAGTGACATTGGTGGGTGGGTGG + Intronic
1146002326 17:29138929-29138951 TATTCAGGTTGGTGGGTGGAGGG - Intronic
1146171778 17:30640108-30640130 GAGTGAGGTAGGAGGCTGGAAGG - Intergenic
1146210124 17:30935769-30935791 AAGTGTGTTTGGTGGGTGTAGGG + Intronic
1146290970 17:31606980-31607002 TAGCGGGGTGGGTGGGTGGATGG - Intergenic
1146345233 17:32056133-32056155 GAGTGAGGTAGGAGGCTGGAAGG - Intergenic
1147374504 17:40015844-40015866 TGGTGAGTGAGGTGGGTGAGAGG + Exonic
1148160849 17:45449434-45449456 TAGGTAGATAGGTGGGTGAATGG - Intronic
1148191478 17:45681552-45681574 TAGTGTGGGAGGTGGGTGGAGGG - Intergenic
1149128605 17:53267117-53267139 TAGTTAGATAGCTGGATGGATGG - Intergenic
1149204286 17:54225971-54225993 GAGTGATTTATGTGGGAGGAAGG - Intergenic
1149500266 17:57147184-57147206 TCTTGAGTTAGGTGAATGGAGGG - Intergenic
1150479769 17:65500072-65500094 TAGTGTGATAGGGTGGTGGAAGG + Intergenic
1150861091 17:68801896-68801918 TAGTTAGTTAGGTGTGTCGTGGG + Intergenic
1152038024 17:77885253-77885275 TAGATAGATAGATGGGTGGATGG + Intergenic
1152067075 17:78117781-78117803 CAGTGAGTGGGGCGGGTGGAGGG - Exonic
1152615551 17:81336305-81336327 TAGATAGATGGGTGGGTGGATGG - Intergenic
1152751258 17:82063447-82063469 GAGTGAGTTGGCTGGGTGGATGG - Exonic
1152767119 17:82147706-82147728 TGGATAGATAGGTGGGTGGATGG + Intronic
1152767170 17:82147893-82147915 TGGATAGATAGGTGGGTGGATGG + Intronic
1152767203 17:82148008-82148030 TGGATAGATAGGTGGGTGGATGG + Intronic
1152767359 17:82148554-82148576 TGGATAGATAGGTGGGTGGATGG + Intronic
1153836480 18:8968825-8968847 TAGGTAGGTAGGTGGGTGGGTGG + Intergenic
1153944661 18:10008418-10008440 TAGGTGGGTAGGTGGGTGGATGG - Intergenic
1154377836 18:13823755-13823777 TAGTTAGTTGGGTAGGTGGGTGG - Intergenic
1154453531 18:14501180-14501202 TAGCGAGTGAGGTTGGTGGCTGG - Intergenic
1154951461 18:21214062-21214084 TAGTGAAGTAGGTAGGTGCATGG - Intergenic
1155980680 18:32176708-32176730 TGGGTAGATAGGTGGGTGGATGG - Intronic
1156371772 18:36477535-36477557 TAGGTAGGTAGGTGGGTGGGTGG - Intronic
1157299896 18:46472075-46472097 TAGATAGATGGGTGGGTGGATGG - Intergenic
1158211271 18:55053279-55053301 TAGTGAGTTAGGTGCATTTAGGG - Intergenic
1158784605 18:60694848-60694870 TAGAGAGTTAGATAGATGGATGG + Intergenic
1159023435 18:63161759-63161781 TAGTGCGTCAGGTGGGAAGACGG - Intronic
1159686983 18:71434769-71434791 TAGTGGTGGAGGTGGGTGGAGGG + Intergenic
1160692264 19:465528-465550 TAGATGGGTAGGTGGGTGGATGG + Intronic
1161131281 19:2590521-2590543 TGGTTGGTTGGGTGGGTGGATGG - Intronic
1161131341 19:2590745-2590767 TGGTTGGTTAGGTGGGTGGATGG - Intronic
1161131359 19:2590805-2590827 TAGTTGGTTGGGTGGGCGGATGG - Intronic
1161489332 19:4553344-4553366 GGGTGAGTTGGGTGGGTAGATGG + Intronic
1161489349 19:4553413-4553435 AGGTGAGTTGGATGGGTGGATGG + Intronic
1161657572 19:5525439-5525461 TAGATGGTTAGGTGGGTGGGTGG - Intergenic
1161657601 19:5525558-5525580 TAGATGGTTAGGTGGGTGGGTGG - Intergenic
1161695140 19:5762735-5762757 TAGAGAGATGGATGGGTGGATGG + Intronic
1161812842 19:6480546-6480568 TAGATAGGTGGGTGGGTGGATGG - Intronic
1161812843 19:6480550-6480572 TAGATAGATAGGTGGGTGGGTGG - Intronic
1161974060 19:7599282-7599304 GAGTGGGGTGGGTGGGTGGATGG - Intronic
1162388923 19:10377783-10377805 TAGGTGGATAGGTGGGTGGATGG + Intronic
1162467152 19:10849117-10849139 GGGTGAGTGAGGTGGGTGGCAGG - Intronic
1162990674 19:14300044-14300066 GAGTGAGGTAGGAGGCTGGAAGG + Intergenic
1163349174 19:16764625-16764647 CAGAAAGATAGGTGGGTGGATGG - Intronic
1163558766 19:18007043-18007065 CAGTGAGGTGTGTGGGTGGAGGG - Intronic
1163675624 19:18654027-18654049 TAGGTGGGTAGGTGGGTGGATGG - Intronic
1163721182 19:18898982-18899004 TAGGGAGGGAGGTGGGTGGGTGG - Intergenic
1164156359 19:22599866-22599888 TAGGGAGGTGGGTGGATGGAAGG + Intergenic
1164441859 19:28285005-28285027 TGGAGAGAAAGGTGGGTGGAGGG + Intergenic
1165759145 19:38310343-38310365 TGGCTAGATAGGTGGGTGGATGG - Intronic
1168400707 19:56084816-56084838 TGGGGAGTAAGCTGGGTGGAGGG + Intergenic
1202635372 1_KI270706v1_random:39880-39902 CAGTGAGTGAGGTTGGTGGCCGG - Intergenic
1202635609 1_KI270706v1_random:41420-41442 TAGTGAGTGAGGTTGGTGGTGGG - Intergenic
927707910 2:25308177-25308199 TAGGCAGGTAGGTGGGTGGGTGG + Intronic
928018377 2:27680548-27680570 GAGTGAGTGAGGTGGGAGGATGG + Intronic
929745262 2:44650429-44650451 TTGTGGGTTAGGTGGAGGGAAGG + Intronic
930782883 2:55240942-55240964 TAGTGACTTAAAGGGGTGGATGG + Intronic
931195122 2:60045029-60045051 TAGTTAGTTAGATGGGTGGATGG + Intergenic
931195123 2:60045033-60045055 TAGTTAGATGGGTGGATGGATGG + Intergenic
934300367 2:91773038-91773060 CAGTGAGTTTTGAGGGTGGAGGG + Intergenic
937158166 2:119736078-119736100 TAGTGAGATAGGTGGCAGGGTGG + Intergenic
939767399 2:146267927-146267949 TTGTGAGTTAGATGGGTGAATGG + Intergenic
940004688 2:148999710-148999732 TGGTGAGTGAGTTAGGTGGAGGG + Intronic
940068251 2:149653980-149654002 CAGTGAGTGAGGTGGGTTGGAGG - Intergenic
940685164 2:156839611-156839633 TAGTGAGTTATGTGGCTTGAGGG + Intergenic
941575286 2:167222349-167222371 GAGAGAGTTAGGTGGTGGGAAGG + Intronic
945387649 2:209222680-209222702 GAGTGAGTTGGTTGGGTGCATGG - Intergenic
946513978 2:220391764-220391786 TAGAGTGTGAGGTGGGTGCAGGG + Intergenic
948072423 2:235138527-235138549 TAGTGGGTGAGCTGGGTGGGAGG + Intergenic
948310317 2:236980782-236980804 AACTGAGTTCAGTGGGTGGAGGG + Intergenic
948605859 2:239134352-239134374 TAGGGAGTGAGGTGGGTGCCGGG + Exonic
1169667714 20:8056838-8056860 GAGTGAGGTAGGTGGGTTTAGGG + Intergenic
1171037897 20:21731022-21731044 TAGTTAGATATGTGGGTGAAAGG - Intergenic
1172963803 20:38818373-38818395 TAGTGAGTTGGGGGAGGGGAGGG + Intronic
1173012422 20:39194388-39194410 CAGAGAGTTAGGAGGGAGGAGGG - Intergenic
1173379046 20:42521036-42521058 TAGGTAGGTGGGTGGGTGGATGG - Intronic
1174295430 20:49542132-49542154 CAGAGAGGTAGGTGGGAGGAGGG + Intronic
1174711218 20:52707330-52707352 TAGATAGATAGGTGGATGGATGG - Intergenic
1175817850 20:61892967-61892989 TAGAGGGATAGATGGGTGGATGG + Intronic
1175901125 20:62360311-62360333 TAGGGGGGTGGGTGGGTGGATGG + Intronic
1176129841 20:63492079-63492101 TAGAGAGGTGGATGGGTGGATGG + Intronic
1176129885 20:63492235-63492257 TGGATAGGTAGGTGGGTGGATGG + Intronic
1176359417 21:5982601-5982623 TGGTGGGTTGGGTGGGTGGGTGG + Intergenic
1178689647 21:34740475-34740497 TGGGTAGATAGGTGGGTGGATGG - Intergenic
1179161342 21:38902131-38902153 TGGAGAGTTGGGTAGGTGGAAGG - Intergenic
1179644068 21:42764968-42764990 TTGTGGGGTGGGTGGGTGGATGG + Intronic
1179764101 21:43555949-43555971 TGGTGGGTTGGGTGGGTGGGTGG - Intronic
1180365102 22:11931806-11931828 TAGTGAGTGAGGTTGGTGGTGGG + Intergenic
1180365336 22:11933347-11933369 CAGTGAGTGAGGTTGGTGGCCGG + Intergenic
1180478026 22:15729530-15729552 GAGTGAGTGAGGTTGGTGGCTGG + Intergenic
1181338295 22:22157801-22157823 TAGAGAGAAAGGTGGGTGGAGGG + Intergenic
1181661735 22:24355455-24355477 TAGGTAGGTAGGTGGGTGGGTGG - Intronic
1181728889 22:24830556-24830578 TATTGACTAAGGTGGGTGGGAGG + Intronic
1181920887 22:26319663-26319685 TAGTGTGTTAGGTGGTGGCAAGG - Intronic
1182052638 22:27324913-27324935 TGGATAGATAGGTGGGTGGATGG + Intergenic
1182069319 22:27452364-27452386 TAGATAGCTGGGTGGGTGGATGG + Intergenic
1183660935 22:39220756-39220778 TAGGTAGATGGGTGGGTGGATGG + Intergenic
1184390160 22:44199210-44199232 CAGGCAGGTAGGTGGGTGGATGG - Intronic
1184410399 22:44322957-44322979 GGGTGAGGTTGGTGGGTGGATGG - Intergenic
1184410424 22:44323053-44323075 GGGTGGGTGAGGTGGGTGGATGG - Intergenic
1184410547 22:44323571-44323593 GGGTGGGTGAGGTGGGTGGATGG - Intergenic
1184444495 22:44539466-44539488 TGGGTAGTTAGGTGGGTGGGTGG + Intergenic
1184444496 22:44539470-44539492 TAGTTAGGTGGGTGGGTGGACGG + Intergenic
1184667824 22:45997817-45997839 GGCTGAGTTGGGTGGGTGGAAGG - Intergenic
1184731177 22:46371958-46371980 GAGTGAGTTGAGTGGATGGATGG - Intronic
1184938031 22:47739395-47739417 TAGTGAGTGGGGTGGGAGGTGGG + Intergenic
949525248 3:4896935-4896957 TAGTGACTGAGGTGGGTATAAGG - Intergenic
950122022 3:10488285-10488307 TAGATAGGTGGGTGGGTGGATGG - Intronic
950470530 3:13182570-13182592 TAGAGAGATGGGTGGGTGAATGG + Intergenic
950474352 3:13206097-13206119 TGGAGAGCTAGATGGGTGGATGG - Intergenic
950750852 3:15126975-15126997 TAGATGGGTAGGTGGGTGGATGG - Intergenic
951023461 3:17805613-17805635 GAGTGAGTGAGCTGTGTGGAAGG - Intronic
951144036 3:19205121-19205143 TAGATAGTTGGGTAGGTGGATGG - Intronic
952593357 3:34985181-34985203 TATGGAGTTAGTGGGGTGGAAGG + Intergenic
953193417 3:40710739-40710761 TAGAGTCTTAGGAGGGTGGATGG - Intergenic
953343623 3:42156675-42156697 TAGTCATTTATGTGGATGGATGG - Intronic
954436286 3:50498102-50498124 GAGTGGGGTAGGTGGCTGGAAGG + Intronic
955783401 3:62510107-62510129 TAGATAGGTGGGTGGGTGGATGG - Intronic
955783402 3:62510111-62510133 TAGGTAGATAGGTGGGTGGGTGG - Intronic
955993967 3:64658940-64658962 TAGTCACTTAGGTGGGAGTACGG - Intronic
956373826 3:68592675-68592697 CAGGGAGTAAGGTGGGGGGAGGG - Intergenic
956685798 3:71826081-71826103 CTGTTAGATAGGTGGGTGGATGG + Intergenic
956750948 3:72343585-72343607 TAGATAGATGGGTGGGTGGATGG - Intergenic
957934194 3:86921262-86921284 TACTGCGCTAGATGGGTGGAAGG + Intergenic
957960803 3:87248736-87248758 TAGAGAGTTAGGTGTGTTGGGGG + Intronic
959294527 3:104519197-104519219 TAGATAGTTCGGTGGGTAGAGGG - Intergenic
961283494 3:125781718-125781740 TAGATGGTAAGGTGGGTGGATGG - Intergenic
962945431 3:140164924-140164946 TAGGTAGATGGGTGGGTGGATGG + Intronic
962951357 3:140222322-140222344 TAGTGAGGGATGGGGGTGGAAGG + Intronic
962969059 3:140382080-140382102 TAGAGAGATGGGAGGGTGGAGGG - Intronic
965915918 3:173845585-173845607 TAGACAGATAGGTAGGTGGATGG + Intronic
967332134 3:188301088-188301110 TAGAGAGGCAGGAGGGTGGATGG - Intronic
969014211 4:4092491-4092513 TAGATGGGTAGGTGGGTGGATGG + Intergenic
969088612 4:4675376-4675398 TAGATGGATAGGTGGGTGGATGG - Intergenic
969448967 4:7262262-7262284 TAGATGGATAGGTGGGTGGATGG - Intronic
969448991 4:7262354-7262376 TAGATGGATAGGTGGGTGGATGG - Intronic
969500144 4:7547644-7547666 TTGGGAGGGAGGTGGGTGGAAGG - Intronic
969565338 4:7974199-7974221 TGGGTAGGTAGGTGGGTGGATGG - Intronic
969565455 4:7974641-7974663 TAGGTGGGTAGGTGGGTGGATGG - Intronic
969739768 4:9015917-9015939 TAGATGGGTAGGTGGGTGGATGG - Intergenic
970602245 4:17649876-17649898 TAGACAGATAGATGGGTGGATGG - Intronic
971802463 4:31309755-31309777 CTGTGAGTGAGGTGAGTGGAAGG - Intergenic
972132555 4:35856585-35856607 TAGTAAACTAGGTGGGAGGATGG - Intergenic
977754877 4:100656867-100656889 TAGTGAGTTGGTTGGGAGGAAGG + Intronic
977754938 4:100657515-100657537 TAGTGAGTTGGTTGGGAGGAGGG - Intronic
979013080 4:115396056-115396078 TAATGAGTGGTGTGGGTGGATGG + Intergenic
979768926 4:124498387-124498409 TGGTGAAGTGGGTGGGTGGATGG + Intergenic
979811691 4:125044128-125044150 AAGTGAGTTAGGTTGCTGGGTGG + Intergenic
980651552 4:135722903-135722925 TAGTGAATTAGCAGGGTTGAAGG + Intergenic
981142949 4:141291699-141291721 CAGTGAGCCAGGTGGGTGGGCGG + Intergenic
982061197 4:151605760-151605782 TATTGACTTAGGTTGATGGATGG + Intronic
982855901 4:160382556-160382578 TTGTAAGTTTGGTGGTTGGAGGG + Intergenic
983827532 4:172282333-172282355 TAGTCCTTTGGGTGGGTGGATGG - Intronic
1202762931 4_GL000008v2_random:127300-127322 TAGTGAGTGAGGTTGGTGGTGGG - Intergenic
985662903 5:1166199-1166221 TAGATGGTTAGGTGGATGGATGG - Intergenic
985758928 5:1734791-1734813 GGATGAGTGAGGTGGGTGGATGG + Intergenic
985793526 5:1945663-1945685 CAGTGACTCAGGTGGGTGCAAGG + Intergenic
986541773 5:8851968-8851990 TAGTGAGTGTGGTGGGAGGATGG - Intergenic
986969077 5:13311100-13311122 TAGGTAGGTAGGTGGGTGGGTGG + Intergenic
987242991 5:16020180-16020202 TAGTTAGGGAGGTAGGTGGATGG + Intergenic
987242992 5:16020184-16020206 TAGGGAGGTAGGTGGATGGATGG + Intergenic
987655830 5:20804741-20804763 TAGTGAGGAAGGTATGTGGAAGG + Intergenic
988767724 5:34399166-34399188 TAGTGAGGAAGGTATGTGGAAGG - Intergenic
988844335 5:35113485-35113507 TAGATAGGTGGGTGGGTGGATGG - Intronic
989621555 5:43389426-43389448 TAGTGAGATGGGTGGATGAATGG - Intronic
989664049 5:43832024-43832046 AAGTGGGGTAGGTGGGTGGATGG - Intergenic
989735510 5:44699097-44699119 TAGGGATTTAGGTGTGTGTATGG - Intergenic
990411055 5:55542016-55542038 TAGTGGGTTGAGTGGGTGGTAGG - Intergenic
993389581 5:87302226-87302248 TAGTGATGTAGGTGGGTTGGTGG + Intronic
994839977 5:104910976-104910998 TGGTGAGTAATGTGGGTGTAAGG - Intergenic
996876255 5:128243574-128243596 TAGTCAGTTGGGTAGTTGGATGG + Intergenic
1000204588 5:159046779-159046801 TTCTGAGTAAAGTGGGTGGAGGG + Intronic
1000214875 5:159145772-159145794 TAGTGAACTGGGTGGGTGGGAGG + Intergenic
1000322315 5:160144328-160144350 TAGTGGGATTGGTGGGTGAATGG + Intergenic
1001404275 5:171464648-171464670 TAGGTAGGTAGGTAGGTGGATGG - Intergenic
1001840396 5:174871344-174871366 TAGGTGGGTAGGTGGGTGGATGG - Intergenic
1002341621 5:178520011-178520033 TAGAGAGTTGGGTGAATGGATGG + Intronic
1003469733 6:6418051-6418073 TAGTGGGAGTGGTGGGTGGAGGG - Intergenic
1004628791 6:17401565-17401587 TAATGAGTTAGGTTGATTGATGG + Intronic
1005223908 6:23619964-23619986 TAGATAGGTAGGTGGGGGGAGGG + Intergenic
1008927027 6:56897832-56897854 TAGTGAGTCAGGAGGGAGCAGGG - Intronic
1010145643 6:72665949-72665971 TAGTGAGTAAGGTGGGTAACAGG - Intronic
1011389403 6:86835661-86835683 TAGTGGGTTAGGTTGGCGGTGGG - Intergenic
1012308405 6:97689154-97689176 TAGTGAGATAGCCAGGTGGAAGG + Intergenic
1012647344 6:101702702-101702724 GAGTGATTTAGGTGTGGGGAAGG + Intronic
1013309347 6:108879172-108879194 TAGGTGGATAGGTGGGTGGATGG - Intronic
1013394253 6:109718571-109718593 TTGTGTGTTAGGTGGCTGCAGGG + Intronic
1014713145 6:124832801-124832823 GAGTGTGTGAGGTGGGTTGAAGG - Intergenic
1015328824 6:131953452-131953474 GAGTGAGGTAGGTGGGAGAAGGG + Intergenic
1015861430 6:137684619-137684641 TGATGAGTTAAGTGAGTGGAGGG + Intergenic
1015984768 6:138873936-138873958 TAGGTAGGTAGGTAGGTGGATGG - Intronic
1016681371 6:146833194-146833216 TTGTGTGTTGGGTGGGTGGCAGG - Intergenic
1016900668 6:149097542-149097564 TAGTGGGCTAGGTGTGTGGGTGG - Intergenic
1017530053 6:155280782-155280804 TCTTGAGTTTGGTGGGTGGATGG - Intronic
1017821718 6:158053864-158053886 TAGATGGATAGGTGGGTGGATGG - Intronic
1018893450 6:167997627-167997649 CAGTGAGAGACGTGGGTGGAAGG - Intronic
1019503626 7:1378747-1378769 TAGAGAGATAGGTGGATGGATGG + Intergenic
1022355241 7:29608726-29608748 TATTTAGTTAGGTGGTTGCAAGG + Intergenic
1022516277 7:30976844-30976866 TAGGTGGTTAGGTGAGTGGATGG - Intronic
1022968530 7:35496428-35496450 CAGTGCGTCAGGTGGATGGATGG - Intergenic
1023641642 7:42264896-42264918 GAGTGAGAAAGGTGGGTGAAGGG + Intergenic
1026161197 7:67870202-67870224 TGGTTAGATGGGTGGGTGGATGG + Intergenic
1026550800 7:71366799-71366821 TAGGGAGTCAGGTGTGAGGAAGG - Intronic
1026904317 7:74054131-74054153 CAGAGAGTTAGGTGGTTGGGTGG + Intronic
1027533605 7:79367406-79367428 GAGTGATTTTGGAGGGTGGAAGG + Intronic
1029072874 7:97914121-97914143 TAGATGGGTAGGTGGGTGGATGG + Intergenic
1030429828 7:109431183-109431205 AAGTGAGGAAGGTGGGAGGAAGG - Intergenic
1032434303 7:131887664-131887686 TAGGGAGTTGGAGGGGTGGATGG - Intergenic
1035047969 7:155981588-155981610 TAGGTAGATAGATGGGTGGAAGG - Intergenic
1035330170 7:158091667-158091689 TGGTTGGTTGGGTGGGTGGATGG + Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035964577 8:4176473-4176495 TAGTGAGTGAGGAGGTTAGAAGG - Intronic
1036584076 8:10106882-10106904 TAGAGGGGTAGGCGGGTGGAGGG - Intronic
1036624791 8:10460530-10460552 TAGAGACTTAGGCGGGTGGTGGG + Intergenic
1036775183 8:11606866-11606888 TATTGAGTTCGATGGGAGGAAGG - Intergenic
1036897022 8:12644276-12644298 TAGATAGGTAGGTGGGTGGATGG + Intergenic
1037820802 8:22133701-22133723 TAGGGATGTAGGTGGGTGGGCGG - Intergenic
1038252584 8:25919427-25919449 TAGTGACTTTGCTGAGTGGAAGG - Intronic
1038845502 8:31225854-31225876 TAGGGTGTTACGTGTGTGGAGGG - Intergenic
1039192247 8:34989605-34989627 TAGTCAGTTACATGGGTGGGGGG - Intergenic
1041523324 8:58778409-58778431 TAGTGAGGAGGGTGGGAGGAGGG + Intergenic
1042402154 8:68361961-68361983 TAGTCAGTTATGTGAGTTGATGG + Intronic
1042941399 8:74112344-74112366 CAATGAGAGAGGTGGGTGGAGGG + Intergenic
1043871859 8:85441949-85441971 TGGTCAGTTTGCTGGGTGGATGG - Intronic
1044386124 8:91590844-91590866 TACTGACTTTGGAGGGTGGAAGG + Intergenic
1044829192 8:96229390-96229412 TAGGGAGCCGGGTGGGTGGAGGG - Intronic
1045652963 8:104358849-104358871 TACTGACTTAGGTAGGTGGCGGG + Intronic
1046588367 8:116175753-116175775 GAGGGAGTGAGGTGGGAGGAAGG + Intergenic
1048018365 8:130517338-130517360 TTGTGAGTGGGGTGTGTGGAGGG + Intergenic
1048758965 8:137770648-137770670 CAGTGAGCTCGGTGGGTAGATGG + Intergenic
1049582452 8:143418722-143418744 TGGTCAGTTGGGTGGATGGATGG - Intergenic
1050050250 9:1592558-1592580 GAGTGAGTAAGGTGTGGGGATGG + Intergenic
1050354175 9:4767812-4767834 TAGTGAGTTATTGGGGTGGTTGG + Intergenic
1052036167 9:23683621-23683643 GAGGGGGTTAGGTGGGTGGGAGG - Intergenic
1052436028 9:28430267-28430289 ATGTGACTTAGGTGGGTGAAAGG + Intronic
1053007870 9:34615972-34615994 TGGGGAGGTAGGTGGATGGATGG - Intronic
1054706675 9:68469812-68469834 AAGGAAGATAGGTGGGTGGAAGG + Intronic
1055056638 9:72030069-72030091 TTGTTGGTTGGGTGGGTGGATGG - Intergenic
1055641144 9:78319948-78319970 TAGATGGGTAGGTGGGTGGATGG - Intronic
1056072054 9:82997527-82997549 TAGGGAGTATTGTGGGTGGATGG + Intronic
1056272545 9:84960508-84960530 TTTTGAGATAGGTAGGTGGATGG + Intronic
1057569240 9:96191414-96191436 AAGTGATTTTGGTGGGTGGAGGG - Intergenic
1057678231 9:97152915-97152937 CAGTGAGTGAGGTTGGTGGCTGG - Intergenic
1059055643 9:110976559-110976581 TGGAGAGTTAGGTTGGTGGCAGG - Intronic
1059807800 9:117822826-117822848 TAGAGAGTGAAGAGGGTGGAGGG - Intergenic
1060413668 9:123415956-123415978 TAGTGATTTGGGTGGGAAGAGGG + Intronic
1060552088 9:124490447-124490469 TGGGGAGTGAGGTGGGTGGCCGG + Intronic
1061402027 9:130373650-130373672 TGGATAGGTAGGTGGGTGGATGG + Intronic
1061478256 9:130883613-130883635 TAGAGAGTGATGTGGGTGGGTGG - Intronic
1061963371 9:133999141-133999163 TAGAGAGATGGATGGGTGGATGG - Intergenic
1062112355 9:134789005-134789027 TAGACAGGTAGGTGGGTGGTTGG + Intronic
1203543694 Un_KI270743v1:112181-112203 TAGTGAGTGAGGTTGGTGGTGGG - Intergenic
1185755497 X:2650131-2650153 TAGATAGATAGATGGGTGGATGG + Intergenic
1185867972 X:3639565-3639587 TTGGGGGGTAGGTGGGTGGATGG + Intronic
1186961454 X:14741134-14741156 TAGGGAGTTAATTGGGTGTATGG + Intergenic
1190320082 X:49174939-49174961 TTGTGACTTAGGTGGGGGCATGG - Exonic
1191101611 X:56735573-56735595 TAGGGAGCCGGGTGGGTGGAGGG - Intergenic
1192692129 X:73374983-73375005 AATTGAGCTTGGTGGGTGGAGGG + Intergenic
1195129827 X:101840969-101840991 TATTTAGTTAGAGGGGTGGAAGG - Intronic
1195176409 X:102318854-102318876 TATTTAGTTAGAGGGGTGGAAGG + Intronic
1195182455 X:102368239-102368261 TATTTAGTTAGAGGGGTGGAAGG - Intronic
1198229738 X:134677620-134677642 TAGTGAGTAAGGAGAGTGGTAGG + Intronic
1198233496 X:134715447-134715469 CAGTGTGTTAGGGGGGTGGGGGG - Intronic
1198666890 X:139034361-139034383 GAGTGAGTTAGCTGGGTGAATGG + Intronic
1199350174 X:146790817-146790839 TTGTGGGCTGGGTGGGTGGAAGG - Intergenic
1199401628 X:147405562-147405584 AATGGAGTTAGGTGGGGGGAGGG + Intergenic